Molecular Characterization of Dactylogyroides tripathii (Monogenea, Dactylogyridae) Using Long Subunit rDNA from North East Region of India
The present study describes the molecular characterization of the monogenea Dactylogyroides tripathii (Tripathi, 1959) Gussev, 1973 infecting the gill filaments of fish, Puntius ticto from River Brahmaputra, Guwahati, Assam, India. This study shows the D. tripathii species identification resulted fr...
Gespeichert in:
| Veröffentlicht in: | Вестник зоологии |
|---|---|
| Datum: | 2013 |
| Hauptverfasser: | , , |
| Format: | Artikel |
| Sprache: | Englisch |
| Veröffentlicht: |
Інститут зоології ім. І.І. Шмальгаузена НАН України
2013
|
| Schlagworte: | |
| Online Zugang: | https://nasplib.isofts.kiev.ua/handle/123456789/109839 |
| Tags: |
Tag hinzufügen
Keine Tags, Fügen Sie den ersten Tag hinzu!
|
| Назва журналу: | Digital Library of Periodicals of National Academy of Sciences of Ukraine |
| Zitieren: | Molecular Characterization of Dactylogyroides tripathii (Monogenea, Dactylogyridae) Using Long Subunit rDNA from North East Region of India / H.R. Chiary, A. Chaudhary, H.S. Singh // Вестник зоологии. — 2013. — Т. 47, № 5. — С. 451–455. — Бібліогр.: 24 назв. — англ. |
Institution
Digital Library of Periodicals of National Academy of Sciences of Ukraine| _version_ | 1859892940428541952 |
|---|---|
| author | Chiary, H.R. Chaudhary, A. Singh, H.S. |
| author_facet | Chiary, H.R. Chaudhary, A. Singh, H.S. |
| citation_txt | Molecular Characterization of Dactylogyroides tripathii (Monogenea, Dactylogyridae) Using Long Subunit rDNA from North East Region of India / H.R. Chiary, A. Chaudhary, H.S. Singh // Вестник зоологии. — 2013. — Т. 47, № 5. — С. 451–455. — Бібліогр.: 24 назв. — англ. |
| collection | DSpace DC |
| container_title | Вестник зоологии |
| description | The present study describes the molecular characterization of the monogenea Dactylogyroides tripathii (Tripathi, 1959) Gussev, 1973 infecting the gill filaments of fish, Puntius ticto from River Brahmaputra, Guwahati, Assam, India. This study shows the D. tripathii species identification resulted from the use of molecular data, particularly the 28S rDNA gene. We compared the 28S partial rDNA sequence of D. tripathii with same gene region of the other species of monogeneans available in GenBank. With this comparison, we determined that the sequence had a similarity with one available species of the genus Dactylogyroides Gussev, 1963 i. e., D. longicirrus and also with the species of Dactylogyrus from which this genus was distinguished.
Представлена молекулярная характеристика моногенеи Dactylogyroides tripathii (Tripathi, 1959) Gussev, 1973 инфицирующую жаберные волоски рыбы Puntius ticto из реки Брахмапутра, Гувахати, Ассам, Индия. Это исследование показывает идентификацию вида D. tripathii с помощью использования молекулярных данных, в частности гена 28S рДНК. Мы сравнили 28S частичной рДНК последовательности вида D. tripathii с той же областью гена другого вида моногеней, доступного в GenBank. С помощью этого сравнения мы определили, что последовательность имела сходство с одним из доступных видов рода Dactylogyroides Gussev, 1963, то есть с видом D. Longicirrus, а также с видами Dactylogyrus, от которых отличается этот род.
|
| first_indexed | 2025-12-07T15:54:27Z |
| format | Article |
| fulltext |
UDC 595.122.1:575.1(540)
MOLECULAR CHARACTERIZATION OF DACTYLOGYROIDES
TRIPATHII (MONOGENEA, DACTYLOGYRIDAE) USING LONG
SUBUNIT rDNA FROM NORTH EAST REGION OF INDIA
H. R. Chiary, A. Chaudhary, H. S. Singh
Molecular Taxonomy Laboratory, Department Of Zoology,
Chaudhary Charan Singh University, Meerut (U. P.), 250004 India
E-mail: anshu8282@rediffmail.com
Molecular Characterization of Dactylogyroides tripathii (Monogenea, Dactylogyridae) Using Long Subunit
rDNA from North East Region of India. Chiary H. R., Chaudhary A., Singh H. S. — The present study
describes the molecular characterization of the monogenea Dactylogyroides tripathii (Tripathi, 1959)
Gussev, 1973 infecting the gill filaments of fish, Puntius ticto from River Brahmaputra, Guwahati, Assam,
India. This study shows the D. tripathii species identification resulted from the use of molecular data,
particularly the 28S rDNA gene. We compared the 28S partial rDNA sequence of D. tripathii with
same gene region of the other species of monogeneans available in GenBank. With this comparison, we
determined that the sequence had a similarity with one available species of the genus Dactylogyroides
Gussev, 1963 i. e., D. longicirrus and also with the species of Dactylogyrus from which this genus was
distinguished.
Key wo rd s : Dactylogyroides tripathii, 28S rDNA, Assam, India.
Ìîëåêóëÿðíàÿ õàðàêòåðèñòèêà Dactylogyroides tripathii (Monogenea, Dactylogyridae) ñ èñïîëüçîâà-
íèåì äëèííûõ ñóáúåäèíèö ðÄÍÊ èç Ñåâåðî-âîñòî÷íîãî ðåãèîíà Èíäèè. ×èàðè Õ. Ð., ×àóäàðè À.,
Ñèíãõ Õ. Ñ. — Ïðåäñòàâëåíà ìîëåêóëÿðíàÿ õàðàêòåðèñòèêà ìîíîãåíåè Dactylogyroides tripathii
(Tripathi, 1959) Gussev, 1973 èíôèöèðóþùóþ æàáåðíûå âîëîñêè ðûáû Puntius ticto èç ðåêè Áðàõ-
ìàïóòðà, Ãóâàõàòè, Àññàì, Èíäèÿ. Ýòî èññëåäîâàíèå ïîêàçûâàåò èäåíòèôèêàöèþ âèäà D. tripathii
ñ ïîìîùüþ èñïîëüçîâàíèÿ ìîëåêóëÿðíûõ äàííûõ, â ÷àñòíîñòè ãåíà 28S ðÄÍÊ. Ìû ñðàâíèëè
28S ÷àñòè÷íîé ðÄÍÊ ïîñëåäîâàòåëüíîñòè âèäà D. tripathii ñ òîé æå îáëàñòüþ ãåíà äðóãîãî âèäà
ìîíîãåíåé, äîñòóïíîãî â GenBank. Ñ ïîìîùüþ ýòîãî ñðàâíåíèÿ ìû îïðåäåëèëè, ÷òî ïîñëåäîâà-
òåëüíîñòü èìåëà ñõîäñòâî ñ îäíèì èç äîñòóïíûõ âèäîâ ðîäà Dactylogyroides Gussev, 1963, òî åñòü ñ
âèäîì D. Longicirrus, à òàêæå ñ âèäàìè Dactylogyrus, îò êîòîðûõ îòëè÷àåòñÿ ýòîò ðîä.
Êëþ÷åâûå ñëîâà : Dactylogyroides tripathii, 28S ðÄÍÊ, Àññàì, Èíäèÿ.
Introduction
Dactylogyroides was proposed by Gussev, 1963 for the worms previously described under the genus Dacty-
logyrus Diesing, 1850 viz., Dactylogyrus tripathii (Tripathi, 1959) Gussev, 1973 from Puntius ticto and P. stigma
at Lucknow, India. These are the parasites of freshwater cyprinids. Gussev (1963) differentiated the genus from
Dactylogyrus in having anchors with their points directed towards each other, the dorsal bar usually double or
single with a different degree of separation into two parts. On this basis Dactylogyrus tripathii Tripathi, 1959
was transferred to the new genus Dactylogyroides Gussev, 1963.
The use of molecular tools for the identification of parasites has become commonplace. The nuclear
rDNA gene regions have also been used extensively in the study of phylogeny at several different taxonomic
levels. So far, in platyhelminth systematics, rDNA genes, have been used successfully (Šimková et al., 2006;
Lee et al., 2007; Chiary et al., 2013) with 28S rDNA, in particular, to estimate the relationships existing
among the Platyhelminthes (Olson et al., 2003). Monogenean sequences of partial 28S rDNA have been used
successfully to study phylogenetic relationships (Mollaret et al., 2000 a; 2000 b; Justine et al., 2002; Olson,
Littlewood, 2002; Whittington et al., 2004; Wu et al., 2008; Šimková et al., 2006; Lee et al., 2007; Chaudhary,
Singh, 2012; Verma et al., 2012).
The aim of the present study is to characterized Dactylogyroides tripathii found infecting the fish P. ticto
from River Brahmaputra, Guwahati, Assam, India using partial sequence of the 28S rDNA.
Vestnik zoologii, 47(5): e-52–e-56, 2013
DOI 10.2478/vzoo-2013-0048
Êðàòêèå ñîîáùåíèÿ
Unauthenticated
Download Date | 12/15/16 7:15 PM
53 H. R. Chiary, A. Chaudhary, H. S. Singh
Material and methods
Monogeneans were collected from the gills of Puntius ticto Hamilton, from River Brahmaputra at the
site Guwahati (26°11ђ N and 91°44ђ E). After the fish identification, they were killed by a sharp blow
on the top of the head and dissected. Methods of collection, extraction, amplification and sequencing of
monogeneans were followed from Singh and Chaudhary (2010) using specifically designed primer (forward,
5ђ–TCTAGTAACGGCGAGTGAACG–3ђ) and (reverse, 5ђ–GGTGGAAGGTCTACCTCAGC–3ђ). The
specimens of D. tripathii have been deposited in the Museum, Department of Zoology (voucher number HS/
monogenea/2012/11), Chaudhary Charan Singh University, Meerut (U. P.), India. The obtained sequence
that included the partial 28S sequence was submitted to GenBank under accession number JX993982.
For phylogenetic analysis, GenBank was first queried to retrieve 28S sequences from monogeneans and
then aligned using ClustalW implemented in MEGA 5.05 (Tamura et al., 2011). Phylogenetic trees were
reconstructed using Neighbour Joining and Minimum Evolution methods by MEGA 5.05. In reconstructing the
NJ tree, the Kimura two-parameter model was used to estimate the distances. Kimura’s two-parameter model
(1980) corrects for multiple hits, taking into account transitional and transversional substitution rates, while
assuming that the four nucleotide frequencies are the same and that rates of substitution do not vary among
sites. Robustness of the inferred phylogeny was assessed using a bootstrap procedure with 1,000 replications.
Results
A 733 bp fragment of the 28S rDNA sequence was amplified from the specimens
of D. tripathii. Nucleotide frequencies (percent) were T = 215, C = 144, A = 167, and
G = 207. Phylogenetic tree of long subunit sequences showed similar grouping using
the different methods employed (fig. 1, 2). The phylogenetic reconstructions inferred
from analyses of the 28S rDNA sequences showed great resolution for the species of the
monogeneans. This species shows nucleotide identity of 90 % with the different species
of genus Dactylogyrus from which it was originally differentiated by Gussev (1963)
including one species of same genus viz., Dactylogyroides longicirrus (91 %).
Fig. 1. Neighbor joining (NJ) tree of Dactylogyroides tripathii showed its phylogenetic relationship with other
species of monogeneans; bootstrap values are indicated in the nodes.
Ðèñ. 1. Äåíäðîãðàììà ïî ìåòîäó ñâÿçûâàíèÿ áëèæàéøèõ ñîñåäåé (NJ — ìåòîä) Dactylogyroides tripathi,
îòîáðàæàþùàÿ îòíîøåíèÿ ñ äðóãèìè âèäàìè ìîíîãåíåé; áóòñòðåïíûå çíà÷åíèÿ óêàçàíû â óçëàõ.
Unauthenticated
Download Date | 12/15/16 7:15 PM
54The Chorionic Sculpture in Eggs of Some Noctuidae (Lepidoptera)
Discussion
Delimiting species of Dactylogyroides monogeneans is often difficult, owing to their
limited morphological characters, and it may have resulted in a gross estimation of the
true number of species. About fourteen species of this genus have been described from
India on the basis of morphological analysis and from these till now only one species
viz., D. longicirrus (Tripathi, 1959) Gussev, 1973 has been characterized at molecular
level (Singh, Chaudhary, 2010).
Gussev (1973) recorded four related monogeneans of genus Dactylogyroides from
the different piscine hosts Puntius stigma, Barbus mahecola and B. dorsalis. But the origi-
nal description of these specimens was not completed and the author (Gussev, 1973)
was not sure about the taxonomic status of these worms. So, the taxonomic status of
these species viz., Dactylogyroides tripathii f. dorsalis, D. tripathii f. filamentosi, D. tripathii
f. mahecoli and D. tripathii f. stigma suffers from serious lapses.
Moreover, Dubey et al. (1997) redescribed Dactylogyroides tripathii (Tripathi, 1959)
Gussev, 1973 from Puntius sophore at Raipur. Agrawal et al., (2002) made a comprehen-
sive review of Indian species of Dactylogyroides Gussev, 1963. The evaluation of morpho-
logical criteria for phylogenetic and taxonomic studies of the monogeneans seems to be
the most controversial area (Desdevises, 2001; Wu et al., 2006, 2007; Chaudhary, Singh,
2012). 28S region analyses in this study revealed that this gene is a good phylogenetic
marker for inferring relationship between closely related species. DNA based identifica-
tion used during this study has enabled the molecular characterization of D. tripathii.
Fig. 2. A phylogenetic tree constructed for Dactylogyroides tripathii by minimum evolution (ME) method for
28S region with different species showed similar topology as Neighbor joining tree.
Ðèñ. 2. Ôèëîãåíåòè÷åñêîå äðåâî, ïîñòðîåííîå äëÿ Dactylogyroides tripathii ïî ìåòîäó ìèíèìàëüíîé
ýâîëþöèè (ÌÝ) äëÿ îáëàñòè 28S ñ ðàçëè÷íûìè âèäàìè, ïîêàçàâøåå ñõîäíóþ òîïîëîãèþ, êàê è NJ-
äåíäðîãðàììà.
Unauthenticated
Download Date | 12/15/16 7:15 PM
55 H. R. Chiary, A. Chaudhary, H. S. Singh
In the present study, D. tripathii shows the close similarity with another species of
same genus viz., D. longicirrus (Tripathi, 1959) Gussev, 1973 and after that with various
species of genus Dactylogyrus from which it was differentiated. The tree topologies derived
from the phylogenetic analysis inferred from 28S rDNA data depicted that both the genus
Dactylogyroides and Dactylogyrus, as genetically, closely related sister taxa as they formed
closely related clade (fig. 1, 2). Therefore, based on our molecular analysis results by dif-
ferent methods, we propose that the species D. tripathii was correctly accommodated in
the genus Dactylogyroides by Gussev, 1973. This study further confirmed that 28S rDNA is
useful marker for distinguishing sister genera or species and helpful in discriminating spe-
cies especially when morphological differences are often difficult to determine.
In conclusion, the present identification of the D. tripathii species with 28S sequence
analysis is consistent with investigations made using only traditional approaches, i. e., by
morphology. The molecular study with 28S sequence is a promising tool for monogenean
identification at species level. We believe that such taxonomic revisions based on
molecular biology will continue with the increasing number of Dactylogyroides species
for comparison and being used for molecular phylogenetic investigations in the future.
Special thanks to the Department of Zoology, Chaudhary Charan Singh University for resources, and
Prof. Umesh C. Goswami, Department of Zoology, Guwahati University, Guwahati, Assam, India, for
identification of the host (from specimens).
References
Agrawal N., Pandey K. C., Tripathi A. Remarks on Indian species of Dactylogyroides Gussev, 1976, with
description of new species on freshwater cyprinids of Lucknow // Indian J. Helminthology. — 2002. —
20. — P. 15–28.
Chaudhary A., Singh H. S. Description of two new species of the genus Thaparocleidus Jain, 1952 (Mono-
genea, Dactylogyridae) from freshwater fish in India: morphological and molecular phylogenetic evi-
dence // J. Helminthology. — 2012. — 87. — P. 160–173.
Chaudhary A., Singh H. S. Phylogenetic study of nine species of freshwater monogeneans using secondary
structure and motif prediction from India // Bioinformation. — 2012. — 8, 18. — P. 862–869.
Chiary H. R., Chaudhary A., Singh H. S. Phylogenetic analysis of the Dactylogyroides longicirrus (Monogenea:
Dactylogyridae) based on the 18S and ITS 1 ribosomal genes // Bioinformation. — 2013. — 9, 5. —
P. 250–254.
Desdevises Y. The phylogenetic position of Furnestinia echeneis (Monogenea, Diplectanidae) based on mo-
lecular data: a case of morphological adaptation? // International J. Parasitology. — 2001. — 31, 2. —
P. 393–401.
Dubey A., Gupta A. K., Agarwal S. M. Studies on monogenean parasites in freshwater fishes at Raipur V. Re-
descriptions of Dactylogyroides tripathii (Tripathi, 1959) Gussev, 1976 and Dactylogyroides longicirrus
(Tripathi, 1959) Gussev, 1976 and a note on Taxonomy of species of the genus // J. Parasitology and
Applied Animal Biology. — 1997. — 6. — P. 31–38.
Gussev A. V. New species of Monogenoidea from fishes of Ceylon // Bulletin of Fisheries Research Station
Ceylon. — 1963. — 16. — P. 53–93.
Gussev A. V. Freshwater Indian Monogenoidea. Principles of systematics, analysis of the world faunas and their
evolution // Indian J. Helminthology. — 1973. — 25, 26. — P. 1–241.
Justine J. L., Jovelin R., Neifar R. et al. Phylogenetic positions of the Bothitrematidae and Neocalceostomati-
dae (Monoopisthocotylean Monogeneans) inferred from 28S rDNA sequences // Comparative Parasito-
logy. — 2002. — 69, 1. — P. 20–25.
Kimura M. A simple method for estimating evolutionary rate of base substitutions through comparative studies
of nucleotide sequences // J. Molecular Evolution. — 1980. — 16, 2. — P. 111–120.
Lee S. U., Chun H. C., Huh S. Molecular phylogeny of parasitic platyhelminthes based on sequences of partial
28S rDNA D1 and mitochondrial cytochrome c oxidase subunit I // Korean Journal of Parasitology. —
2007. — 45, 3. — P. 181–189.
Mollaret I., Jamieson B. G. M., Justine J. L. Phylogeny of the Monopisthocotylea and Polyopisthocotylea
(Platyhelminthes) inferred from 28S rDNA sequences // International J. Parasitology. — 2000 a. — 30,
2. — P. 171–185.
Mollaret I., Lim L. H. S., Justine J. L. Phylogenetic position of the monogeneans Sundanonchus, Thaparoclei-
dus and Cichlidogyrus inferred from 28S rDNA sequences // International J. Parasitology. — 2000 b. —
30, 5. — P. 659–662.
Olson P. D., Littlewood D. T. J. Phylogenetics of the Monogenea-evidence from a medley of molecules //
International J. Parasitology. — 2002. — 32, 3. — P. 233–244.
Unauthenticated
Download Date | 12/15/16 7:15 PM
56The Chorionic Sculpture in Eggs of Some Noctuidae (Lepidoptera)
Olson P. D., Cribb T. H., Tkach V. V. et al. Phylogeny and classification of the digenea (Platyhelminthes:
Trematoda) // International J. Parasitology. — 2003. — 33, 7. — P. 733–755.
Šimková A., Matejusová I., Cunningham C. O. A molecular phylogeny of the Dactylogyridae sensu Kritsky &
Boeger (1989) (Monogenea) based on the D1–D3 domains of large subunit rDNA // Parasitology. —
2006. — 133, 1. — P. 43–53.
Singh H. S., Chaudhary A. Genetic characterization of Dactylogyroides longicirrus (Tripathi, 1959) Gussev,
1976 by nuclear 28S segment of ribosomal DNA with a morphological redescription // Scientia Parasi-
tologica. — 2010. — 11, 3. — P. 119–127.
Tamura K., Peterson D., Peterson N. et al. MEGA5: molecular evolutionary genetics analysis using maximum
likelihood, evolutionary distance, and maximum parsimony methods // Molecular Biology and Evolu-
tion. — 2011. — 28, 10. — DOI: 10.1093/molbev/msr121. — P. 2731–2739.
Tripathi Y. R. Monogenetic trematodes from fishes of India // Indian J. Helminthology. — 1959. — 9, 1–2. —
P. 1–149.
Verma C., Chaudhary A., Singh H. S. PCR-based molecular characterization, phylogenetic analysis and sec-
ondary structure of the 28S rDNA of Thaparocleidus wallagonius (Monogenea: Dactylogyridae) — the
most primitive species of this genus from India // Bioinformation. — 2012. — 8, 17. — P. 816–819.
Whittington I. D., Deveney M. R., Morgan J. A. T. et al. A preliminary phylogenetic analysis of the Capsali-
dae (Platyhelminthes: Monogenea: Monopisthocotylea) inferred from large subunit rDNA sequences //
Parasitology. — 2004. — 128, is. 5. — P. 511–519.
Wu X. Y., Zhu X. Q., Xie M. Q., Li A. X. The radiation of Haliotrema (Monogenea: Dactylogyridae: Ancyro-
cephalinae): Molecular evidence and explanation inferred from LSU rDNA sequences // Parasitology. —
2006. — 132, is. 5. — P. 659–668.
Wu X. Y., Zhu X. Q., Xie M. Q., Li A. X. The evaluation for generic-level monophyly of Ancyrocephalinae
(Monogenea, Dactylogyridae) using ribosomal DNA sequence data // Molecular Phylogenetics and
Evolution. — 2007. — 44, 2. — P. 530–544.
Wu X. Y., Zhu X. Q., Xie M. Q., Wang J. Q., Li A. X. The radiation of Thaparocleidus (Monogenoidea: Dacty-
logyridae: Ancylodiscoidinae): phylogenetic analyses and taxonomic implications inferred from ribosomal
DNA sequences // Parasitology Research. — 2008. — 102, 2. — P. 283–288.
Received 31 October 2012
Accepted 1 October 2013
Unauthenticated
Download Date | 12/15/16 7:15 PM
|
| id | nasplib_isofts_kiev_ua-123456789-109839 |
| institution | Digital Library of Periodicals of National Academy of Sciences of Ukraine |
| issn | 0084-5604 |
| language | English |
| last_indexed | 2025-12-07T15:54:27Z |
| publishDate | 2013 |
| publisher | Інститут зоології ім. І.І. Шмальгаузена НАН України |
| record_format | dspace |
| spelling | Chiary, H.R. Chaudhary, A. Singh, H.S. 2016-12-17T20:44:53Z 2016-12-17T20:44:53Z 2013 Molecular Characterization of Dactylogyroides tripathii (Monogenea, Dactylogyridae) Using Long Subunit rDNA from North East Region of India / H.R. Chiary, A. Chaudhary, H.S. Singh // Вестник зоологии. — 2013. — Т. 47, № 5. — С. 451–455. — Бібліогр.: 24 назв. — англ. 0084-5604 DOI 10.2478/vzoo-2013-0048 https://nasplib.isofts.kiev.ua/handle/123456789/109839 595.122.1:575.1(540) The present study describes the molecular characterization of the monogenea Dactylogyroides tripathii (Tripathi, 1959) Gussev, 1973 infecting the gill filaments of fish, Puntius ticto from River Brahmaputra, Guwahati, Assam, India. This study shows the D. tripathii species identification resulted from the use of molecular data, particularly the 28S rDNA gene. We compared the 28S partial rDNA sequence of D. tripathii with same gene region of the other species of monogeneans available in GenBank. With this comparison, we determined that the sequence had a similarity with one available species of the genus Dactylogyroides Gussev, 1963 i. e., D. longicirrus and also with the species of Dactylogyrus from which this genus was distinguished. Представлена молекулярная характеристика моногенеи Dactylogyroides tripathii (Tripathi, 1959) Gussev, 1973 инфицирующую жаберные волоски рыбы Puntius ticto из реки Брахмапутра, Гувахати, Ассам, Индия. Это исследование показывает идентификацию вида D. tripathii с помощью использования молекулярных данных, в частности гена 28S рДНК. Мы сравнили 28S частичной рДНК последовательности вида D. tripathii с той же областью гена другого вида моногеней, доступного в GenBank. С помощью этого сравнения мы определили, что последовательность имела сходство с одним из доступных видов рода Dactylogyroides Gussev, 1963, то есть с видом D. Longicirrus, а также с видами Dactylogyrus, от которых отличается этот род. Special thanks to the Department of Zoology, Chaudhary Charan Singh University for resources, and Prof. Umesh C. Goswami, Department of Zoology, Guwahati University, Guwahati, Assam, India, for identification of the host (from specimens). en Інститут зоології ім. І.І. Шмальгаузена НАН України Вестник зоологии Краткие сообщения Molecular Characterization of Dactylogyroides tripathii (Monogenea, Dactylogyridae) Using Long Subunit rDNA from North East Region of India Молекулярная характеристика Dactylogyroides tripathii (Monogenea, Dactylogyridae) с использованием длинных субъединиц рДНК из Северо-восточного региона Индии Article published earlier |
| spellingShingle | Molecular Characterization of Dactylogyroides tripathii (Monogenea, Dactylogyridae) Using Long Subunit rDNA from North East Region of India Chiary, H.R. Chaudhary, A. Singh, H.S. Краткие сообщения |
| title | Molecular Characterization of Dactylogyroides tripathii (Monogenea, Dactylogyridae) Using Long Subunit rDNA from North East Region of India |
| title_alt | Молекулярная характеристика Dactylogyroides tripathii (Monogenea, Dactylogyridae) с использованием длинных субъединиц рДНК из Северо-восточного региона Индии |
| title_full | Molecular Characterization of Dactylogyroides tripathii (Monogenea, Dactylogyridae) Using Long Subunit rDNA from North East Region of India |
| title_fullStr | Molecular Characterization of Dactylogyroides tripathii (Monogenea, Dactylogyridae) Using Long Subunit rDNA from North East Region of India |
| title_full_unstemmed | Molecular Characterization of Dactylogyroides tripathii (Monogenea, Dactylogyridae) Using Long Subunit rDNA from North East Region of India |
| title_short | Molecular Characterization of Dactylogyroides tripathii (Monogenea, Dactylogyridae) Using Long Subunit rDNA from North East Region of India |
| title_sort | molecular characterization of dactylogyroides tripathii (monogenea, dactylogyridae) using long subunit rdna from north east region of india |
| topic | Краткие сообщения |
| topic_facet | Краткие сообщения |
| url | https://nasplib.isofts.kiev.ua/handle/123456789/109839 |
| work_keys_str_mv | AT chiaryhr molecularcharacterizationofdactylogyroidestripathiimonogeneadactylogyridaeusinglongsubunitrdnafromnortheastregionofindia AT chaudharya molecularcharacterizationofdactylogyroidestripathiimonogeneadactylogyridaeusinglongsubunitrdnafromnortheastregionofindia AT singhhs molecularcharacterizationofdactylogyroidestripathiimonogeneadactylogyridaeusinglongsubunitrdnafromnortheastregionofindia AT chiaryhr molekulârnaâharakteristikadactylogyroidestripathiimonogeneadactylogyridaesispolʹzovaniemdlinnyhsubʺedinicrdnkizseverovostočnogoregionaindii AT chaudharya molekulârnaâharakteristikadactylogyroidestripathiimonogeneadactylogyridaesispolʹzovaniemdlinnyhsubʺedinicrdnkizseverovostočnogoregionaindii AT singhhs molekulârnaâharakteristikadactylogyroidestripathiimonogeneadactylogyridaesispolʹzovaniemdlinnyhsubʺedinicrdnkizseverovostočnogoregionaindii |