The possible involvement of D-amino acids or their metabolites in Arabidopsis cysteine proteinase/cystatin-dependent proteolytic pathway
Cysteine proteinases and their inhibitors ‘cystatins’ play essential roles in plant growth and development. They are involved in various signaling pathways and in the response to wide ranges of biotic and abiotic environmental stresses. To investigate their possible influence from D-amino acids or t...
Gespeichert in:
| Veröffentlicht in: | Цитология и генетика |
|---|---|
| Datum: | 2015 |
| 1. Verfasser: | |
| Format: | Artikel |
| Sprache: | English |
| Veröffentlicht: |
Інститут клітинної біології та генетичної інженерії НАН України
2015
|
| Schlagworte: | |
| Online Zugang: | https://nasplib.isofts.kiev.ua/handle/123456789/126707 |
| Tags: |
Tag hinzufügen
Keine Tags, Fügen Sie den ersten Tag hinzu!
|
| Назва журналу: | Digital Library of Periodicals of National Academy of Sciences of Ukraine |
| Zitieren: | The possible involvement of D-amino acids or their metabolites in Arabidopsis cysteine proteinase/cystatin-dependent proteolytic pathway / A. Gholizadeh // Цитология и генетика. — 2015. — Т. 49, № 2. — С. 3-10. — Бібліогр.: 30 назв. — англ. |
Institution
Digital Library of Periodicals of National Academy of Sciences of Ukraine| id |
nasplib_isofts_kiev_ua-123456789-126707 |
|---|---|
| record_format |
dspace |
| spelling |
Gholizadeh, A. 2017-12-01T20:25:43Z 2017-12-01T20:25:43Z 2015 The possible involvement of D-amino acids or their metabolites in Arabidopsis cysteine proteinase/cystatin-dependent proteolytic pathway / A. Gholizadeh // Цитология и генетика. — 2015. — Т. 49, № 2. — С. 3-10. — Бібліогр.: 30 назв. — англ. 0564-3783 DOI: 10.3103/S0095452715020036 https://nasplib.isofts.kiev.ua/handle/123456789/126707 Cysteine proteinases and their inhibitors ‘cystatins’ play essential roles in plant growth and development. They are involved in various signaling pathways and in the response to wide ranges of biotic and abiotic environmental stresses. To investigate their possible influence from D-amino acids or their metabolism in vivo, Arabidopsis seedlings were allowed to grow under four physico-chemically different D-amino acids including D-aspartate, D-serine, D-alanine and D-phenylalanine containing media. The reverse transcription polymerase chain reaction (RT-PCR) analysis of cysteine proteinase and cystatin gene expressions showed that the addition of D-amino acid to the plant growth media considerably induce the expression of proteinase transcript while decrease the expression level of inhibitor gene in the leaf and root tissues of the test plant in overall. Based on the obtained results the potential impact of D-amino acids or their metabolism on the activity of cysteine proteinase/cystatin-dependent proteolytic apparatus as well as their possible cooperation were predicted and discussed in the plant system. Цистеинпротеиназы и их ингибиторы цистатины играют существенную роль в росте и развитии ратений. Они вовлечены в различные сигнальные пути и в ответ на широкий спектр биотических и абиотических стрессов. Для изучения возможного влияния на них D-аминокислот или их метаболизма in vivo проростки Arabidopsis выращивали на средах в присутствии четырех физико-химически различных аминокислот, включая D-аспартат, D-серин, D-аланин и D-фенилаланин. RT-PCR анализ цистеин-протеиназы и экспрессии гена цистатина показал, что добавление D-аминокислот в среду для выращивания растений значительно индуцировало экспрессию транскриптов протеиназ, в то же время снижая уровень экспрессии гена-ингибитора в тканях листьев и корней исследуемых растений. На основании полученных результатов обсуждается потенциальное влияние D-аминокислот или их метаболизма на активность в цистеинпротеиназа/цистатин-зависимом протеолитическом пути, а также ихвозможное взаимодействие в растительной системе. The present work was financially supported by Research Institute for Fundamental Sciences (RIFS), University of Tabriz, Iran. The authors of this paper are thanks for their supporting. en Інститут клітинної біології та генетичної інженерії НАН України Цитология и генетика Оригинальные работы The possible involvement of D-amino acids or their metabolites in Arabidopsis cysteine proteinase/cystatin-dependent proteolytic pathway Возможное участие D-аминокислот или их метаболитов в цистеинпротеиназа/цистатин-зависимом протеолитическом пути у арабидопсиса Article published earlier |
| institution |
Digital Library of Periodicals of National Academy of Sciences of Ukraine |
| collection |
DSpace DC |
| title |
The possible involvement of D-amino acids or their metabolites in Arabidopsis cysteine proteinase/cystatin-dependent proteolytic pathway |
| spellingShingle |
The possible involvement of D-amino acids or their metabolites in Arabidopsis cysteine proteinase/cystatin-dependent proteolytic pathway Gholizadeh, A. Оригинальные работы |
| title_short |
The possible involvement of D-amino acids or their metabolites in Arabidopsis cysteine proteinase/cystatin-dependent proteolytic pathway |
| title_full |
The possible involvement of D-amino acids or their metabolites in Arabidopsis cysteine proteinase/cystatin-dependent proteolytic pathway |
| title_fullStr |
The possible involvement of D-amino acids or their metabolites in Arabidopsis cysteine proteinase/cystatin-dependent proteolytic pathway |
| title_full_unstemmed |
The possible involvement of D-amino acids or their metabolites in Arabidopsis cysteine proteinase/cystatin-dependent proteolytic pathway |
| title_sort |
possible involvement of d-amino acids or their metabolites in arabidopsis cysteine proteinase/cystatin-dependent proteolytic pathway |
| author |
Gholizadeh, A. |
| author_facet |
Gholizadeh, A. |
| topic |
Оригинальные работы |
| topic_facet |
Оригинальные работы |
| publishDate |
2015 |
| language |
English |
| container_title |
Цитология и генетика |
| publisher |
Інститут клітинної біології та генетичної інженерії НАН України |
| format |
Article |
| title_alt |
Возможное участие D-аминокислот или их метаболитов в цистеинпротеиназа/цистатин-зависимом протеолитическом пути у арабидопсиса |
| description |
Cysteine proteinases and their inhibitors ‘cystatins’ play essential roles in plant growth and development. They are involved in various signaling pathways and in the response to wide ranges of biotic and abiotic environmental stresses. To investigate their possible influence from D-amino acids or their metabolism in vivo, Arabidopsis seedlings were allowed to grow under four physico-chemically different D-amino acids including D-aspartate, D-serine, D-alanine and D-phenylalanine containing media. The reverse transcription polymerase chain reaction (RT-PCR) analysis of cysteine proteinase and cystatin gene expressions showed that the addition of D-amino acid to the plant growth media considerably induce the expression of proteinase transcript while decrease the expression level of inhibitor gene in the leaf and root tissues of the test plant in overall. Based on the obtained results the potential impact of D-amino acids or their metabolism on the activity of cysteine proteinase/cystatin-dependent proteolytic apparatus as well as their possible cooperation were predicted and discussed in the plant system.
Цистеинпротеиназы и их ингибиторы цистатины играют существенную роль в росте и развитии ратений. Они вовлечены в различные сигнальные пути и в ответ на широкий спектр биотических и абиотических стрессов. Для изучения возможного влияния на них D-аминокислот или их метаболизма in vivo проростки Arabidopsis выращивали на средах в присутствии четырех физико-химически различных аминокислот, включая D-аспартат, D-серин, D-аланин и D-фенилаланин. RT-PCR анализ цистеин-протеиназы и экспрессии гена цистатина показал, что добавление D-аминокислот в среду для выращивания растений значительно индуцировало экспрессию транскриптов протеиназ, в то же время снижая уровень экспрессии гена-ингибитора в тканях листьев и корней исследуемых растений. На основании полученных результатов обсуждается потенциальное влияние D-аминокислот или их метаболизма на активность в цистеинпротеиназа/цистатин-зависимом протеолитическом пути, а также ихвозможное взаимодействие в растительной системе.
The present work was financially supported by Research Institute for Fundamental Sciences (RIFS), University of Tabriz, Iran. The authors of this paper are thanks for their supporting.
|
| issn |
0564-3783 |
| url |
https://nasplib.isofts.kiev.ua/handle/123456789/126707 |
| citation_txt |
The possible involvement of D-amino acids or their metabolites in Arabidopsis cysteine proteinase/cystatin-dependent proteolytic pathway / A. Gholizadeh // Цитология и генетика. — 2015. — Т. 49, № 2. — С. 3-10. — Бібліогр.: 30 назв. — англ. |
| work_keys_str_mv |
AT gholizadeha thepossibleinvolvementofdaminoacidsortheirmetabolitesinarabidopsiscysteineproteinasecystatindependentproteolyticpathway AT gholizadeha vozmožnoeučastiedaminokislotiliihmetabolitovvcisteinproteinazacistatinzavisimomproteolitičeskomputiuarabidopsisa AT gholizadeha possibleinvolvementofdaminoacidsortheirmetabolitesinarabidopsiscysteineproteinasecystatindependentproteolyticpathway |
| first_indexed |
2025-11-26T01:39:32Z |
| last_indexed |
2025-11-26T01:39:32Z |
| _version_ |
1850603235985850368 |
| fulltext |
3ISSN 0564–3783. Öèòîëîãèÿ è ãåíåòèêà. 2015. Ò. 49. ¹ 2
ОРИГИНАЛЬНЫЕ РАБОТЫ
THE POSSIBLE INVOLVEMENT OF D-AMINO ACIDS
OR THEIR METABOLITES IN ARABIDOPSIS CYSTEINE
PROTEINASE/CYSTATIN-DEPENDENT PROTEOLYTIC PATHWAY
A. GHOLIZADEH
Research Institute for Fundamental Sciences (RIFS), University of Tabriz, Iran
E-mail: aghz_bioch@yahoo.co.in
© A. GHOLIZADEH, 2015
Cysteine proteinases and their inhibitors ‘cystatins’ play
essential roles in plant growth and development. They are
involved in various signaling pathways and in the response
to wide ranges of biotic and abiotic environmental stresses.
To investigate their possible influence from D-amino acids
or their metabolism in vivo, Arabidopsis seedlings were
allowed to grow under four physico-chemically different
D-amino acids including D-aspartate, D-serine, D-alanine
and D-phenylalanine containing media. The reverse
transcription polymerase chain reaction (RT-PCR) analysis
of cysteine proteinase and cystatin gene expressions showed
that the addition of D-amino acid to the plant growth media
considerably induce the expression of proteinase transcript
while decrease the expression level of inhibitor gene in the
leaf and root tissues of the test plant in overall. Based on
the obtained results the potential impact of D-amino acids
or their metabolism on the activity of cysteine proteinase/
cystatin-dependent proteolytic apparatus as well as their
possible cooperation were predicted and discussed in the
plant system.
Key words: Arabidopsis, cystatin, cysteine proteinase,
D-amino acid, RT-PCR.
Introduction. In plants, proteolysis is a complicated
process in which many enzymes and proteolytic
pathways are involved. Cysteine proteinases (CP)
referred to as thiol proteases are known to play an
essential role and share in total proteolysis from 30
to 90 % depending on the cellular conditions [1,
2]. CP enzymes are involved in protein maturation,
degradation, protein rebuilt in response to different
internal and external stimuli, continuous removal
of protein abnormalities and mis-foldings during
plants growth and developmental stages [3, 4]. In
each case, the hyperactivity of CP enzymes leads to
severe cellular disturbance. Therefore, proteolysis
process is highly regulated. Cells or whole organ-
isms have developed various strategies to protect
themselves against undesired proteolysis. One of
the common strategies is the control of proteolytic
activity by inhibition [5]. It has been suggested that
the CP-based proteolysis is regulated by the activity
poised between the cysteine proteinases and their
proteineous inhibitors referred as cystatins [6]. Re-
cently, it has been reported that the cysteine pro-
teinase and cystatin interactions determines their
mutual participation in specific pathways including
anabolic and catabolic processes, different signaling
pathways and responding to various biotic and abi-
otic environmental stresses throughout the plants
life [7].
Cystatins constitutes the largest and well char-
acterized group of natural CP inhibitors (CPI) in
plant system [8–10]. These proteineous inhibitors
have been known to bind adjacent to the prote-
ase active site, obstructing the access of substrate,
but they do not directly interact with the enzyme
catalytic centre [15]. Cystatins mostly direct their
inhibitory actions against the papain superfam-
ily members found in a wide range of organisms
including viruses, bacteria, plants and animals [5,
12]. The plant cystatins differ from microorgan-
isms or animal types. They are generally named
as «phytocystatins». Like all members of the cys-
tatin super-family, phytocystatins contain three
conserved regions («G» residue at the N-terminus,
«Q×V×G» and «W» at the C-terminus) that interact
with cysteine proteinase molecular structures, but
they differ from non-plant types due to the presence
ISSN 0564–3783. Öèòîëîãèÿ è ãåíåòèêà. 2015. Ò. 49. ¹ 24
A. Gholizadeh
of a plant-specific sequence, [LVI]-[AGT]-[RKE]-
[FY]-[AS]-[VI]-x-[EDQV]-[HYFQ]-N located in
an N-terminal -helix region [13, 14].
A survey of cystatins and cysteine proteinases in
plants has suggested the conservation and evolution
of the cystatin inhibitory family and their putative
targets, the papain-type cysteine proteinases from
families C1A and C13. Functionality of both fami-
lies of proteins in plants was predicted to be the
result of a coevolutionary process that might have
occurred during the evolution of basal and land
plants leading to a complex functional relationship
among them [7, 15].
Plant papain-type proteinases are the most
abundant and widely investigated family of cyste-
ine proteases. These proteases are synthesized as
inactive precursors and then their activation take
place by limited intra or intermolecular proteolysis
[16]. Genome annotation and sequence similarity
search data has revealed that Arabidopsis encodes
32 papain-type (C1 family) cysteine proteinases
which are classified into eight main groups con-
sisting of senescence and stress induced, aleurain,
cathepsin-b like, bromelain-like, KEDL, telose-
quences and actinidain-like proteinases [2, 17].
This papain-type CP family was recently found
to be important player in Arabidopsis immunity
against pathogen infections [18].
Although the full physio-biological functions of
plant cysteine proteinases and cystatins remain ob-
scure, but studies on their gene expression patterns
have been suggested that they may play important
roles in plant system such as the regulation of seed
maturation and germination, participation in the
defense mechanism against pathogen attacks or
against different abiotic environmental stresses such
as drought, salt and heat and modulating the phe-
nomenon of programmed cell death (PCD) during
plant development and senescence [6, 19–21].
We predicted that the proteolytic pathway en-
zymes may be naturally influenced from the other
metabolic pathways such as D-amino acid metabo-
lizing rout in plants. Similar to proteolytic enzymes,
D-amino acids and their metabolic enzymes have
been known to be involved in a number of bio-
logical processes such as aging and tissue/organ
growth and developments in mammalians [22, 23].
Using gene expression data, the possible contribu-
tion of D-amino acids and their related enzymes
in some biological processes and in response to a
number of environmental stresses such as drought
have also been later on suggested in plant systems
[23]. Although, the recent reports have demon-
strated that the engineered D-amino acids and their
synthetic derivatives affect the CP/CPI-dependent
proteolytic activities [24, 25], but, there is no any
information to our knowledge about the possible
natural correlations that may be present between
the proteolytic and D-amino acid metabolic routs,
still yet.
In the present study, as an initial research work,
our attempts were made to: 1) sketch in the basic and
the quantitative RT-PCR based expression profiles
of Arabidopsis papain-like proteinase (Accession no.
At3G54940) and a cystain type inhibitor (Accession
no. AF411786) in two different organs including
leaves and roots, simultaneously; 2) study on the
RT-PCR based expression profiles of papain-like
and cystatin genes in the presence of D-amino acid
containing media that may help us to understand
about the possible functional relationships between
D-amino acid metabolism and CP/CPI based pro-
teolytic pathway in plant system.
Materials and methods. Bacterial strains and
chemicals. E. coli strain DH5 was used for the
bacterial transformation. pGEM-T Easy vector sys-
tem I from Promega (Cat. No. A1360) was used
for the PCR product cloning. Trizol reagent used
for total RNA isolation was purchased from Gibco
BRL, USA (Cat. No. 15596-013). The mRNA mi-
ni preparation kit was from QIAGEN, USA (Cat.
No.70022). AcessQuickTM RT-PCR System was
purchased from Promega (Cat. no. A1701). iQ
SYBR green supermix was from Bio-Rad, USA.
Restriction enzymes, Taq DNA polymerase, buf-
fer, dNTPs, and MgCl2 used for PCR amplification
were provided by CinnaGen Company. In order
to purify the PCR end product from the agarose
gel materials, Fermentas DNA extraction kit (Cat.
No. K0513) was used. All the other chemicals were
of analytical and molecular biology grades and pur-
chased from Merck AG (Darmstadt, Germany) or
Sigma (St. Louis, MO, USA).
Plant materials and growth conditions. The seeds
of Arabidopsis thaliana (thale cress) were provided
by Dr B. Baghban Kohnehrouz (Laboratory of
Plant Genetic Engineering, Department of Plant
Breeding and Biotechnology, University of Tabriz,
Iran). The seeds were germinated up to seedling
stages, and then each seedling separately transferred
ISSN 0564–3783. Öèòîëîãèÿ è ãåíåòèêà. 2015. Ò. 49. ¹ 2 5
The possible involvement of D-amino acids or their metabolites in Arabidopsis cysteine
to the nitrate-free Hoagland solution containing
1000 ppm (1 g/L) D-amino acid as nitrogen source.
Four different amino acids including D-aspatate,
D-serine, D-alanine and D-phenylalanine were
considered for the analysis. Each medium included
only one type of amino acid. The experimental
materials were collected from the fresh leaf and
root tissues after one week and proceeded for the si-
multaneous RNA isolation and RT-PCR reactions.
Total RNA isolation and mRNA purification. To-
tal cellular RNA was isolated from the leaf and root
materials using Trizol reagent, separately. 0.2 g of
each test material was powdered using liquid N2
and 2 ml of Trizol reagent was added to homog-
enize it at room temperature (RT). Then, 200 l of
chloroform was added to the mixture, mixed for 15
second, incubated on ice for 5 min and centrifuged
at 13 000 g for 15 min. The upper phase was trans-
ferred to another tube and RNA was precipitated
with an equal volume of isopropanol. The pellet was
washed in 1 ml of 75 % ethanol, dried at RT and
dissolved in 30 l RNase-free water. The integrity
of the RNA was tested on 1 % non-denaturing aga-
rose gel using TBE running buffer. Poly(A+) RNA
was purified from prepared total RNA using oligo
dT-columns according to the provided kit protocol.
The integrity of the purified mRNA was also ana-
lyzed by electrophoresis using 1 % non-denaturing
agarose gel. The quantity of the RNA in the starting
materials for the next experiments was measured
spectrophotometrically [26].
Primer Designing. The specific primer sets for the
amplification of Arabidopsis papain-like cysteine
proteinase and a cystatin cDNA were designed
based on their already reported sequences (The
EMBL accession numbers for papain-like and cys-
tatin sequences were At3G54940 and AF411786,
respectively). The sequence-specific primers for CP
(Fw, 5 CGATAACAGCGATCATGGTG3 ; Rv,
5 GAAACTTGGGTGGCTACTGC3 ) and CPI
(Fw, 5 GAAAATGGCGGATCAACAAG3 ; Rv,
5 ACATCGTGATGGTGGTTGAA3 ) were de-
signed by Primer3 software (http://www. Primer-
3plus.com).
RT-PCR Reactions. The RT-PCR reactions were
separately performed for each test samples using
one-step AcessQuickTM RT-PCR System. 0.5 g of
each mRNA sample was mixed with 25 l Master
Mix (2x) and 1 l of primer set (at the final con-
centration of 0.2 M). The mixtures were adjusted
to a final volume of 50 l using nuclease-free wa-
ter. The reaction mixtures were incubated at 45 °C
for 45 min, the subsequent PCR amplification was
carried out after a pre-denaturation stage at 95 °C
for 3 minutes in 25 cycles. The PCR cycles for CP
and CPI amplifications were performed according
to the following programs, respectively: «denatu-
ration at 93 °C for 30 s, annealing at 55 °C for
2 min, extension at 72 °C for 1 min, final extension
at 72 °C for 10 min» and «denaturation at 93 °C
for 1 min, annealing at 56 °C for 1.5 min, exten-
sion at 72 °C for 2 min, final extension at 72 °C
for 10 min».
In the next step, the amplified products were
extracted from the agarose gel, cloned in pGEM-
T easy cloning vector [37]. The cloned fragments
proceeded for the partial sequencing in Microsynth
DNA sequencing center at Switzerland.
Real-time RT-PCR reactions. The real-time RT-
PCR reactions were analyzed by using iQ SYBR
green dye on Miniopticon Real Time PCR Detec-
tion System (Bio-Rad, USA). Each sample was
performed in three replicates and the mean values
of the data were presented. All the data were nor-
malized by actin reference gene expression values
in the test samples and the relative fold expression
was calculated using the 2–DDCt value [27].
Sequence Analysis. To ensure that the amplified
products are corresponding to our sequences of
interest, the nucleotide and deduced amino acid
sequences of the isolated cDNA were analyzed
by computing at BLAST (Basic Local Alignment
Search Tool; http://www.ncbi.nlm.blast.com/).
Results and discussion. Using gene expression
technologies, plant cysteine proteinases (CP) and
their inhibitors (CPI) have been suggested to be con-
tributed in many biological processes in a regulative
manner. They are mostly involved in protein turn-
overs, programmed cell death and protein degrada-
tions in response to several internal developmental
shifting and external stressful environments [4, 28].
Wounding, low or high temperatures, drought, high
salinity and diseases have been reported to alter the
expression patterns of CP and CPI genes [28, 29].
In senescing and developing plants as well as in
germinating seeds, the CP/CPI gene activities have
been shown to be regulated [19, 21].
Besides the gene expression alterations, the bi-
molecular fluorescent complementation data analy-
sis have newly demonstrated that the CP and CPI
ISSN 0564–3783. Öèòîëîãèÿ è ãåíåòèêà. 2015. Ò. 49. ¹ 26
A. Gholizadeh
molecules are interacted in a regulated manner and
participate in the same bio-physiological processes
[7]. Also the relative activities poised by the protein-
ases and inhibitors have been suggested to deter-
mine their regulated function in vivo [6]. The rela-
tive enzymatic and inhibitory activities of CP/CPI
proteolytic pair have been recently reported to be
influenced from several non-natural D-amino acid
derivatives [24, 25]. These compounds are known
to increase the inhibitory activity of inhibitor mol-
ecules and relatively decrease the protease activity
in the treated cells or tissues.
In the present study, we aimed to investigate
the possible effects of exogenously applied D-ami-
no acids on the expression patterns of Arabodop-
sis papain-like proteinase and a cystatin, simul-
taneously. For this purpose, four structurally and
physico-chemically different D-amino acids in-
cluding D-aspartate, D-serine, D-alanine and D-
phenylalanine were considered as nitrogen source
for test plant seedlings. Seedlings were allowed to
grow in nitrate-free Hoagland solutions containing
1000 ppm D-amino acids, separately. After one
week, experimental materials were simultaneously
collected from the leaf and root tissues of growing
plants and subjected to the gene expression studies.
The Cp/CPI pair was selected according to their
computational predictable interactive structures
(Fig. 1). Using molecular docking analysis data, the
interaction energy between this pair was predicted
to be 19559.2 kcal/mol. This interactive structure
was also found to be the most popular model be-
tween Arabidopsis papain-type Cp/CPI molecules.
The expression of CP and CPI transcripts were
detected by RT-PCR and real-time RT-PCR meth-
ods using the same amounts of the starting mRNA
materials for all of test samples. Analysis of the
RT-PCR end products showed that the expression
patterns of CP and CPI are considerably influenced
from the D-amino acid containing growth media.
In the medium without D-amino acids, the ex-
pression of CP was detected in both leaf and root
tissues, but CPI transcript was only observed in the
leaf tissues. The results failed to show evidence of
CPI gene expression in the root materials. Analysis
of the 2–DDCt values reliably revealed that there is
about 3.2 fold increase in the expression level of leaf
CP gene as compared to the root sample (Fig. 2).
The partial nucleotide sequences of the amplified
CP and CPI fragments were analyzed by BLAST
Fig. 1. Presentation of CP/CPI interactive structure. The
interaction between the test CP and CPI molecules were
predicted by using computational molecular docking
Fig. 2. Expression analysis of CP/CPI genes in the
leaf and root tissues: a – the expression of papain-like
proteinase and cystatin transcripts were detected by RT-
PCR reactions in the leaves and roots of Arabidopsis test
plants grown in D-amino acid free Hoagland solutions.
Electrophoresis was carried out using 1 % non-denaturing
agarose gel; b – quantitative expression analysis of Cp/
CPI genes was performed by real time RT-PCR using iQ
SYBR Green dye. Data were normalized by actin and
related to leave samples using 2–DDCt value. Here and
Fig. 3–6: lCP – leaf CP; rCP – root CP; lCPI – leaf
CPI; rCPI – root CPI; M – EcoRI and HindIII double
digested DNA markers; CP – cysteine proteinase; CPI –
cysteine proteinase inhibitor
ISSN 0564–3783. Öèòîëîãèÿ è ãåíåòèêà. 2015. Ò. 49. ¹ 2 7
The possible involvement of D-amino acids or their metabolites in Arabidopsis cysteine
and their complete identity with the already reported
sequences were confirmed by CLASTAW (the se-
quences and the alignment results not presented).
In D-aspartate containing medium, the expres-
sion patterns of CP and CPI were found to be the
similar to the D-amino acid free media, while the
relative levels of their expression were consider-
ably different (Fig. 3). In compare to the samples
of the D-amino acid free medium (considered as
control), the expression levels of CP in D-aspartate
plus medium were increased in both root and leaf
tissues. The folds increase in the CP levels of leaf
and root samples were found to be about 1.9 and
2.1, respectively. In contrast, the CPI gene expres-
sion in the leaves of D-aspartate plus medium was
decreased about 50 % as compared to the samples
collected from D-amino acid free medium.
In D-serine containing medium, the patterns
and the levels of the root CP and CPI expressions
were found to be the same as for the samples col-
lected from the D-amino acid free medium, while
the expression of CP/CPI in the leaf samples were
different. The leaf CP showed the same expression
pattern, but no expression signal was detected for
the CPI gene (Fig. 4).
Comparison of the CP/CPI gene expressions in
D-alanine plus and D-amino acid free media showed
that root CP is increased to about 2 fold, but the leaf
CP remained the same. Analysis of CPI expression
level showed that leaf CPI gene expression is about
50 % decreased, but the root CPI gene expression is
not detectable as the same as control (Fig. 5).
In D-phenylalanine containing medium, the ex-
pression levels of leaf and root CP showed about
2.4 and 2.1 fold increases, respectively. Analysis of
the expression of CPI gene revealed that its patterns
and the levels remained as the same as the controls
in both leaf and root tissues (Fig. 6).
In overall, analysis of the expression data re-
lated to the samples collected from the D-amino
acid containing media indicated that the expression
patterns of the CP and CPI genes are similar to
the samples of D-amino acid free medium, but the
levels of their expressions are differential.
This study for the first time reports the expres-
sion analysis of cysteine proteinase and its potent
inhibitor in plant system, simultaneously. Previ-
ously, the expression patterns of CP or CPI have
been individually investigated and suggested their
potent effects on various developmental processes
Fig. 3. Effects of D-aspartate on the expression of CP/
CPI genes: a – the expression of CP and CPI transcripts
were analyzed by RT-PCR method from Arabidopsis test
plants grown in Hoagland solutions containing 1000
ppm D-aspartate; here and Fig. 4–6 b – the expression
levels of CP/CPI related to the D-amino free media
using 2–DDCt value in real-time PCR
Fig. 4. Effects of D-serine on the expression of CP/CPI
genes: a – comparative expression analysis of CP and CPI
genes were carried out by RT-PCR in the test plants grown
in Hoagland solutions containing 1000 ppm D-serine
ISSN 0564–3783. Öèòîëîãèÿ è ãåíåòèêà. 2015. Ò. 49. ¹ 28
A. Gholizadeh
as well as on different responses against stressful
environmental stimuli [4, 18, 28]. However, our
simultaneous studies firstly revealed that the expres-
sion pattern of CP is different from that of CPI in
two different organs of test plants. Secondly, the
overall obtained results indicated that CP gene is
highly active than CPI gene in both organs. This
may reflect the wide regulation of CPI inhibitory
activity by the natural or non-natural compounds.
The various synthetic and non-natural deriva-
tives of D-amino acids have been previously known
to activate the inhibitory function of CPI [25]. An
engineered CPI molecule with D-amino acid resi-
dues has also been shown to get higher inhibitory
activity towards human immunodeficiency virus
(HIV) proteinase [24].
Our present studies on gene expression pat-
terns confirmed that D-amino acids of plants
growth media have different effects on gene ac-
tivities and the expression levels of CP and CPI.
In overall, our data revealed that D-amino acids
of the growth media could able to increase the
CP expression level, while decrease the CPI tran-
script level. This result is interesting and it may
have two explanations: 1) D-amino acids of the
growth media are possibly transferred to the plant
cells and directly inhibit the activity of proteinase
enzyme, or D-amino acids are firstly metabolized
and then their metabolites exhibit the inhibitory
activity towards proteinase; 2) D-amino acids or
their metabolites are able to increase the inhibi-
tory activity of the CPI molecule and therefore
indirectly affect the proteinase activity. Since,
the expression levels of CPI were detected to
be very low as compared to CP, therefore both
the possibilities are predicted and need for more
clarifications.
Among the test D-amino acids, D-serine was
found to have more differential and considerable ef-
fects on CP/CPI gene expressions. It not only does
not increase the expression level of CP transcript
but also completely inhibit the expression of CPI
gene. This result may suggest the importance of D-
serine and its possible regulatory roles as compared
to other test D-amino acids in plant system.
Although, plants have been found to take up
different D-amino acids from their root system, but
how plants are able to metabolize these compounds
still remains as a puzzle. However, studies reported
the presence of different metabolic pathways for D-
Fig. 5. Effects of D-alanine on the expression of CP/
CPI genes: a – RT-PCR based expression analysis of
CP and CPI genes were carried out in test plants grown
under D-alanine containing media
Fig. 6. Effects of D-phenylalanine on the expression
of CP/CPI genes: a – the expression patterns of CP
and CPI genes were analyzed by RT-PCR method from
plants grown in Hoagland solutions containing 1000
ppm D-phenylalanine
ISSN 0564–3783. Öèòîëîãèÿ è ãåíåòèêà. 2015. Ò. 49. ¹ 2 9
The possible involvement of D-amino acids or their metabolites in Arabidopsis cysteine
amino acids in plant system [30]. On this base, our
results may suggest the possible roles of D-amino
acids or their natural metabolites in CP/CPI activ-
ity that can be comparable to the roles of the syn-
thetic or non-natural derivatives of D-amino acids.
Conclusion. The potential effects of D-amino
acids or their natural metabolites on the activity of
proteolytic CP/CPI were predicted. However, this
prediction is recommended to be investigated in
details and compared to the already approved roles
of non-natural compounds of D-amino acids with
regard to the proteolytic system in plants.
The present work was financially supported by Re-
search Institute for Fundamental Sciences (RIFS),
University of Tabriz, Iran. The authors of this paper
are thanks for their supporting.
ÂÎÇÌÎÆÍÎÅ Ó×ÀÑÒÈÅ
D-ÀÌÈÍÎÊÈÑËÎÒ ÈËÈ ÈÕ ÌÅÒÀÁÎËÈÒÎÂ
 ÖÈÑÒÅÈÍÏÐÎÒÅÈÍÀÇÀ/ÖÈÑÒÀÒÈÍ-
ÇÀÂÈÑÈÌÎÌ ÏÐÎÒÅÎËÈÒÈ×ÅÑÊÎÌ ÏÓÒÈ
Ó ÀÐÀÁÈÄÎÏÑÈÑÀ
A. Gholizadeh
Research Institute for Fundamental Sciences (RIFS),
University of Tabriz, Iran
E-mail: aghz_bioch@yahoo.co.in
Öèñòåèíïðîòåèíàçû è èõ èíãèáèòîðû öèñòàòèíû
èãðàþò ñóùåñòâåííóþ ðîëü â ðîñòå è ðàçâèòèè ðàñ-
òåíèé. Îíè âîâëå÷åíû â ðàçëè÷íûå ñèãíàëüíûå ïó-
òè è â îòâåò íà øèðîêèé ñïåêòð áèîòè÷åñêèõ è
àáèîòè÷åñêèõ ñòðåññîâ. Äëÿ èçó÷åíèÿ âîçìîæíîãî
âëèÿíèÿ íà íèõ D-àìèíîêèñëîò èëè èõ ìåòàáîëèçìà
in vivo ïðîðîñòêè Arabidopsis âûðàùèâàëè íà ñðåäàõ â
ïðèñóòñòâèè ÷åòûðåõ ôèçèêî-õèìè÷åñêè ðàçëè÷íûõ
àìèíîêèñëîò, âêëþ÷àÿ D-àñïàðòàò, D-ñåðèí, D-àëà-
íèí è D-ôåíèëàëàíèí. RT-PCR àíàëèç öèñòåèí-
ïðîòåèíàçû è ýêñïðåññèè ãåíà öèñòàòèíà ïîêàçàë,
÷òî äîáàâëåíèå D-àìèíîêèñëîò â ñðåäó äëÿ âûðà-
ùèâàíèÿ ðàñòåíèé çíà÷èòåëüíî èíäóöèðîâàëî ýêñ-
ïðåññèþ òðàíñêðèïòîâ ïðîòåèíàç, â òî æå âðåìÿ
ñíèæàÿ óðîâåíü ýêñïðåññèè ãåíà-èíãèáèòîðà â òêà-
íÿõ ëèñòüåâ è êîðíåé èññëåäóåìûõ ðàñòåíèé. Íà
îñíîâàíèè ïîëó÷åííûõ ðåçóëüòàòîâ îáñóæäàåòñÿ ïî-
òåíöèàëüíîå âëèÿíèå D-àìèíîêèñëîò èëè èõ ìåòà-
áîëèçìà íà àêòèâíîñòü â öèñòåèíïðîòåèíàçà/öèñòà-
òèí-çàâèñèìîì ïðîòåîëèòè÷åñêîì ïóòè, à òàêæå èõ
âîçìîæíîå âçàèìîäåéñòâèå â ðàñòèòåëüíîé ñèñòåìå.
REFERENCES
1. Wisniewski K., Zagdanska B. Genotype-dependent
proteolytic response of spring wheat to water defi-
ciency // J. Exp. Bot. – 2001. – 52. – P. 1455–1463 .
2. Grudkowska M.M., Zagda ska B. Multifunctional role
of plant cysteine proteinases // Acta Biochim. Polon. –
2004. – 51. – P. 609–624.
3. Aberlenc-Bertossi F., Chabrillange N., Duval Y., Tre-
gear J. Contrasting globulin and cysteine proteinase
gene expression patterns reveal fundamental deve-
lopmental differences between zygotic and somatic
embryos of oil palm // Tree Physiol. – 2008. – 28. –
P. 1157–1167.
4. Fan J., Yang Y.W., Gao X. et al. Expression of a
senescence-associated cysteine protease gene related
to peel pitting of navel orange (Citrus sinensis L.
Osbeck) // Plant Cell Tiss. Organ.Cult. – 2009. –
98. – P. 281–289.
5. Rzychon M., Chmiel D., Stec-Niemczyk J. Modes of
inhibition of cysteine proteases // Acta Biochim.
Pol. – 2004. – 51. – P. 861–873.
6. Solomon M., Belenghi B., Delledonne M. et al. The
involvement of cysteine proteases and protease in-
hibitor genes in the regulation of programmed cell
death in plants // Plant Cell. – 1999. – 11. – P. 431–
443.
7. Martínez M., Cambra I., González-Melendi P. et al.
C1A cysteine-proteases and their inhibitors in plants //
Physiol. Plant. – 2012. – 145. – P. 85–94.
8. Bode W., Engh R., Musil D. et al. Mechanism of in-
teraction of cysteine proteinases and their protein
inhibitors as compared to the serine proteinase-in-
hibitor interaction // Biol. Chem. Hoppe-Seyler. –
1990. – 371. – P. 111–118.
9. Grzonka Z., Jankowska E., Kasprzykowski F. et al.
Structural studies of cysteine proteases and their
inhibitors // Acta Biochim. Pol. – 2001. – 48. –
P. 1–20.
10. Santamaría M.E., Hernández-Crespo P., Ortego F. et al.
Cysteine peptidases and their inhibitors in Tetranychus
urticae: a comparative genomic approach // BMC
Genom. – 2012. – 13. – P. 307–319.
11. Bode W., Huber R. Structural basis of the endo-
proteinase – protein inhibitor interaction // Biochim.
Biophys. Acta. – 2000. – 1477. – P. 241–252.
12. Barrett A.J., Fritz H., Grubb A. Nomenclature and
classification of the proteins homologous with the
cysteine-proteinase inhibitor chicken cystatin //
Biochem. J. – 1998. – 236. – P. 312–318.
13. Rawling N.D., Barrett A.J. Evolution of proteins of
the cystatin superfamily // J. Mol. Evol. – 1990. –
30. – P. 60–71.
14. Bateman A., Birney E., Cerruti L. et al. The Pfam pro-
tein families database // Nucl. Acids Res. – 2002. –
30. – P. 276–280.
15. Martinez M., Diaz I. The origin and evolution of
plant cystatins and their target cysteine proteinases
indicate a complex functional relationship // BMC
Evol. Biol. – 2008. – 8. – P. 198–209.
ISSN 0564–3783. Öèòîëîãèÿ è ãåíåòèêà. 2015. Ò. 49. ¹ 210
A. Gholizadeh
16. Wiederanders B. Structure-function relationships in
class CA1 cysteine peptidase propeptides // Acta
Biochim. Pol. – 2003. – 50. – P. 691–713.
17. Simpson D.J. Proteolytic degradation of cereal
prolamins – the problem with praline // Plant Sci. –
2001. – 161. – P. 825–838.
18. Shindo T., Misas-Villamil J.C., Horger N.C. et al. A
role in immunity for arabidopsis cysteine protease
RD21, the ortholog of the tomato immune protease
C14 // PLoS ONE. – 2012. – 7. – P. e29317.
19. Arai S., Matsumoto I., Emori Y., Abe K. Plant seed
cystatins and their target enzymes of endogenous and
exogenous origin // J. Agric. Food. Chem. – 2002. –
50. – P. 6612–6617.
20. Diop N.N., Kidric M., Repellin A. et al. A multicystatin
is induced by drought-stress in cowpea (Vigna un-
guiculata (L.) Walp.) leaves // FEBS Lett. – 2004. –
577. – P. 545–550.
21. Belenghi B., Acconcia F., Trovato M. et al. AtCYS1,
a cystatin from Arabidopsis thaliana, suppresses hy-
persensitive cell death // Eur. J. Biochem. – 2003. –
270. – P. 2593–2604.
22. Tishkov V.L., Khoronenkova S.V. D-amino acid oxi-
dase: structure, catalytic mechanism and practical
application // Rus. J. Biochemistry. – 2005. – 70. –
P. 51–56.
23. Gholizadeh A., Faizi M.H., Kohnehrouz B.B. Molecular
detection of drought stress-inducible D-amino acid
oxidase gene from Zea mays L. // Asian J. Plant Sci. –
2009. – 8. – P. 224–229.
24. Annedi S.C., Biabani F., Poduch E. et al. Engineering
D-amino acid containing novel protease inhibitors
using catalytic site architecture // Bioorg. Med.
Chem. – 2006. – 14. – P. 214–236.
25. Sato A., Tri J., Nakahara K. et al. Combination of
non-natural D-amino acid derivatives and allophe-
nylnorstatine-dimethylthioproline scaffold in HIV
protease inhibitors have high efficacy in mutant HIV //
J. Med. Chem. – 2008. – 51. – P. 2992–3004.
26. Ausubel F.M., Brent R., Kingston R.E. et al. Current
Protocols in Molecular Biology. – New York : John
Wiley and Sons, 1991.
27. Livak K.J., Schmittgen T.D. Analysis of relative gene
expression data using real-time quantitative PCR
and the 2–DDCt method // Methods. – 2001. – 25. –
P. 402–408.
28. Palma J.M., Sandalio L.M., Corpas F.J. et al. Plant
proteases, protein degradation, and oxidative stress:
role of peroxisomes // Plant Physiol. Biochem. –
2002. – 40. – P. 521–530.
29. Ueda T., Seo S., Ohashi Y., Hashimoto J. Circadian
and senescence-enhanced expression of a tobacco
cysteine protease gene // Plant Mol. Biol. – 2000. –
44. – P. 649–657.
30. Erickson O., Hertzberg M., Nasholm T. A conditional
marker gene allowing both positive and negative
selection in plants // Nat. Biotechnol. – 2004. – 22. –
P. 455–458.
Received 13.10.13
<<
/ASCII85EncodePages false
/AllowTransparency false
/AutoPositionEPSFiles true
/AutoRotatePages /None
/Binding /Left
/CalGrayProfile (Dot Gain 20%)
/CalRGBProfile (sRGB IEC61966-2.1)
/CalCMYKProfile (U.S. Web Coated \050SWOP\051 v2)
/sRGBProfile (sRGB IEC61966-2.1)
/CannotEmbedFontPolicy /Error
/CompatibilityLevel 1.4
/CompressObjects /Tags
/CompressPages true
/ConvertImagesToIndexed true
/PassThroughJPEGImages true
/CreateJobTicket false
/DefaultRenderingIntent /Default
/DetectBlends true
/DetectCurves 0.0000
/ColorConversionStrategy /CMYK
/DoThumbnails false
/EmbedAllFonts true
/EmbedOpenType false
/ParseICCProfilesInComments true
/EmbedJobOptions true
/DSCReportingLevel 0
/EmitDSCWarnings false
/EndPage -1
/ImageMemory 1048576
/LockDistillerParams false
/MaxSubsetPct 100
/Optimize true
/OPM 1
/ParseDSCComments true
/ParseDSCCommentsForDocInfo true
/PreserveCopyPage true
/PreserveDICMYKValues true
/PreserveEPSInfo true
/PreserveFlatness true
/PreserveHalftoneInfo false
/PreserveOPIComments false
/PreserveOverprintSettings true
/StartPage 1
/SubsetFonts true
/TransferFunctionInfo /Apply
/UCRandBGInfo /Preserve
/UsePrologue false
/ColorSettingsFile ()
/AlwaysEmbed [ true
]
/NeverEmbed [ true
]
/AntiAliasColorImages false
/CropColorImages true
/ColorImageMinResolution 300
/ColorImageMinResolutionPolicy /OK
/DownsampleColorImages true
/ColorImageDownsampleType /Bicubic
/ColorImageResolution 1200
/ColorImageDepth -1
/ColorImageMinDownsampleDepth 1
/ColorImageDownsampleThreshold 1.50000
/EncodeColorImages false
/ColorImageFilter /DCTEncode
/AutoFilterColorImages true
/ColorImageAutoFilterStrategy /JPEG
/ColorACSImageDict <<
/QFactor 0.15
/HSamples [1 1 1 1] /VSamples [1 1 1 1]
>>
/ColorImageDict <<
/QFactor 0.15
/HSamples [1 1 1 1] /VSamples [1 1 1 1]
>>
/JPEG2000ColorACSImageDict <<
/TileWidth 256
/TileHeight 256
/Quality 30
>>
/JPEG2000ColorImageDict <<
/TileWidth 256
/TileHeight 256
/Quality 30
>>
/AntiAliasGrayImages false
/CropGrayImages true
/GrayImageMinResolution 300
/GrayImageMinResolutionPolicy /OK
/DownsampleGrayImages true
/GrayImageDownsampleType /Bicubic
/GrayImageResolution 1200
/GrayImageDepth -1
/GrayImageMinDownsampleDepth 2
/GrayImageDownsampleThreshold 1.50000
/EncodeGrayImages false
/GrayImageFilter /DCTEncode
/AutoFilterGrayImages true
/GrayImageAutoFilterStrategy /JPEG
/GrayACSImageDict <<
/QFactor 0.15
/HSamples [1 1 1 1] /VSamples [1 1 1 1]
>>
/GrayImageDict <<
/QFactor 0.15
/HSamples [1 1 1 1] /VSamples [1 1 1 1]
>>
/JPEG2000GrayACSImageDict <<
/TileWidth 256
/TileHeight 256
/Quality 30
>>
/JPEG2000GrayImageDict <<
/TileWidth 256
/TileHeight 256
/Quality 30
>>
/AntiAliasMonoImages false
/CropMonoImages true
/MonoImageMinResolution 1200
/MonoImageMinResolutionPolicy /OK
/DownsampleMonoImages true
/MonoImageDownsampleType /Bicubic
/MonoImageResolution 1200
/MonoImageDepth -1
/MonoImageDownsampleThreshold 1.50000
/EncodeMonoImages false
/MonoImageFilter /CCITTFaxEncode
/MonoImageDict <<
/K -1
>>
/AllowPSXObjects false
/CheckCompliance [
/None
]
/PDFX1aCheck false
/PDFX3Check false
/PDFXCompliantPDFOnly false
/PDFXNoTrimBoxError true
/PDFXTrimBoxToMediaBoxOffset [
0.00000
0.00000
0.00000
0.00000
]
/PDFXSetBleedBoxToMediaBox true
/PDFXBleedBoxToTrimBoxOffset [
0.00000
0.00000
0.00000
0.00000
]
/PDFXOutputIntentProfile (None)
/PDFXOutputConditionIdentifier ()
/PDFXOutputCondition ()
/PDFXRegistryName ()
/PDFXTrapped /False
/CreateJDFFile false
/Description <<
/ARA <FEFF06270633062A062E062F0645002006470630064700200627064406250639062F0627062F0627062A002006440625064606340627062100200648062B062706260642002000410064006F00620065002000500044004600200645062A064806270641064206290020064406440637062806270639062900200641064A00200627064406450637062706280639002006300627062A0020062F0631062C0627062A002006270644062C0648062F0629002006270644063906270644064A0629061B0020064A06450643064600200641062A062D00200648062B0627062606420020005000440046002006270644064506460634062306290020062806270633062A062E062F062706450020004100630072006F0062006100740020064800410064006F006200650020005200650061006400650072002006250635062F0627063100200035002E0030002006480627064406250635062F062706310627062A0020062706440623062D062F062B002E0635062F0627063100200035002E0030002006480627064406250635062F062706310627062A0020062706440623062D062F062B002E>
/BGR <FEFF04180437043f043e043b043704320430043904420435002004420435043704380020043d0430044104420440043e0439043a0438002c00200437043000200434043000200441044a0437043404300432043004420435002000410064006f00620065002000500044004600200434043e043a0443043c0435043d04420438002c0020043c0430043a04410438043c0430043b043d043e0020043f044004380433043e04340435043d04380020043704300020043204380441043e043a043e043a0430044704350441044204320435043d0020043f04350447043004420020043704300020043f044004350434043f0435044704300442043d04300020043f043e04340433043e0442043e0432043a0430002e002000200421044a04370434043004340435043d043804420435002000500044004600200434043e043a0443043c0435043d044204380020043c043e0433043004420020043404300020044104350020043e0442043204300440044f0442002004410020004100630072006f00620061007400200438002000410064006f00620065002000520065006100640065007200200035002e00300020043800200441043b0435043404320430044904380020043204350440044104380438002e>
/CHS <FEFF4f7f75288fd94e9b8bbe5b9a521b5efa7684002000410064006f006200650020005000440046002065876863900275284e8e9ad88d2891cf76845370524d53705237300260a853ef4ee54f7f75280020004100630072006f0062006100740020548c002000410064006f00620065002000520065006100640065007200200035002e003000204ee553ca66f49ad87248672c676562535f00521b5efa768400200050004400460020658768633002>
/CHT <FEFF4f7f752890194e9b8a2d7f6e5efa7acb7684002000410064006f006200650020005000440046002065874ef69069752865bc9ad854c18cea76845370524d5370523786557406300260a853ef4ee54f7f75280020004100630072006f0062006100740020548c002000410064006f00620065002000520065006100640065007200200035002e003000204ee553ca66f49ad87248672c4f86958b555f5df25efa7acb76840020005000440046002065874ef63002>
/CZE <FEFF005400610074006f0020006e006100730074006100760065006e00ed00200070006f0075017e0069006a007400650020006b0020007600790074007600e101590065006e00ed00200064006f006b0075006d0065006e0074016f002000410064006f006200650020005000440046002c0020006b00740065007200e90020007300650020006e0065006a006c00e90070006500200068006f006400ed002000700072006f0020006b00760061006c00690074006e00ed0020007400690073006b00200061002000700072006500700072006500730073002e002000200056007900740076006f01590065006e00e900200064006f006b0075006d0065006e007400790020005000440046002000620075006400650020006d006f017e006e00e90020006f007400650076015900ed007400200076002000700072006f006700720061006d0065006300680020004100630072006f00620061007400200061002000410064006f00620065002000520065006100640065007200200035002e0030002000610020006e006f0076011b006a016100ed00630068002e>
/DAN <FEFF004200720075006700200069006e0064007300740069006c006c0069006e006700650072006e0065002000740069006c0020006100740020006f007000720065007400740065002000410064006f006200650020005000440046002d0064006f006b0075006d0065006e007400650072002c0020006400650072002000620065006400730074002000650067006e006500720020007300690067002000740069006c002000700072006500700072006500730073002d007500640073006b007200690076006e0069006e00670020006100660020006800f8006a0020006b00760061006c0069007400650074002e0020004400650020006f007000720065007400740065006400650020005000440046002d0064006f006b0075006d0065006e0074006500720020006b0061006e002000e50062006e00650073002000690020004100630072006f00620061007400200065006c006c006500720020004100630072006f006200610074002000520065006100640065007200200035002e00300020006f00670020006e0079006500720065002e>
/DEU <FEFF00560065007200770065006e00640065006e0020005300690065002000640069006500730065002000450069006e007300740065006c006c0075006e00670065006e0020007a0075006d002000450072007300740065006c006c0065006e00200076006f006e002000410064006f006200650020005000440046002d0044006f006b0075006d0065006e00740065006e002c00200076006f006e002000640065006e0065006e002000530069006500200068006f006300680077006500720074006900670065002000500072006500700072006500730073002d0044007200750063006b0065002000650072007a0065007500670065006e0020006d00f60063006800740065006e002e002000450072007300740065006c006c007400650020005000440046002d0044006f006b0075006d0065006e007400650020006b00f6006e006e0065006e0020006d006900740020004100630072006f00620061007400200075006e0064002000410064006f00620065002000520065006100640065007200200035002e00300020006f0064006500720020006800f600680065007200200067006500f600660066006e00650074002000770065007200640065006e002e>
/ESP <FEFF005500740069006c0069006300650020006500730074006100200063006f006e0066006900670075007200610063006900f3006e0020007000610072006100200063007200650061007200200064006f00630075006d0065006e0074006f00730020005000440046002000640065002000410064006f0062006500200061006400650063007500610064006f00730020007000610072006100200069006d0070007200650073006900f3006e0020007000720065002d0065006400690074006f007200690061006c00200064006500200061006c00740061002000630061006c0069006400610064002e002000530065002000700075006500640065006e00200061006200720069007200200064006f00630075006d0065006e0074006f00730020005000440046002000630072006500610064006f007300200063006f006e0020004100630072006f006200610074002c002000410064006f00620065002000520065006100640065007200200035002e003000200079002000760065007200730069006f006e0065007300200070006f00730074006500720069006f007200650073002e>
/ETI <FEFF004b00610073007500740061006700650020006e0065006900640020007300e4007400740065006900640020006b00760061006c006900740065006500740073006500200074007200fc006b006900650065006c007300650020007000720069006e00740069006d0069007300650020006a0061006f006b007300200073006f00620069006c0069006b0065002000410064006f006200650020005000440046002d0064006f006b0075006d0065006e00740069006400650020006c006f006f006d006900730065006b0073002e00200020004c006f006f0064007500640020005000440046002d0064006f006b0075006d0065006e00740065002000730061006100740065002000610076006100640061002000700072006f006700720061006d006d006900640065006700610020004100630072006f0062006100740020006e0069006e0067002000410064006f00620065002000520065006100640065007200200035002e00300020006a00610020007500750065006d006100740065002000760065007200730069006f006f006e00690064006500670061002e000d000a>
/FRA <FEFF005500740069006c006900730065007a00200063006500730020006f007000740069006f006e00730020006100660069006e00200064006500200063007200e900650072002000640065007300200064006f00630075006d0065006e00740073002000410064006f00620065002000500044004600200070006f0075007200200075006e00650020007100750061006c0069007400e90020006400270069006d007000720065007300730069006f006e00200070007200e9007000720065007300730065002e0020004c0065007300200064006f00630075006d0065006e00740073002000500044004600200063007200e900e90073002000700065007500760065006e0074002000ea0074007200650020006f007500760065007200740073002000640061006e00730020004100630072006f006200610074002c002000610069006e00730069002000710075002700410064006f00620065002000520065006100640065007200200035002e0030002000650074002000760065007200730069006f006e007300200075006c007400e90072006900650075007200650073002e>
/GRE <FEFF03a703c103b703c303b903bc03bf03c003bf03b903ae03c303c403b5002003b103c503c403ad03c2002003c403b903c2002003c103c503b803bc03af03c303b503b903c2002003b303b903b1002003bd03b1002003b403b703bc03b903bf03c503c103b303ae03c303b503c403b5002003ad03b303b303c103b103c603b1002000410064006f006200650020005000440046002003c003bf03c5002003b503af03bd03b103b9002003ba03b103c42019002003b503be03bf03c703ae03bd002003ba03b103c403ac03bb03bb03b703bb03b1002003b303b903b1002003c003c103bf002d03b503ba03c403c503c003c903c403b903ba03ad03c2002003b503c103b303b103c303af03b503c2002003c503c803b703bb03ae03c2002003c003bf03b903cc03c403b703c403b103c2002e0020002003a403b10020005000440046002003ad03b303b303c103b103c603b1002003c003bf03c5002003ad03c703b503c403b5002003b403b703bc03b903bf03c503c103b303ae03c303b503b9002003bc03c003bf03c103bf03cd03bd002003bd03b1002003b103bd03bf03b903c703c403bf03cd03bd002003bc03b5002003c403bf0020004100630072006f006200610074002c002003c403bf002000410064006f00620065002000520065006100640065007200200035002e0030002003ba03b103b9002003bc03b503c403b103b303b503bd03ad03c303c403b503c103b503c2002003b503ba03b403cc03c303b503b903c2002e>
/HEB <FEFF05D405E905EA05DE05E905D5002005D105D405D205D305E805D505EA002005D005DC05D4002005DB05D305D9002005DC05D905E605D505E8002005DE05E105DE05DB05D9002000410064006F006200650020005000440046002005D405DE05D505EA05D005DE05D905DD002005DC05D405D305E405E105EA002005E705D305DD002D05D305E405D505E1002005D005D905DB05D505EA05D905EA002E002005DE05E105DE05DB05D90020005000440046002005E905E005D505E605E805D5002005E005D905EA05E005D905DD002005DC05E405EA05D905D705D4002005D105D005DE05E605E205D505EA0020004100630072006F006200610074002005D5002D00410064006F00620065002000520065006100640065007200200035002E0030002005D505D205E805E105D005D505EA002005DE05EA05E705D305DE05D505EA002005D905D505EA05E8002E05D005DE05D905DD002005DC002D005000440046002F0058002D0033002C002005E205D905D905E005D5002005D105DE05D305E805D905DA002005DC05DE05E905EA05DE05E9002005E905DC0020004100630072006F006200610074002E002005DE05E105DE05DB05D90020005000440046002005E905E005D505E605E805D5002005E005D905EA05E005D905DD002005DC05E405EA05D905D705D4002005D105D005DE05E605E205D505EA0020004100630072006F006200610074002005D5002D00410064006F00620065002000520065006100640065007200200035002E0030002005D505D205E805E105D005D505EA002005DE05EA05E705D305DE05D505EA002005D905D505EA05E8002E>
/HRV (Za stvaranje Adobe PDF dokumenata najpogodnijih za visokokvalitetni ispis prije tiskanja koristite ove postavke. Stvoreni PDF dokumenti mogu se otvoriti Acrobat i Adobe Reader 5.0 i kasnijim verzijama.)
/HUN <FEFF004b0069007600e1006c00f30020006d0069006e0151007300e9006701710020006e0079006f006d00640061006900200065006c0151006b00e90073007a00ed007401510020006e0079006f006d00740061007400e100730068006f007a0020006c006500670069006e006b00e1006200620020006d0065006700660065006c0065006c0151002000410064006f00620065002000500044004600200064006f006b0075006d0065006e00740075006d006f006b0061007400200065007a0065006b006b0065006c0020006100200062006500e1006c006c00ed007400e10073006f006b006b0061006c0020006b00e90073007a00ed0074006800650074002e0020002000410020006c00e90074007200650068006f007a006f00740074002000500044004600200064006f006b0075006d0065006e00740075006d006f006b00200061007a0020004100630072006f006200610074002000e9007300200061007a002000410064006f00620065002000520065006100640065007200200035002e0030002c0020007600610067007900200061007a002000610074007400f3006c0020006b00e9007301510062006200690020007600650072007a006900f3006b006b0061006c0020006e00790069007400680061007400f3006b0020006d00650067002e>
/ITA <FEFF005500740069006c0069007a007a006100720065002000710075006500730074006500200069006d0070006f007300740061007a0069006f006e00690020007000650072002000630072006500610072006500200064006f00630075006d0065006e00740069002000410064006f00620065002000500044004600200070006900f900200061006400610074007400690020006100200075006e00610020007000720065007300740061006d0070006100200064006900200061006c007400610020007100750061006c0069007400e0002e0020004900200064006f00630075006d0065006e007400690020005000440046002000630072006500610074006900200070006f00730073006f006e006f0020006500730073006500720065002000610070006500720074006900200063006f006e0020004100630072006f00620061007400200065002000410064006f00620065002000520065006100640065007200200035002e003000200065002000760065007200730069006f006e006900200073007500630063006500730073006900760065002e>
/JPN <FEFF9ad854c18cea306a30d730ea30d730ec30b951fa529b7528002000410064006f0062006500200050004400460020658766f8306e4f5c6210306b4f7f75283057307e305930023053306e8a2d5b9a30674f5c62103055308c305f0020005000440046002030d530a130a430eb306f3001004100630072006f0062006100740020304a30883073002000410064006f00620065002000520065006100640065007200200035002e003000204ee5964d3067958b304f30533068304c3067304d307e305930023053306e8a2d5b9a306b306f30d530a930f330c8306e57cb30818fbc307f304c5fc59808306730593002>
/KOR <FEFFc7740020c124c815c7440020c0acc6a9d558c5ec0020ace0d488c9c80020c2dcd5d80020c778c1c4c5d00020ac00c7a50020c801d569d55c002000410064006f0062006500200050004400460020bb38c11cb97c0020c791c131d569b2c8b2e4002e0020c774b807ac8c0020c791c131b41c00200050004400460020bb38c11cb2940020004100630072006f0062006100740020bc0f002000410064006f00620065002000520065006100640065007200200035002e00300020c774c0c1c5d0c11c0020c5f40020c2180020c788c2b5b2c8b2e4002e>
/LTH <FEFF004e006100750064006f006b0069007400650020016100690075006f007300200070006100720061006d006500740072007500730020006e006f0072011700640061006d00690020006b0075007200740069002000410064006f00620065002000500044004600200064006f006b0075006d0065006e007400750073002c0020006b00750072006900650020006c0061006200690061007500730069006100690020007000720069007400610069006b007900740069002000610075006b01610074006f00730020006b006f006b007900620117007300200070006100720065006e006700740069006e00690061006d00200073007000610075007300640069006e0069006d00750069002e0020002000530075006b0075007200740069002000500044004600200064006f006b0075006d0065006e007400610069002000670061006c006900200062016b007400690020006100740069006400610072006f006d00690020004100630072006f006200610074002000690072002000410064006f00620065002000520065006100640065007200200035002e0030002000610072002000760117006c00650073006e0117006d00690073002000760065007200730069006a006f006d00690073002e>
/LVI <FEFF0049007a006d0061006e0074006f006a00690065007400200161006f00730020006900650073007400610074012b006a0075006d00750073002c0020006c0061006900200076006500690064006f00740075002000410064006f00620065002000500044004600200064006f006b0075006d0065006e007400750073002c0020006b006100730020006900720020012b00700061016100690020007000690065006d01130072006f00740069002000610075006700730074006100730020006b00760061006c0069007401010074006500730020007000690072006d007300690065007300700069006501610061006e006100730020006400720075006b00610069002e00200049007a0076006500690064006f006a006900650074002000500044004600200064006f006b0075006d0065006e007400750073002c0020006b006f002000760061007200200061007400760113007200740020006100720020004100630072006f00620061007400200075006e002000410064006f00620065002000520065006100640065007200200035002e0030002c0020006b0101002000610072012b00200074006f0020006a00610075006e0101006b0101006d002000760065007200730069006a0101006d002e>
/NLD (Gebruik deze instellingen om Adobe PDF-documenten te maken die zijn geoptimaliseerd voor prepress-afdrukken van hoge kwaliteit. De gemaakte PDF-documenten kunnen worden geopend met Acrobat en Adobe Reader 5.0 en hoger.)
/NOR <FEFF004200720075006b00200064006900730073006500200069006e006e007300740069006c006c0069006e00670065006e0065002000740069006c002000e50020006f0070007000720065007400740065002000410064006f006200650020005000440046002d0064006f006b0075006d0065006e00740065007200200073006f006d00200065007200200062006500730074002000650067006e0065007400200066006f00720020006600f80072007400720079006b006b0073007500740073006b00720069006600740020006100760020006800f800790020006b00760061006c0069007400650074002e0020005000440046002d0064006f006b0075006d0065006e00740065006e00650020006b0061006e002000e50070006e00650073002000690020004100630072006f00620061007400200065006c006c00650072002000410064006f00620065002000520065006100640065007200200035002e003000200065006c006c00650072002000730065006e006500720065002e>
/POL <FEFF0055007300740061007700690065006e0069006100200064006f002000740077006f0072007a0065006e0069006100200064006f006b0075006d0065006e007400f300770020005000440046002000700072007a0065007a006e00610063007a006f006e00790063006800200064006f002000770079006400720075006b00f30077002000770020007700790073006f006b00690065006a0020006a0061006b006f015b00630069002e002000200044006f006b0075006d0065006e0074007900200050004400460020006d006f017c006e00610020006f007400770069006500720061010700200077002000700072006f006700720061006d006900650020004100630072006f00620061007400200069002000410064006f00620065002000520065006100640065007200200035002e0030002000690020006e006f00770073007a0079006d002e>
/PTB <FEFF005500740069006c0069007a006500200065007300730061007300200063006f006e00660069006700750072006100e700f50065007300200064006500200066006f0072006d00610020006100200063007200690061007200200064006f00630075006d0065006e0074006f0073002000410064006f0062006500200050004400460020006d00610069007300200061006400650071007500610064006f00730020007000610072006100200070007200e9002d0069006d0070007200650073007300f50065007300200064006500200061006c007400610020007100750061006c00690064006100640065002e0020004f007300200064006f00630075006d0065006e0074006f00730020005000440046002000630072006900610064006f007300200070006f00640065006d0020007300650072002000610062006500720074006f007300200063006f006d0020006f0020004100630072006f006200610074002000650020006f002000410064006f00620065002000520065006100640065007200200035002e0030002000650020007600650072007300f50065007300200070006f00730074006500720069006f007200650073002e>
/RUM <FEFF005500740069006c0069007a00610163006900200061006300650073007400650020007300650074010300720069002000700065006e007400720075002000610020006300720065006100200064006f00630075006d0065006e00740065002000410064006f006200650020005000440046002000610064006500630076006100740065002000700065006e0074007200750020007400690070010300720069007200650061002000700072006500700072006500730073002000640065002000630061006c006900740061007400650020007300750070006500720069006f006100720103002e002000200044006f00630075006d0065006e00740065006c00650020005000440046002000630072006500610074006500200070006f00740020006600690020006400650073006300680069007300650020006300750020004100630072006f006200610074002c002000410064006f00620065002000520065006100640065007200200035002e00300020015f00690020007600650072007300690075006e0069006c006500200075006c0074006500720069006f006100720065002e>
/RUS <FEFF04180441043f043e043b044c04370443043904420435002004340430043d043d044b04350020043d0430044104420440043e0439043a043800200434043b044f00200441043e043704340430043d0438044f00200434043e043a0443043c0435043d0442043e0432002000410064006f006200650020005000440046002c0020043c0430043a04410438043c0430043b044c043d043e0020043f043e04340445043e0434044f04490438044500200434043b044f00200432044b0441043e043a043e043a0430044704350441044204320435043d043d043e0433043e00200434043e043f0435044704300442043d043e0433043e00200432044b0432043e04340430002e002000200421043e043704340430043d043d044b04350020005000440046002d0434043e043a0443043c0435043d0442044b0020043c043e0436043d043e0020043e0442043a0440044b043204300442044c002004410020043f043e043c043e0449044c044e0020004100630072006f00620061007400200438002000410064006f00620065002000520065006100640065007200200035002e00300020043800200431043e043b043504350020043f043e04370434043d043804450020043204350440044104380439002e>
/SKY <FEFF0054006900650074006f0020006e006100730074006100760065006e0069006100200070006f0075017e0069007400650020006e00610020007600790074007600e100720061006e0069006500200064006f006b0075006d0065006e0074006f0076002000410064006f006200650020005000440046002c0020006b0074006f007200e90020007300610020006e0061006a006c0065007001610069006500200068006f0064006900610020006e00610020006b00760061006c00690074006e00fa00200074006c0061010d00200061002000700072006500700072006500730073002e00200056007900740076006f00720065006e00e900200064006f006b0075006d0065006e007400790020005000440046002000620075006400650020006d006f017e006e00e90020006f00740076006f00720069016500200076002000700072006f006700720061006d006f006300680020004100630072006f00620061007400200061002000410064006f00620065002000520065006100640065007200200035002e0030002000610020006e006f0076016100ed00630068002e>
/SLV <FEFF005400650020006e006100730074006100760069007400760065002000750070006f0072006100620069007400650020007a00610020007500730074007600610072006a0061006e006a006500200064006f006b0075006d0065006e0074006f0076002000410064006f006200650020005000440046002c0020006b006900200073006f0020006e0061006a007000720069006d00650072006e0065006a016100690020007a00610020006b0061006b006f0076006f00730074006e006f0020007400690073006b0061006e006a00650020007300200070007200690070007200610076006f0020006e00610020007400690073006b002e00200020005500730074007600610072006a0065006e006500200064006f006b0075006d0065006e0074006500200050004400460020006a00650020006d006f0067006f010d00650020006f0064007000720065007400690020007a0020004100630072006f00620061007400200069006e002000410064006f00620065002000520065006100640065007200200035002e003000200069006e0020006e006f00760065006a01610069006d002e>
/SUO <FEFF004b00e40079007400e40020006e00e40069007400e4002000610073006500740075006b007300690061002c0020006b0075006e0020006c0075006f00740020006c00e400680069006e006e00e4002000760061006100740069007600610061006e0020007000610069006e006100740075006b00730065006e002000760061006c006d0069007300740065006c00750074007900f6006800f6006e00200073006f00700069007600690061002000410064006f0062006500200050004400460020002d0064006f006b0075006d0065006e007400740065006a0061002e0020004c0075006f0064007500740020005000440046002d0064006f006b0075006d0065006e00740069007400200076006f0069006400610061006e0020006100760061007400610020004100630072006f0062006100740069006c006c00610020006a0061002000410064006f00620065002000520065006100640065007200200035002e0030003a006c006c00610020006a006100200075007500640065006d006d0069006c006c0061002e>
/SVE <FEFF0041006e007600e4006e00640020006400650020006800e4007200200069006e0073007400e4006c006c006e0069006e006700610072006e00610020006f006d002000640075002000760069006c006c00200073006b006100700061002000410064006f006200650020005000440046002d0064006f006b0075006d0065006e007400200073006f006d002000e400720020006c00e4006d0070006c0069006700610020006600f60072002000700072006500700072006500730073002d007500740073006b00720069006600740020006d006500640020006800f600670020006b00760061006c0069007400650074002e002000200053006b006100700061006400650020005000440046002d0064006f006b0075006d0065006e00740020006b0061006e002000f600700070006e00610073002000690020004100630072006f0062006100740020006f00630068002000410064006f00620065002000520065006100640065007200200035002e00300020006f00630068002000730065006e006100720065002e>
/TUR <FEFF005900fc006b00730065006b0020006b0061006c006900740065006c0069002000f6006e002000790061007a006401310072006d00610020006200610073006b013100730131006e006100200065006e0020006900790069002000750079006100620069006c006500630065006b002000410064006f006200650020005000440046002000620065006c00670065006c0065007200690020006f006c0075015f007400750072006d0061006b0020006900e70069006e00200062007500200061007900610072006c0061007201310020006b0075006c006c0061006e0131006e002e00200020004f006c0075015f0074007500720075006c0061006e0020005000440046002000620065006c00670065006c0065007200690020004100630072006f006200610074002000760065002000410064006f00620065002000520065006100640065007200200035002e003000200076006500200073006f006e0072006100730131006e00640061006b00690020007300fc007200fc006d006c00650072006c00650020006100e70131006c006100620069006c00690072002e>
/UKR <FEFF04120438043a043e0440043804410442043e043204430439044204350020044604560020043f043004400430043c043504420440043800200434043b044f0020044104420432043e04400435043d043d044f00200434043e043a0443043c0435043d044204560432002000410064006f006200650020005000440046002c0020044f043a04560020043d04300439043a04400430044904350020043f045604340445043e0434044f0442044c00200434043b044f0020043204380441043e043a043e044f043a04560441043d043e0433043e0020043f0435044004350434043404400443043a043e0432043e0433043e0020043404400443043a0443002e00200020042104420432043e04400435043d045600200434043e043a0443043c0435043d0442043800200050004400460020043c043e0436043d04300020043204560434043a0440043804420438002004430020004100630072006f006200610074002004420430002000410064006f00620065002000520065006100640065007200200035002e0030002004300431043e0020043f04560437043d04560448043e04570020043204350440044104560457002e>
/ENU (Use these settings to create Adobe PDF documents best suited for high-quality prepress printing. Created PDF documents can be opened with Acrobat and Adobe Reader 5.0 and later.)
>>
/Namespace [
(Adobe)
(Common)
(1.0)
]
/OtherNamespaces [
<<
/AsReaderSpreads false
/CropImagesToFrames true
/ErrorControl /WarnAndContinue
/FlattenerIgnoreSpreadOverrides false
/IncludeGuidesGrids false
/IncludeNonPrinting false
/IncludeSlug false
/Namespace [
(Adobe)
(InDesign)
(4.0)
]
/OmitPlacedBitmaps false
/OmitPlacedEPS false
/OmitPlacedPDF false
/SimulateOverprint /Legacy
>>
<<
/AddBleedMarks false
/AddColorBars false
/AddCropMarks false
/AddPageInfo false
/AddRegMarks false
/ConvertColors /ConvertToCMYK
/DestinationProfileName ()
/DestinationProfileSelector /DocumentCMYK
/Downsample16BitImages true
/FlattenerPreset <<
/PresetSelector /MediumResolution
>>
/FormElements false
/GenerateStructure false
/IncludeBookmarks false
/IncludeHyperlinks false
/IncludeInteractive false
/IncludeLayers false
/IncludeProfiles false
/MultimediaHandling /UseObjectSettings
/Namespace [
(Adobe)
(CreativeSuite)
(2.0)
]
/PDFXOutputIntentProfileSelector /DocumentCMYK
/PreserveEditing true
/UntaggedCMYKHandling /LeaveUntagged
/UntaggedRGBHandling /UseDocumentProfile
/UseDocumentBleed false
>>
]
>> setdistillerparams
<<
/HWResolution [2400 2400]
/PageSize [612.000 792.000]
>> setpagedevice
|