Polymorphisms of the dna base excision repair gene mutyh in head and neck cancer
Background: Head and neck squamous cell carcinomas (HNSCC) comprise about 6% of all malignant neoplasms. The major risk factors of HNSCC
 are smoking and alcohol consumption. Genetic polymorphisms of DNA repair enzymes may lead to genetic instability and carcinogenesis. MUTYH gene
 e...
Saved in:
| Published in: | Experimental Oncology |
|---|---|
| Date: | 2009 |
| Main Authors: | , , , , , , , |
| Format: | Article |
| Language: | English |
| Published: |
Інститут експериментальної патології, онкології і радіобіології ім. Р.Є. Кавецького НАН України
2009
|
| Subjects: | |
| Online Access: | https://nasplib.isofts.kiev.ua/handle/123456789/135113 |
| Tags: |
Add Tag
No Tags, Be the first to tag this record!
|
| Journal Title: | Digital Library of Periodicals of National Academy of Sciences of Ukraine |
| Cite this: | Polymorphisms of the dna base excision repair gene mutyh in head and neck cancer / T. Sliwinski, L. Markiewicz, P. Rusin, W. Pietruszewska, J. Olszewski, A. Morawiec-Sztandera,W. Mlynarski, I. Majsterek // Experimental Oncology. — 2009. — Т. 31, № 1. — С. 57-59. — Бібліогр.: 21 назв. — англ. |
Institution
Digital Library of Periodicals of National Academy of Sciences of Ukraine| _version_ | 1860267421744496640 |
|---|---|
| author | Sliwinski, T. Markiewicz, L. Rusin, P. Pietruszewska, W. Olszewski, J. Morawiec-Sztandera, A. Mlynarski, W. Majsterek, I. |
| author_facet | Sliwinski, T. Markiewicz, L. Rusin, P. Pietruszewska, W. Olszewski, J. Morawiec-Sztandera, A. Mlynarski, W. Majsterek, I. |
| citation_txt | Polymorphisms of the dna base excision repair gene mutyh in head and neck cancer / T. Sliwinski, L. Markiewicz, P. Rusin, W. Pietruszewska, J. Olszewski, A. Morawiec-Sztandera,W. Mlynarski, I. Majsterek // Experimental Oncology. — 2009. — Т. 31, № 1. — С. 57-59. — Бібліогр.: 21 назв. — англ. |
| collection | DSpace DC |
| container_title | Experimental Oncology |
| description | Background: Head and neck squamous cell carcinomas (HNSCC) comprise about 6% of all malignant neoplasms. The major risk factors of HNSCC
are smoking and alcohol consumption. Genetic polymorphisms of DNA repair enzymes may lead to genetic instability and carcinogenesis. MUTYH gene
encodes a DNA glycosylase that can initiate the base excision repair (BER) pathway and prevent G:C > T:A transversion by excising adenine mispaired
with 8-hydroxyguanine produced by reactive oxygen species (ROS). Aim: to perform a case-control study to test the association between polymorphism
in the MUTYH gene: Tyr165Cys and head and neck cancer risk progression. Methods: Genotypes were determined in DNA from peripheral blood
lymphocytes of 193 patients (among them 97 subjects with precancerous hyperplastic laryngeal lesions and 96 subjects with head and neck cancer)
and 140 age, sex and ethnic-matched cancer-free controls by tetra-primer amplification refractory mutation system PCR (T-ARMS-PCR). Results:
We found an association between head and neck cancer risk and the Tyr165Tyr variant of the MUTYH gene (OR 2.18; 95% CI 1.19–3.97). For
Tyr165Tyr genotype we also observed positive correlation with cancer progression assessed by tumor size (OR 4.56; 95% CI 1.60–12.95). We did
not observe any correlation between Tyr165Cys polymorphism of MUTYHgene and precancerous hyperplastic laryngeal lesions risk. Conclusion:
The Tyr165Tyr polymorphic variant of the MUTYHgene may be associated with head and neck cancer in Polish population.
|
| first_indexed | 2025-12-07T19:02:25Z |
| format | Article |
| fulltext |
Experimental Oncology 31, 57–59, 2009 (March) 57
Head and neck squamous cell carcinomas (HNSCC)
comprise about 6% of all malignant neoplasms. Overall
survival is low, especially in developing countries, and
the major risk factors of HNSCC are smoking and/or al-
cohol consumption [1]. Tobacco and alcohol consump-
tion are the main etiological factors in head and neck
carcinogenesis [2]. Head and neck carcinogenesis is
associated with abnormalities in DNA repair, apoptosis,
carcinogen metabolism and cell-cycle control [3–5].
Polymorphisms of DNA repair genes may influence
variation in individual DNA repair capacity, which is
crucial for preventing genomic instability and in turn
may be associated with risk of cancer [6]. Among the
various DNA repair pathways, base excision repair
(BER) is considered to play a key role by removing
DNA damage from oxidation, deamination, and ring
fragmentation [7]. Exposure to tobacco smoking
can increase production of reactive oxygen species
(ROS), which have the potential to induce oxidative
damage, like the stable guanine adduct 8-oxoguanine
[8]. Moreover, the variation in ability of glycosylases
MUTYH or OGG1 involving in BER may be associated
with cancer risk occurrence [9]. MUTYH excises the
misincorporated adenine opposite 8-oxoguanine, and
thus prevents 8-oxoguanine-induced mutagenesis.
An increased susceptibility to spontaneous carcino-
genesis of the liver, lung or intestine was observed in
MUTYH-null mice [10]. Moreover Germ-line MUTYH
mutations predispose persons to a recessive pheno-
type, multiple adenomas, or polyposis coli [11].
In this paper we described a case-control study
performed to test the association between single
nucleotide polymorphisms (SNPs) of MUTYH gene
and the occcurence as wel as progression of head and
neck cancer. We investigated MUTYH polymorphism
of a G → A transition producing a Tyr → Cys substitution
at codon 165 located in chromosome 1 (the Tyr165Cys
polymorphism; rs34612342) in patients with precancer-
ous hyperplastic laryngeal lesions (PHLL), patients with
head and neck cancer and cancer-free controls.
Patients. Blood samples were obtained from 193 pa-
tients, among them 97 subjects had precancerous hyper-
plastic laryngeal lesions (80 men and 17 women; median
age 52, quartiles: 37, 74 years) and 96 subjects have
been diagnosed with head and neck cancer (83 men
and 13 women; median age 54, quartiles: 37, 76 years).
Control samples consisted of age- (± 5 years) and sex-
matched 140 cancer-free blood donors. The diagnosis
of cancer was made after histopathological examina-
tion of patients biopsies. Patients with precancerous
hyperplastic laryngeal lesions were selected during
direct laryngoscopy with the minimal clinical follow-up
10 years. Patients and controls subjects enrolled to the
examination were also matched in smoking attitude or
alcohol consumption. Prior to examination, the patients
POLYMORPHISMS OF THE DNA BASE EXCISION REPAIR
GENE MUTYH IN HEAD AND NECK CANCER
T. Sliwinski1, L. Markiewicz1, P. Rusin1, W. Pietruszewska2, J. Olszewski3, A. Morawiec-Sztandera4,
W. Mlynarski5, I. Majsterek1, 6, *
1Department of Molecular Genetics, University of Lodz, Lodz 90-237, Poland
2Department of Otolaryngology, Medical University of Lodz, Lodz 90-153, Poland
3Department of Otolaryngology and Oncology, Medical University of Lodz, Lodz 90-549, Poland
4Department of Head and Neck Cancer, Medical University of Lodz, Lodz 93-509, Poland
5Department of Pediatrics, Medical University of Lodz, Lodz 91-738, Poland
6Department of Chronopharmacology, Medical University of Lodz, Lodz 90-647, Poland
Background: Head and neck squamous cell carcinomas (HNSCC) comprise about 6% of all malignant neoplasms. The major risk factors of HNSCC
are smoking and alcohol consumption. Genetic polymorphisms of DNA repair enzymes may lead to genetic instability and carcinogenesis. MUTYH gene
encodes a DNA glycosylase that can initiate the base excision repair (BER) pathway and prevent G:C > T:A transversion by excising adenine mispaired
with 8-hydroxyguanine produced by reactive oxygen species (ROS). Aim: to perform a case-control study to test the association between polymorphism
in the MUTYH gene: Tyr165Cys and head and neck cancer risk progression. Methods: Genotypes were determined in DNA from peripheral blood
lymphocytes of 193 patients (among them 97 subjects with precancerous hyperplastic laryngeal lesions and 96 subjects with head and neck cancer)
and 140 age, sex and ethnic-matched cancer-free controls by tetra-primer amplification refractory mutation system PCR (T-ARMS-PCR). Results:
We found an association between head and neck cancer risk and the Tyr165Tyr variant of the MUTYH gene (OR 2.18; 95% CI 1.19–3.97). For
Tyr165Tyr genotype we also observed positive correlation with cancer progression assessed by tumor size (OR 4.56; 95% CI 1.60–12.95). We did
not observe any correlation between Tyr165Cys polymorphism of MUTYH gene and precancerous hyperplastic laryngeal lesions risk. Conclusion:
The Tyr165Tyr polymorphic variant of the MUTYH gene may be associated with head and neck cancer in Polish population.
Key Words: MUTYH, gene polymorphism, head and neck cancer.
Received: December 23, 2008.
*Correspondence: Fax: +48 (0) 42 6354484
E-mail: imajst@biol.uni.lodz.pl
Abbreviations used: BER — base excision repair; HNSCC – head
and neck squamous cellcarcinoma; OGG1 – 8-oxoguanin DNA
glycosylase; PHLL – precancerous hyperplastic laryngeal lesions;
ROS – reactive oxygen species; SNPs – single nucleotide poly-
morphisms; T-ARMS-PCR – tetra primer amplification refractory
mutation system PCR.
Exp Oncol 2009
31, 1, 57–59
SHORT COMMuNICATIONS
58 Experimental Oncology 31, 57–59, 2009 (March)
and control subjects, did not receive medicaments like
antibiotics or steroids. All patients and controls subjects
were recruited from three medical units of Head and Neck
Neoplasm Surgery Departments, Medical University of
Lodz, Poland. All subjects included into the study were
unrelated Caucasians and inhibited Lodz district, Poland.
The study was approved by the Local Ethic Committee
and written consent was obtained from each patient or
healthy blood donor before enrolling into the study.
Chemicals and reagents. QIAamp DNA Blood
Mini Kit for isolation of high-molecular-weight DNA
was obtained from Qiagen (Chatsworth, CA, USA). All
reagents for PCR reaction were from Qiagen. Elektro-
phoresis was conducted in TAE buffer.
Genotyping. Genomic DNA was prepared using the
QIAamp DNA Blood Mini Kit for isolation of high-mole-
cular-weight DNA. Multiplex Tetra-Primer Amplification
Refractory Mutation System PCR was used to detect
the genotypes of the Tyr165Cys polymorphism of the
MUTYH gene associated with head and neck cancer.
T-ARMS-PCR amplified both wild-type and mutant al-
leles, together with a control fragment, in a single tube
PCR reaction. The region flanking the mutation was am-
plified by 2 common (outer) primers, producing a non–
allele-specific control amplicon 200 bp in length:
Fo 5’GGGACTGACGGGTGATCTCTTTGACCTCTG 3’
Ro 5’CCTCTACCACCTGATTGGAGTGCAAGACTC 3’
Two allele-specific (inner) primers:
Fi(G) 5’GGTGAATCAACTCTGGGCTGGCCTGGGATG 3’
Ri(A) 5’CTGCAGCCGCCGGCCACGAGAATCGT 3’
were designed in opposite orientation and, in combina-
tion with the common primers, simultaneously amplified
both the wild-type and the mutant amplicons 100 bp
and 155 bp in length respectively. PCR primers and
conditions for amplification was described previously by
Piccili et al. [12]. The 2 allele-specific amplicons have
different lengths were separated by 8% polyacrylamide
gel electrophoresis. More than 10% of the samples were
repeated, and the results were 100% concordant.
Data analysis. Distribution of genotypes and alleles
between groups were tested using chi-square tests. Poten-
tial linkage between genotype and cancer was assessed
by the logistic regression. Analyses were performed us-
ing STATISTICA 6.0 package (Statsoft, Tulsa, OK, USA).
The genotypes of patients and controls were
scored according to Tyr165Cys polymorphism of
MUTYH gene (Figure). All distributions did not dif-
fer significantly (P > 0.005) from those predicted by
the Hardy-Weinberg equilibrium. An statistically sig-
nificant association between head and neck cancer
occurrence and the Tyr165Tyr genotype was found
(OR 2.18; 95% CI 1.19–3.97) (Table 1). Additionally,
there were statistically significant differences in the
frequency of Tyr165 allele between HNSCC patients and
controls (OR 1.81; 95% CI 1.05–3.13), while there were
not observed any differences in the frequency of the
Cys165 allele (see Table 1). Finally, we did not observe
any correlation between Tyr165Cys polymorphism of
MUTYH gene and precancerous hyperplastic laryngeal
lesions risk.
200
155
100
M 1 2 3 4 5 6 7
Figure. Representative T-ARMS-PCR for the Tyr165Cys polymor-
phism of MUTYH gene. Lane M, DNA marker 100 bp; lanes: 1, 2, 5,
7 wild-type control 100 bp band; lanes: 3, 4 Tyr165Cys heterozy-
gote; 100 and 155 bp bands and lane: 6 Cys165Cys homozygote
155 bp band. In each line 200 bp product indicate a positive
control of PCR. T-ARMS-PCR products were electrophoresed on
a 8% polyacrylamide gel containing ethidium bromide. MUTYH
T-ARMS-PCR band sizes are indicated on the right of panel
Table 2 shows the distribution of genotypes and
frequency of alleles in groups of patients suffer head
and neck cancer with different tumour size (T) and node
status (N). We found statistically significant differences
in distribution of the Tyr165Tyr genotype (OR 4.56; 95%
CI 1.60–12.95) and frequency of Tyr156 allele (OR 17.39;
95% CI 7.10–42.59) in group of patients with different
tumour size, when patients with T3 and T4 grades were
compared with patients with T1 and T2 grade. Addition-
ally, there was no differences in the distribution of geno-
types and frequency of alleles in patients with positive
(N1 + N2 + N3 + N4) and negative (N0) lymph node.
Table 1. The genotype and allele frequency and odds ratio (OR) of the Tyr165Cys polymorphism of the MUTYH gene in head and neck cancer (HNSCC)
and precancerous hyperplastic laryngeal lesions (PHLL)
HNSCC (n = 96) Controls (n = 140) PHLL (n = 97)
Genotype or Allele Fre quen cy Fre quen cy OR (95% CI) Frequency OR (95% CI)
Tyr165Tyr 0.80 0.64 2.18 (1.19–3.97) 0.53 0.66 (0.39–1.12)
Tyr165Cys 0.19 0.36 0.43 (0.23–0.79) 0.43 1.28 (0.75–2.17)
Cys165Cys 0.01 – – 0.04 –
165Tyr 0.90 0.82 1.81 (1.05–3.13) 0.74 0.66 (0.42–1.03)
165Cys 0.10 0.18 0.55 (0.32–0.95) 0.26 1.51 (0.97–2,36)
Notes: “CI” – confidence interval; “–” – not estimated.
Table 2. The genotype and allele frequency and odds ratios (OR) of the Tyr165Cys polymorphism of MUTYH gene in patients with head and neck cancer
with different tumor size and lymph node status
Tumour size Node status
Geno type or Allele T3 + T4 Fre quen cy T1+ T2 Fre quen cy OR (95% CI) N1 + N2 + N3 + N4
Fre quen cy N0 Fre quen cy OR (95% CI)
Tyr/Tyr 0.89 0.63 4.56 (1.60–12.95) 0.81 0.78 1.14 (0.41–3.21)
Tyr/Cys 0.11 0.34 0.25 (0.09–0.71) 0.19 0.20 0.96 (0.34–2.73)
Cys/Cys – 0.03 – – 0.02 –
Tyr 0.94 0.80 17.39 (7.10–42.59) 0.90 0.88 1.23 (0.47–3.20)
Cys 0.06 0.20 0.06 (0.02–0.14) 0.10 0.12 0.82 (0.31–2.13)
Notes: “CI” – confidence interval; “–” – not estimated.
Experimental Oncology 31, 57–59, 2009 (March) 59
An association between the risk of occurrence
and progression of the head and neck cancer and
the Tyr165Cys polymorphism of the MUTYH gene of
BER-repair DNA pathway has not been investigated
previously. Our results suggest that this polymorphism
may increase the risk of head and neck cancer in Polish
population (OR 2.18 for homozygous Tyr165Tyr). We
also found an association between Tyr165Tyr genotype
of MUTYH gene and head and neck cancer progression
assessed by tumour size (OR 4.56). However, we did
not observe any correlation between Tyr165Cys poly-
morphism of MUTYH gene and precancerous hyper-
plastic laryngeal lesions risk. Thus, this polymorphism
may not reflect the progression of PHLL as it is allowed
to be determined by classic histological grading.
There is only a few data reported an investigation of
MUTYH gene polymorphisms in association with cancer
occurrence. Previously, it was found that recessive muta-
tions of the MUTYH gene predispose to multiple colorec-
tal adenomas and carcinoma [13–18]. Other reports have
suggested that the Gln324His variant of MUTYH gene is
strongly associated with colorectal cancer in Japanese
population [19, 20]. In contrast, Gorgens et al. have not
found any correlation between polymorphisms of MUTYH
gene and the etiology of a head and neck cancer [21], but
they investigated Val22Met, Gln324His and Val315Met
variants and they did not investigated Tyr165Cys. The
other reason that no correlation was found by Gorgens et
al. might be extremely small number of subjects enrolled
to their study (29 patients and 30 controls). In our study
we investigated an association of Tyr165Cys polymor-
phism of MUTYH gene in group of 193 patients (among
them 97 subjects with precancerous hyperplastic laryn-
geal lesions and 96 subjects with head and neck cancer)
and 140 cancer-free controls. Our study is the first that
reported an assaociation of Tyr165Tyr polymorphic vari-
ant of MUTYH gene with head and neck cancer.
Evidences consistently linking SNPs in the DNA repair
genes with pathogenesis of head and neck cancer are
still limited. In the post-genomic era we think about or-
chestration of the expression of the genome rather, than
about acts of expression of individual genes. However, to
construct a reliable microarray dedicated to any cancer
a large set of SNPs data should be obtained. We suggest
that the Tyr165Cys polymorphism of the MUTYH gene may
be considered as an early diagnostic marker in occurrence
and progression of the head and neck cancer.
ACKNOwLEDGMENTS
This work was supported by grant N301 099 32/3581
from Polish Ministry of Science and Higher Education.
REFERENCES
Koskinen WJ. 1. Prognostic markers in head and neck
carcinoma. Helsinki: Academic Dissertation Haartman In
stitute, 2006.
Crowe DL. 2. Molecular pathology of head and neck
cancer. Histol Histopathol 2002; 17: 909–14.
Park JY, Muscat JE, Ren Q, 3. et al. CYP1A1 and GSTM1
polymorphisms and oral cancer risk. Cancer Epidemiol Bio
markers Prev 1997; 6: 791–7.
Scully C, Field JK, Tanzawa H4. . Genetic aberrations in
oral or head and neck squamous cell carcinoma (SCCHN): 1.
Carcinogen metabolism, DNA repair and cell cycle control.
Oral Oncol 2000; 36: 256–63.
Scully C, Field JK, Tanzawa H.5. Genetic aberrations in
oral or head and neck squamous cell carcinoma: 2. Chromo
somal aberrations. Oral Oncol 2000; 36: 311–27.
de Boer JG. 6. Polymorphisms in DNA repair and envi
ronmental interactions. Mutat Res 2002; 509: 201–10.
Frosina G. 7. Commentary: DNA base excision repair defects
in human pathologies. Free Radic Res 2004; 38: 1037–54.
Wilson DM 3rd, Sofinowski TM, McNeill DR. 8. Repair
mechanisms for oxidative DNA damage. Front Biosci 2003;
8: d963–81.
Marra G, Jiricny J. 9. Multiple colorectal adenomas – Is
their number up? N Engl J Med 2003; 348: 845–7.
Nakabeppu Y, Tsuchimoto D, Furuichi M, Sakumi K. 10. The
defense mechanisms in mammalian cells against oxidative dam
age in nucleic acids and their involvement in the suppression of
mutagenesis and cell death. Free Radical Res 2004; 38: 423–9.
Sieber OM, Lipton L, Crabtree M,11. et al. Multiple colo
rectal adenomas, classic adenomatous polyposis, and germ
line mutations in MYH. N Engl J Med 2003; 348: 791–9.
Piccioli P, Serra M, Gismondi V, 12. et al. Multiplex
tetraprimer amplification refractory mutation system PCR
to detect 6 common germline mutations of the MUTYH gene
associated with polyposis and colorectal cancer. Clin Chem
2006; 52: 739–43.
Al-Tassan N, Chmiel NH, Maynard J, 13. et al. Inherited
variants of MYH associated with somatic G:C > T:A mutations
in colorectal tumors. Nat Genet 2002; 30: 227–32.
Jones S, Emmerson P, Maynard J, 14. et al. Biallelic germline
mutations in MYH predispose to multiple colorectal adenoma and
somatic G:C > T:A mutations. Hum Mol Genet 2002; 11: 2961.
Halford SE, Rowan AJ, Lipton L, 15. et al. Germline muta
tions but not somatic changes at the MYH locus contribute to
the pathogenesis of unselected colorectal cancers. Am J Pathol
2003; 162: 1545–8.
Sampson JR, Dolwani S, Jones S, 16. et al. Autosomal
recessive colorectal adenomatous polyposis due to inherited
mutations of MYH. Lancet 2003; 362: 39–41.
Cheadle J, Sampson J. 17. Exposing the MYtH about base
excision repair and human inherited disease. Hum Mol Genet
2003; 12 Spec: R159–65.
Sieber OM, Lipton L, Crabtree M, 18. et al. Multiple colore
ctal adenomas, classic adenomatous polyposis, and germline
mutations in MYH. N Engl J Med 2003; 348: 791–9.
Kasahara M, Osawa K, Yoshida K, 19. et al. Association of
MUTYH Gln324His and APEX1 Asp148Glu with colorectal
cancer and smoking in a Japanese population. J Exp Clin
Cancer Res 2008; 30: 27–49.
Tao H, Shinmura K, Suzuki M, 20. et al. Association be
tween genetic polymorphisms of the base excision repair gene
MUTYH and increased colorectal cancer risk in a Japanese
population. Cancer Sci 2008; 99: 355–60.
Görgens H, Müller A, Krüger S, 21. et al. Analysis of the base
excision repair genes MTH1, OGG1 and MUTYH in patients
with squamous oral carcinomas. Oral Oncol 2007; 43: 791–5.
Copyright © Experimental Oncology, 2009
|
| id | nasplib_isofts_kiev_ua-123456789-135113 |
| institution | Digital Library of Periodicals of National Academy of Sciences of Ukraine |
| issn | 1812-9269 |
| language | English |
| last_indexed | 2025-12-07T19:02:25Z |
| publishDate | 2009 |
| publisher | Інститут експериментальної патології, онкології і радіобіології ім. Р.Є. Кавецького НАН України |
| record_format | dspace |
| spelling | Sliwinski, T. Markiewicz, L. Rusin, P. Pietruszewska, W. Olszewski, J. Morawiec-Sztandera, A. Mlynarski, W. Majsterek, I. 2018-06-14T15:40:24Z 2018-06-14T15:40:24Z 2009 Polymorphisms of the dna base excision repair gene mutyh in head and neck cancer / T. Sliwinski, L. Markiewicz, P. Rusin, W. Pietruszewska, J. Olszewski, A. Morawiec-Sztandera,W. Mlynarski, I. Majsterek // Experimental Oncology. — 2009. — Т. 31, № 1. — С. 57-59. — Бібліогр.: 21 назв. — англ. 1812-9269 https://nasplib.isofts.kiev.ua/handle/123456789/135113 Background: Head and neck squamous cell carcinomas (HNSCC) comprise about 6% of all malignant neoplasms. The major risk factors of HNSCC
 are smoking and alcohol consumption. Genetic polymorphisms of DNA repair enzymes may lead to genetic instability and carcinogenesis. MUTYH gene
 encodes a DNA glycosylase that can initiate the base excision repair (BER) pathway and prevent G:C > T:A transversion by excising adenine mispaired
 with 8-hydroxyguanine produced by reactive oxygen species (ROS). Aim: to perform a case-control study to test the association between polymorphism
 in the MUTYH gene: Tyr165Cys and head and neck cancer risk progression. Methods: Genotypes were determined in DNA from peripheral blood
 lymphocytes of 193 patients (among them 97 subjects with precancerous hyperplastic laryngeal lesions and 96 subjects with head and neck cancer)
 and 140 age, sex and ethnic-matched cancer-free controls by tetra-primer amplification refractory mutation system PCR (T-ARMS-PCR). Results:
 We found an association between head and neck cancer risk and the Tyr165Tyr variant of the MUTYH gene (OR 2.18; 95% CI 1.19–3.97). For
 Tyr165Tyr genotype we also observed positive correlation with cancer progression assessed by tumor size (OR 4.56; 95% CI 1.60–12.95). We did
 not observe any correlation between Tyr165Cys polymorphism of MUTYHgene and precancerous hyperplastic laryngeal lesions risk. Conclusion:
 The Tyr165Tyr polymorphic variant of the MUTYHgene may be associated with head and neck cancer in Polish population. This work was supported by grant N301 099 32/3581
 from Polish Ministry of Science and Higher Education. en Інститут експериментальної патології, онкології і радіобіології ім. Р.Є. Кавецького НАН України Experimental Oncology Short communications Polymorphisms of the dna base excision repair gene mutyh in head and neck cancer Article published earlier |
| spellingShingle | Polymorphisms of the dna base excision repair gene mutyh in head and neck cancer Sliwinski, T. Markiewicz, L. Rusin, P. Pietruszewska, W. Olszewski, J. Morawiec-Sztandera, A. Mlynarski, W. Majsterek, I. Short communications |
| title | Polymorphisms of the dna base excision repair gene mutyh in head and neck cancer |
| title_full | Polymorphisms of the dna base excision repair gene mutyh in head and neck cancer |
| title_fullStr | Polymorphisms of the dna base excision repair gene mutyh in head and neck cancer |
| title_full_unstemmed | Polymorphisms of the dna base excision repair gene mutyh in head and neck cancer |
| title_short | Polymorphisms of the dna base excision repair gene mutyh in head and neck cancer |
| title_sort | polymorphisms of the dna base excision repair gene mutyh in head and neck cancer |
| topic | Short communications |
| topic_facet | Short communications |
| url | https://nasplib.isofts.kiev.ua/handle/123456789/135113 |
| work_keys_str_mv | AT sliwinskit polymorphismsofthednabaseexcisionrepairgenemutyhinheadandneckcancer AT markiewiczl polymorphismsofthednabaseexcisionrepairgenemutyhinheadandneckcancer AT rusinp polymorphismsofthednabaseexcisionrepairgenemutyhinheadandneckcancer AT pietruszewskaw polymorphismsofthednabaseexcisionrepairgenemutyhinheadandneckcancer AT olszewskij polymorphismsofthednabaseexcisionrepairgenemutyhinheadandneckcancer AT morawiecsztanderaa polymorphismsofthednabaseexcisionrepairgenemutyhinheadandneckcancer AT mlynarskiw polymorphismsofthednabaseexcisionrepairgenemutyhinheadandneckcancer AT majstereki polymorphismsofthednabaseexcisionrepairgenemutyhinheadandneckcancer |