Celecoxib inhibits tumor growth and angiogenesis in an orthotopic implantation tumor model of human colon cancer

Aim: To examine the effect of celecoxib on tumor growth and angiogenesis in an orthotopic implantation tumor model of colon cancer. Methods: Human colorectal adenocarcinoma HT-29 cells were implanted subcutaneously in nude mice. Four groups of animals received different doses of celecoxib after tumo...

Повний опис

Збережено в:
Бібліографічні деталі
Опубліковано в: :Experimental Oncology
Дата:2008
Автори: Wang, L., Chen, W., Xie, X., He, Y., Bai, X.
Формат: Стаття
Мова:Англійська
Опубліковано: Інститут експериментальної патології, онкології і радіобіології ім. Р.Є. Кавецького НАН України 2008
Теми:
Онлайн доступ:https://nasplib.isofts.kiev.ua/handle/123456789/139184
Теги: Додати тег
Немає тегів, Будьте першим, хто поставить тег для цього запису!
Назва журналу:Digital Library of Periodicals of National Academy of Sciences of Ukraine
Цитувати:Celecoxib inhibits tumor growth and angiogenesis in an orthotopic implantation tumor model of human colon cancer / L. Wang, W. Chen, X. Xie, Y. He, X. Bai // Experimental Oncology. — 2008. — Т. 30, № 1. — С. 42–51. — Бібліогр.: 45 назв. — англ.

Репозитарії

Digital Library of Periodicals of National Academy of Sciences of Ukraine
_version_ 1859475217417502720
author Wang, L.
Chen, W.
Xie, X.
He, Y.
Bai, X.
author_facet Wang, L.
Chen, W.
Xie, X.
He, Y.
Bai, X.
citation_txt Celecoxib inhibits tumor growth and angiogenesis in an orthotopic implantation tumor model of human colon cancer / L. Wang, W. Chen, X. Xie, Y. He, X. Bai // Experimental Oncology. — 2008. — Т. 30, № 1. — С. 42–51. — Бібліогр.: 45 назв. — англ.
collection DSpace DC
container_title Experimental Oncology
description Aim: To examine the effect of celecoxib on tumor growth and angiogenesis in an orthotopic implantation tumor model of colon cancer. Methods: Human colorectal adenocarcinoma HT-29 cells were implanted subcutaneously in nude mice. Four groups of animals received different doses of celecoxib after tumor implantation. After 42 days, all animals were evaluated for changes in body weight, the volume and weight of colorectal tumors, and tumor growth inhibition. The content of prostaglandin E2 (PGE2) in the tumor tissue homogenate was estimated by radioimmunoassay (RIA). Cyclooxygenase-2 (COX-2) and CD34 expression in tumor tissue was assessed by immunohistochemistry, and the microvessel density (MVD) of tumor tissue was determined. Apoptosis of the tumor cells was detected by the terminal deoxynucleotidyl transferase-mediated dUTP nick-end labeling (TUNEL). The expression of vascular endothelial growth factor (VEGF) mRNA and matrix metalloproteinase-2 (MMP-2) mRNA extracted from the tumor tissue was analyzed by reverse transcriptase polymerase chain reaction (RT-PCR). Results: There was no statistically significant change in the animals’ body weight between the treatment groups. However, with increasing doses of celecoxib, the volume and weight of the tumor decreased. The rates of tumor growth inhibition for the L (low), M (medium) and H (high) groups were 25.30%, 38.80%, and 76.92%, respectively, which were significant compared to the C (control) group. There were significant differences in COX-2 expression in the tumor tissue between all groups, except between the L and M groups. Celecoxib exposure also reduced PGE2 levels in the tumor tissue homogenates. The level of PGE2 correlated to the weight of tumor (r = 0.8814, P < 0.05) and to COX-2 expression (r = 0.8249, P < 0.05). Compared to the control group, the tumor cells from celecoxib-treated mice had a significantly higher apoptotic index. Celecoxib also decreased CD34+ expression in tumors from treated mice. There were significant differences in the MVD between all groups except between groups H and M. Celecoxib significantly reduced the expression of VEGF and MMP-2 mRNA in the group H but not in L and M groups. The MVD in tumor tissue was closely related to the PGE2 levels, as well as the expression of VEGF and MMP-2 mRNA (r = 0.9006, r = 0.8573 and r = 0.6427, respectively; P < 0.05). Conclusions: By inhibiting COX-2, PGE2 synthesis, and VEGF and MMP-2 mRNA expression in tumor tissue, celecoxib enhances tumor cell apoptosis, thereby inhibiting the growth and angiogenesis of orthotopically implanted tumors in a mouse model of human colorectal cancer. Цель: изучить влияние целекоксиба на рост опухоли и ангиогенез в модели ортопической имплантации опухоли толстой кишки человека. Методы: клетки колоректальной аденокарциномы человека НT-29 подкожно имплантировали бестимусным мышам. После имплантации опухоли четыре группы животных получали разные дозы целекоксиба. Через 42 дня изучали изменения веса животных, объем опухолей, эффект ингибирования роста опухоли. С помощью радиоиммунного анализа (RIA) в гомо- RIA) в гомо ) в гомогенате опухолей определяли содержание простогландина E2 (PGE2 ). В опухолевой ткани иммуногистохимическим методом выявляли экспрессию циклооксигеназы-2 (COX-2) и CD34 и оценивали плотность микрососудов (MVD). Апоптотические клетки выявляли методом TUNEL. Экспрессия мРНК фактора роста эндотелия сосудов (VEGF) и металлопротеиназы-2 (MMP-2) в опухолях проанализирована методом обратной транскриптазной реакции (RT-PCR). Результаты: статистически достоверных различий в весе животных между разными группами обнаружено не было. Вто же время, с увеличением дозы целекоксиба объем и вес опухоли уменьшался. По сравнению с контрольной группой (C), рост опухоли статистически достоверно ингибировался в L (низкая доза), M (средняя доза) и H (высокая доза) группах животных на 25,30%, 38,80% и 76,92% соответственно. Были обнаружены значительные отличия в экспрессии COX-2 в опухолевых тканях между всеми группами животных, кроме групп L и M. Было показано целекоксиб-зависимое уменьшение уровня PGE2 в гомогенатах опухолей. Уровень PGE2 коррелировал с весом опухоли (r = 0,8814, P < 0,05) и экспрессией COX-2 (r = 0,8249, P < 0,05). По сравнению с контрольной группой опухолевые клетки мышей, получавших целекоксиб, имели значительно более высокий апоптотический индекс. Целекоксиб также снижал экспрессию CD34+ на поверхности опухолевых клеток. Были обнаружены статистически достоверные различия в MVD между всеми исследованными группами, кроме H и M. Целекоксиб способствовал уменьшению экспрессии мРНК VEGF и MMP-2 в группе Н, но не в группах L и M. MVD в опухолевой ткани кореллировал с уровнем PGE2 , а также с экспрессией мРНК VEGF и MMP-2 (r = 0,9006, r = 0,8573 и r = 0,6427 соответственно; P < 0,05). Выводы: целекоксиб способствует апоптозу опухолевых клеток, ингибирует рост опухоли и ангиогенез при ортотопической имплантации мышам колоректальной аденокарциномы человека. Такой эффект целекоксиба связан с угнетением синтеза COX-2, PGE2 и экспрессии мРНК VEGF и MMP-2 в опухолевой ткани.
first_indexed 2025-11-24T11:02:19Z
format Article
fulltext 42 Experimental Oncology 30, 42–51, 2008 (March) According to the recent reports, colorectal cancer is the third most frequently diagnosed cancer in the United States. In 2005, an estimated 105,950 new cases of colon cancer occurred. During the same year, an esti- mated 55,290 people died from colorectal cancer [1]. In China, the incidence of colon cancer has increased recently, becoming a major threat to the public health. Therefore, improving early detection and treatment, especially the efficacy, to reduce mortality and extend the patients’ lives are of the greatest concern. Cyclooxygenase (COX), a rate-limiting enzyme for the metabolism of arachidonic acid to prostanoids, has two isoforms, constitutive COX-1 and inducible COX-2, which were identified in 1991 [2, 3]. COX-1 is expressed in quiescent and normal cells, while in normal tissue the expression of COX-2 is very low, and, in many cases, undetectable. COX-2 expression is induced by a variety of factors, including interleukin-1 (IL-1), tis- sue anoxia, ultraviolet ray exposure, epidermal growth factor (EGF), transforming growth factor β (TGF-β), tumor necrosis factor-α (TNF-α) and tumor promoters [2]. Recent researches have demonstrated that COX-2 is overexpressed frequently in various gastrointestinal tract cancers, such as colorectal cancer, esophageal carcinoma, gastric cancer and pancreatic cancer [4]. Epidemiological and clinical observation and labora- tory research since 1980s have indicated that non-ste- roidal anti-inflammatory drugs (NSAIDs) played a crucial role in tumor inhibition both in vivo and in vitro, particularly in gastrointestinal tract cancers [5]. These researches indicated that COX-2 is maybe a target of NSAIDs. Since the development of selective COX-2 inhibi- tors to treat inflammatory diseases, Steinbach et al. [6] first reported in 2000 that in 100 patients with familial adenomatous polyposis, six months of twice-daily treatment with 400 mg of celecoxib, a COX-2 inhibitor, significantly reduced the number of colorectal pol- yps. More and more studies have demonstrated that non-selective NSAIDs, as well as selective COX-2 inhibitors, can reduce cellular proliferation, induce CELECOXIB INHIBITS TUMOR GROWTH AND ANGIOGENESIS IN AN ORTHOTOPIC IMPLANTATION TUMOR MODEL OF HUMAN COLON CANCER L. Wang1, W. Chen1, *, X. Xie2, Y. He3, X. Bai3 1Department of Gastroenterology, the First Affiliated Hospital of Soochow University, Jiangsu, China 2Department of Neurosurgery, the First Affiliated Hospital of Soochow University, Jiangsu, China 3Jiangsu Institute of Hematology, the First Affiliated Hospital of Soochow University, Jiangsu, China Aim: To examine the effect of celecoxib on tumor growth and angiogenesis in an orthotopic implantation tumor model of colon cancer. Meth- ods: Human colorectal adenocarcinoma HT-29 cells were implanted subcutaneously in nude mice. Four groups of animals received different doses of celecoxib after tumor implantation. After 42 days, all animals were evaluated for changes in body weight, the volume and weight of colorectal tumors, and tumor growth inhibition. The content of prostaglandin E2 (PGE2) in the tumor tissue homogenate was estimated by radioimmunoassay (RIA). Cyclooxygenase-2 (COX-2) and CD34 expression in tumor tissue was assessed by immunohistochemistry, and the microvessel density (MVD) of tumor tissue was determined. Apoptosis of the tumor cells was detected by the terminal deoxynucleotidyl transferase-mediated dUTP nick-end labeling (TUNEL). The expression of vascular endothelial growth factor (VEGF) mRNA and matrix metalloproteinase-2 (MMP-2) mRNA extracted from the tumor tissue was analyzed by reverse transcriptase polymerase chain reaction (RT-PCR). Results: There was no statistically significant change in the animals’ body weight between the treatment groups. However, with increasing doses of celecoxib, the volume and weight of the tumor decreased. The rates of tumor growth inhibition for the L (low), M (medium) and H (high) groups were 25.30%, 38.80%, and 76.92%, respectively, which were significant compared to the C (control) group. There were significant differences in COX-2 expression in the tumor tissue between all groups, except between the L and M groups. Celecoxib exposure also reduced PGE2 levels in the tumor tissue homogenates. The level of PGE2 correlated to the weight of tumor (r = 0.8814, P < 0.05) and to COX-2 expression (r = 0.8249, P < 0.05). Compared to the control group, the tumor cells from celecoxib-treated mice had a significantly higher apoptotic index. Celecoxib also decreased CD34+ expression in tumors from treated mice. There were significant differences in the MVD between all groups except between groups H and M. Celecoxib significantly reduced the expression of VEGF and MMP-2 mRNA in the group H but not in L and M groups. The MVD in tumor tissue was closely related to the PGE2 levels, as well as the expression of VEGF and MMP-2 mRNA (r = 0.9006, r = 0.8573 and r = 0.6427, respectively; P < 0.05). Conclusions: By inhibiting COX-2, PGE2 synthesis, and VEGF and MMP-2 mRNA expression in tumor tissue, celecoxib enhances tumor cell apoptosis, thereby inhibiting the growth and angiogenesis of orthotopically implanted tumors in a mouse model of human colorectal cancer. Key Words: colon cancer, orthotopic implantation, cyclooxygenase-2, angiogenesis, prostaglandin E2. Received: January 17, 2008. *Correspondence: Fax: +8651265238350 E-mail: weichangchen@126.com Abbreviations used: AI — apoptotic index; cAMP — cyclic adeno- sine monophosphate; COX — cyclooxygenase; EP — E-type pros- taglandin receptor; ERK — extracellular signal regulated protein kinase; GSK — glycogen synthase kinase; MAPK — mitogen-acti- vated protein kinase; MEK — MAPK/ERK kinase; MMP-2 — matrix metalloproteinase-2; MVD — microvessel density; NSAIDs — non- steroidal anti-inflammatory drugs; PDK1 — 3-phosphoinositide- dependent protein kinase-1; PKA — protein kinase A; PKB — pro- tein kinase B; PGs — prostaglandins; RIA – radioimmunoassay; TIMP — tissue inhibitor of metalloproteinase; TUNEL — terminal deoxynucleotidyl transferase-mediated dUTP nick-end labeling; TXA2 — thromboxan A2; VEGF — vascular endothelial growth factor. Exp Oncol 2008 30, 1, 42–51 Experimental Oncology 30, 42–51, 2008 (March) 4330, 42–51, 2008 (March) 43March) 43) 43 43 apoptosis, promote immunologic surveillance, and/or reduce neoangiogenesis. These drugs inhibit tumor angiogenesis by both COX-dependent and COX-in- dependent mechanisms [7–10]. However, the exact mechanisms remain poorly understood [11–13]. In this study we established an animal model of or- thotopic implantation of colon cancer cells to replicate the clinical conditions of human colon cancer. We then observed the effects of the selective COX-2 inhibitor celecoxib on the tumors to investigate its anticancer mechanism. MATERIALS AND METHODS Cell lines and animal model. The human colorectal adenocarcinoma cell line HT-29 was purchased from the Institute of Biochemistry and Cell Biology (Shang- hai Institute for Biological Sciences (SIBS), Chinese Acade my of the Sciences (CAS), Shanghai, China) and was maintained in McCoy’s 5A medium containing 10% fetal bovine serum (GIBCO, USA). Four-week-old female BALB/c nu/nu mice (Shanghai Laboratory Animal Center, CAS) were maintained under specific pathogen-free conditions in a laminar air-flow incubator (25 °C, 40 to 60% humidity, with a 12 h light-dark cycle). To initiate the tumor growth, HT-29 cells in the log phase of growth were implanted subcutaneously in nude mice. After 4 weeks, small pieces of HT-29 tumor tissue (2 mm x 2 mm in di- ameter) were resected aseptically during the exponential growth phase (4 weeks) and implanted orthotopically on the surface of the cecum of 24 nude mice. The cecum was carefully exteriorized, and the serosa was injured (2 mm x 2 mm in diameter) at the site where the tumor was to be implanted. A tumor piece was then fixed on each injured site of the serosal surface with an 8-0 Vicryl transmural suture. The abdominal wall and skin were closed with 8-0 Vicryl sutures [14]. The present study was approved by the ethics com- mittee of the hospital, and adhered to the tenets of the Declaration of Helsinky. COX-2 inhibitor treatment. The selective COX-2 inhibitor, celecoxib, was a generous gift of Pharmacia & Upjohn Ltd (Suzhou, China). Postoperatively, all animals were randomly divided into four groups: control (C), and high (H), middle (M), and low (L) doses of celecoxib. Pure water or water containing 1.5, 1.0, or 0.5 mg/L celecoxib was provided daily for these animals to drink freely [15]. The mice were sacrificed at 6 weeks after tumor implanta- tion. After weighing each animal, the tumors were removed and the volume and weight were evaluated. The tumor volume was determined using the formula V = L × W2/ 2 where L is length and W is width of colon tumor. The rate of tumor inhibition (TI) was calculated using the formula TI = [(average tumor weight of the control group — ave- rage tumor weight of the treatment group)/average tumor weight of the control group] × 100%. Histopathology. For histological examination, the stomach, intestine, liver and colon of animals were excised and fixed in 10% neutral buffered formalin after the animals were sacrificed at 6 weeks. Paraffin embedded sections (5 μm) were cut and stained with hematoxlin and eosin for histological examination by a pathologist who was unaware of the treatment as- signments. If the orthotopically implantated tumors in- vaded the serosa, muscularis propria, submucosa, or mucosa, or there was pathologic damage to either the stomach or intestine mucosa, or there were liver me- tastases, the results were observed and recorded. RIA for PGE2. After colon tumor tissue samples (50 mg) were washed with 0.9% NS (normal saline), these tissues were homogenized in 1 ml of 0.9% NS. Then these solutions were centrifuged (7500 rpm, 10 min). The supernatant (0.1 ml) was collected and the content of PGE2 was measured with a PGE2 RIA kit (a gift from Jiangsu Institute of Hematology, Suzhou, China) according to the manufacturer’s instructions. PGE2 values were expressed as picogram per milliliter in the tumor tissue homogenate samples. RT-PCR for VEGF and MMP-2 mRNA. Tumor samples were frozen in liquid nitrogen or stored at –80 °C for mRNA analysis. Total cellular RNA was extracted from the frozen tumor samples using TRIzol Reagent (Sigma, MO, USA) according to the manufacturer’s protocol. Briefly, 40 mg of tumor tissue was homogenized in 1 ml of TRIzol, and then 0.2 ml of chloroform was added, and the mixture was centrifuged (12 000 rpm, 15 min, 4 °C). The aqueous layer, which contained the RNA, was carefully aspirated and 0.5 ml of isopropanol was added to precipitate the RNA. The resulting solution was centrifuged (12 000 rpm, 15 min, 4 °C) and the pellet was washed with 0.6 ml of 75% ethanol, then with 0.8 ml of 100% ethanol and centrifuged again (12 000 rpm, 15 min, 4 °C). Finally, the pellet containing RNA was dissolved in diethyl pyrocarbonate-treated water (DEPC-H2O) and was stored frozen at –80 °C until analysis. The RNA samples were prepared for RT-PCR analysis by first diluting the mixture of total RNA (2 μg) and 2 μl random hexamers (0.1 mmol/L) to 15 μl with DEPC-H2O and incubated at 70 °C for 5 min. Then, after adding 8 μl of 5 × buffer (Promega co. Madison, WI,USA), 200 units of Moloneymurine leukemia virus reverse transcriptase (Promega), 50 units of RNasin (Promega) and 1.25 μl dNTPs (10 mmol/L), the mixture was diluted to 25 μl in DEPC-H2O and converted to cDNA by incubation at 37 °C for 1 h and 95 °C for 5 min. Finally, the cDNA solution was stored at -20 °C. PCR was performed using 5 μl of diluted cDNA in a to- tal volume of 50 μl, including 5 μl 10 × buffer (Promega), 1 μl dNTPs (10 mmol/L), 4 μl MgC12 (25 mmol/L), 2 μl of sense and antisense primers (10 μmol/L) for VEGF or MMP-2, 2 μl of sense and antisense primers (10 μmol/L) for β-actin, and 2.5 units of Taq Polymerase (Promega). Sequences of the primers for the human VEGF, MMP- 2 and β-actin are shown in Table 1. The samples were amplified for 30 cycles of PCR reaction in which pre- denaturation was done for 5 min at 94 °C, denaturation for 30 s, and extension for 3 min at 72 °C. Annealing time was 30 s; however, the annealing temperature was 60 °C for VEGF transcript and 62 °C for MMP-2. After 30 cycles, the product of the PCR reaction was stored for 7 min at 72 °C and then analyzed. 44 Experimental Oncology 30, 42–51, 2008 (March) Amplified cDNAs were separated by electropho- resis on a 1.5% agarose gel containing ethidium bromide. The density of the electrophoretic band for each amplification product was evaluated using the BioCaptMW software. The mRNA values are expressed as relative units calculated according to the following formula: density of the VEGF or MMP-2 amplification product/density of the β-actin amplification product. Immunohistochemistry for COX-2 protein. Tis- sue samples were embedded in paraffin, cut into 5 μm sections, deparaffinized, and subjected to microwave irradiation for 15 min at 92 to 98 °C in 0.01 M Citric acid buffer (pH 6.0). Then the slides were immersed in 1% H2O2 for 30 min to neutralize endogenous peroxidases. The primary antibody against COX-2 (anti-human COX- 2 mouse IgG, Cayman Chemical, USA) was applied to tissue sections at a dilution of 1 : 100 and incubated overnight at 4 °C. The secondary antibody and en- zymes were obtained in an Ultravision Detection Sys- tem kit (Lab Vision, USA). The reaction products were visualized using streptavidin-biotin-peroxidase and 3, 3`-diaminobenzidene chromogen. Finally, the sections were counterstained with hematoxylin, dehydrated, and mounted in diphenylxylene. The expression level of COX-2 was calculated by multiplying a quantitative measure of the extent of COX-2 staining extent by the quantitative measure of the staining intensity. The COX-2 positive staining extent was recorded using a 5-grade system, based on the percentage of tumor cells stained: grade 0 = 0% to 4%; grade 1 = 5% to 24%; grade 2 = 25% to 49%; grade 3 = 50% to 74%; and grade 4 = 75% to 100%. Staining intensity was recorded using 3-grade system: grade 0 = negative; 1 = weakly positive; 2 = positive. All slides were inde- pendently evaluated by two blinded observers, both of whom were experienced pathologists. Assay for microvessel density (MVD). Microves- sels in the tumor tissue were immunostained using anti-human CD34 mouse monoclonal antibody and the streptavidin-biotin-peroxidase complex technique (Lab Vision, USA). MVD was evaluated according to the method first described by Weidner et al. [20]. The entire tumor sections was observed under a light microscope (Magnification: 40 x) to find the area that showed the most intense microvessel density, i.e. the highest density of brown stained CD34-positive cells (also referred to as the hot spot). Three different areas within a section were chosen and the stained microvessels were counted under a light microscope at 200x magnification. The aver- age count was considered the MVD for each slide. Assessing the apoptotic index (AI). Terminal deoxynucleotidyl transferase-mediated dUTP nick-end labeling (TUNEL) was performed using a commercial kit (In Situ Cell Detection kit, POD, Roche Diagnostics, Germany) according to the manufacturer’s instruc- tions. By this method, the nuclei of apoptotic tumor cells were stained brown. One thousand tumor cells, including the apoptotic tumor cells, were counted for each sample. The apoptotic index (AI) was calcu- lated as follows: AI (%) = (number of apoptotic tumor cells/1000) × 100. Statistical analysis. The data are expressed as the mean plus or minus the standard deviation (SD). Analyses between multiple groups were determined by ANOVA. Analyses between two groups were determined using the SNK test. The relationships between PGE2 and the weight of tumor, between MVD and the PGE2, between COX- 2 expression and the PGE2, between MVD and VEGF mRNA expression and between MVD and MMP-2 mRNA expression were examined by simple linear regression analysis. All statistical analyses were performed using a statistical software package (SPSS, Version 10.0, USA). Statistical significance was defined as P-values less than 0.05. All P-values were two-sided. RESULTS General Observations. None of the nude mice died after implantation and all animals formed colorec- tal tumor masses before sacrifice. Three animals in group C could touch the mass (about 4 mm in diam- eter) on the inferior belly in the third week. After all ani- mals were sacrificed, opening the abdominal cavity of each animal revealed masses whose size ranged from 0.50 cm × 0.45 cm to 1.35 cm × 0.95 cm (Fig. 1, a). In addition, staining with haematoxlin and eosin con- firmed that, in some animals, the tumor cells both the muscularis propria and submucosa (Fig. 1, b). The mean body weight of the control animals was lower than in the treatment groups, but the difference was not statistically significant (P > 0.05; Fig. 2). However, the volume and weight of the tumor in group C were signifi- cantly higher than in the treatment groups, and were sig- nificantly different among all groups (P < 0.05; Table 2). Tumor growth was inhibited by 25.30% in the L group, 38.80% in the M group, and 76.92% in the H group, as compared to the control group. No obvious ascites was found in the abdominal cavity of any animal. Also, no animal showed signs of liver metastasis, hyperemia, edema, erosion, bleeding or ulceration of the stomach and intestine mucosa, confirmed by histopathology. PGE2 levels and COX-2 immunohistochemistry. The PGE2 is one important product of metabolism of arachidonic acid to prostanoids. The COX-2 plays a role in this process. By measuring the PGE2 levels, we can analyze the activity of COX-2. In our research, the PGE2 levels in the tumor tissue were higher in group C than that in the treatment groups (P < 0.05). With increasing doses of celecoxib, the PGE2 levels in the treatment groups were reduced (P < 0.05; Table 3). Table 1. RT-PCR primers Sense Antisense Product size (bp) Refe rence β-actin ATCTGGCACCACACCTTCTACAATGAGCTGCG CGTCATACTCCTGTGATCCACATCTGC 838 16 VEGF GGGCCTCCGAAACCATGAACTT CGCATCAGGGGCACACAG 259 17 β-actin GAAACTACCTTCAACTCCATC CGAGGCCAGGATGGAGCCGCC 219 18 MMP-2 ACCTGGATGCCGTCGTGGAC TGTGGCAGCACCAGGGCAGC 447 19 Experimental Oncology 30, 42–51, 2008 (March) 4530, 42–51, 2008 (March) 45March) 45) 45 45 a b Fig. 1. Macroscopic and microscopic appearance of ortho- topically implanted tumors in a mouse model of colon cancer. a: Different tumor masses were found in the colon of each animal, and celecoxib obviously inhibited the growth of tumor. b: Staining with haematoxlin and eosin showed that the tumor cells invaded muscularis propria and submucosa (Magnification: × 400) 15 16 17 18 19 20 21 22 23 Pro- operation 1W 2W 3W 4W 5W 6W Weeks M ea n Bo dy W ei gh t o f a ni m al (g ) C L M H * Fig. 2. Celecoxib did not alter the mean body weight of animals in this study. While the mean body weight of group C animals was lower than in the treatment groups, there was no statistically significant difference among all groups (P > 0.05) Table 2. The volume and weight of colon tumor in situa Group volume of tumor, cm3 weight of tumor, g C 0.53 ± 0.07* 0.59 ± 0.06* L 0.34 ± 0.10* 0.44 ± 0.08* M 0.25 ± 0.05* 0.36 ± 0.05* H 0.06 ± 0.03* 0.14 ± 0.03* Note: aValues represent the mean ± SD; *P < 0.05 between all groups. Table 3. The level of PGE2 and COX-2 expression in tumor tissuea Group PGE2 pg/mL COX-2 C 608.88 ± 76.71* 8.67 ± 1.03** L 425.27 ± 71.70* 6.83 ± 1.17** b M 244.77 ± 29.04* 5.50 ± 1.05**b H 97.92 ± 15.57* 3.83 ± 1.17** Notes: aValues represent the mean ± SD; *P < 0.05; bThere were significant differences in the COX-2 expression of tumor tissue between all groups except between L and M groups; **P < 0.05. c h l m Fig. 3. Expression of COX-2 in tumor tissue as determined by immunostaining. COX-2 expression was detected using the streptavidin-biotin-peroxidase method as described in the Mate- rials and Methods section The extent of COX-2 expression in the treatment groups (group L, M and H) decreased gradually with the increasing dose of celecoxib. (Magnification: X 400) 46 Experimental Oncology 30, 42–51, 2008 (March) The expression of COX-2 in the tumor tissue was higher in group C than in the treatment groups (P < 0.05). There were significant differences between all groups except the L and M groups in COX-2 expression in tu- mor tissue (P < 0.05), and the expression decreased correspondingly with the increasing dose of celecoxib (Table 3, Fig. 3). In addition, the PGE2 levels corre- lated positively with the weight of the tumor (r = 0.8814, P < 0.05; Fig. 4, a). Between the PGE2 level and the extent of COX-2 expression significant association was also seen (r = 0.8249, P < 0.05; Fig. 4, b). By inhibiting COX-2, celecoxib could reduce synthesis of PGE2 in the tumor tissue with the increasing dose of celecoxib. Fig. 4. Correlation between PGE2 and either the weight of the tumor (a) or the expression of COX-2 (b). The correlation coefficient between PGE2 and the weight of tumor was 0.8814 (P < 0.05), whereas the correlation coefficient between PGE2 and expression of COX-2 was 0.8249 (P < 0.05) Apoptosis in the tumor cells. Apoptosis of the tumor cells was detected by TUNEL assay to determine the apoptotic index (AI) in the different groups. Our experiment showed that the AI was significantly lower in group C (2.77 ± 0.70) than in the treatment groups (P < 0.05) (Fig. 5). As the dose of celecoxib increased, so did the AI, from 5.90 (± 0.65) in the L group, to 7.47 (± 0.96) in the M group and 9.27 (± 0.97) in the H group. These differences were statistically significant (P < 0.05). The results revealed that celecoxib could dose-dependently enhance tumor cell apoptosis. Microvessel density (MVD). The MVD is the impor- tant biomarker for angiogenesis of tumor. Our experiment investigated the anti- angiogenesis of celecoxib by mea- suring the MVD in the tumor tissue. The MVD in group C (30.50 ± 4.60) was significantly higher than in the treat- ment groups (P < 0.05). Celecoxib obviously decreased the MVD of groups L (24.33 ± 3.78), M (13.17 ± 3.19), and H (9.00 ± 3.58). There were significant differences in c h l m Fig. 5. Detection of apoptotic HT-29 cells by the TUNEL assay. The apoptosis of the tumor cells was detected using the TUNEL method as described in the Materials and Methods section. TUNEL-positive cells (apoptotic cells) are stained brown (Magnification: × 400). There were more apoptotic cells in the samples from celecoxib- treated mice than in the samples from the control group Experimental Oncology 30, 42–51, 2008 (March) 4730, 42–51, 2008 (March) 47March) 47) 47 47 the MVD (P < 0.05) between all groups except between groups H and M (Fig. 6). A significant correlation was found between MVD and PGE2 levels in the tumor (r = 0.9006, P < 0.05; Fig. 7). The results showed that cele- coxib could inhibit the angiogenesis of tumor and PGE2 could have a significant correlation with angiogenesis. Fig. 7. Correlation between PGE2 and MVD in tumors from ce- lecoxib-treated mice. The correlation coefficient between PGE2 and MVD was 0.9006 (P < 0.05) VEGF and MMP-2 mRNA expression. VEGF and MMP-2 play an important role in the angiogenesis of tumor. Additionally MMP-2 might correlate to invasion and metastasis of tumor. Our experiment showed that celecoxib significantly reduced the expression of VEGF and MMP-2 mRNA in the treatment groups compared with to the control group (P < 0.05). There were signifi- cant differences in the expression of VEGF and MMP-2 mRNA (P < 0.05) between all groups except groups L and M (Table 4, Fig. 8 and 9). Table 4. Expression levels of VEGF mRNA and MMP-2 mRNA in tumor tissuea Group VEGF/β-actin MMP-2/β-actin C 0.66 ± 0.10* 0.59 ± 0.14** L 0.49 ± 0.06*b 0.42 ± 0.04**c M 0.43 ± 0.08*b 0.34 ± 0.06**c H 0.23 ± 0.06* 0.22 ± 0.08** Notes: aValues represent the mean ± SD; bThere were significant diffe- rences in the expression levels of VEGF mRNA between all groups except between group L and M; *P <0.05; cThere were significant differences in the expression levels of MMP-2 mRNA between all groups except between groups L and M; **P < 0.05. Fig. 8. Expression of VEGF mRNA in tumor tissue as determined by RT-PCR. Fig. 9. Expression of MMP-2 mRNA in tumor tissue as deter- mined by RT-PCR c h l m Fig. 6. Detection of microvessels in tumor tissue by immu- nostaining for CD34. CD34 expression was detected using the streptavidin-biotin-peroxidase method as described in the Materials and Methods section. The microvessels were more numerous in the control group than in the treatment groups (Magnification: × 200) 48 Experimental Oncology 30, 42–51, 2008 (March) In addition, the MVD of tumor tissue significantly correlated to the expression of VEGF and MMP-2 mRNA in the tumor tissue (r = 0.8573, r = 0.6427, respectively; P < 0.05; Fig. 10, A and B). By inhibiting VEGF and MMP-2 mRNA expression in tumor tissue, celecoxib inhibited the angiogenesis of colorectal cancer Fig. 10. Correlation between MVD and the expression of VEGF (a) and MMP-2 mRNA (b) in tumor tissue. The correlation coef- ficient between MVD and the expression of VEGF mRNA was 0.8573 (P <0.05), whereas the coefficient between MVD and expression of MMP-2 mRNA was 0.6427 (P < 0.05) DISCUSSION In the past 20 years, epidemiological, molecular and clinical studies have proved that COX-2 plays an in- creasingly important role in the occurrence and devel- opment of colon cancer by various mechanisms [5, 12, 13]. Since selective COX-2 inhibitors (e.g. celecoxib) have lower toxicity and side effects compared to the traditional NSAIDs (e.g. aspirin, sulindac, piroxicam, ibuprofen, ibuprofen, and indomethacin), we have investigated the effect of celecoxib on the growth and angiogenesis of orthotopically implanted tumors in a mouse model of human colon cancer [21–24]. Our first priority was to establish a suitable pre- clinical animal model. According to the ‘seed and soil’ theory of S. Paget, the animal model of orthotopic implantation of colon cancer is the most suitable to study the anti-cancer mechanism of celecoxib, because this model more accurately replicates the clinical condition of human colon cancer, thereby more accurately reflecting the efficacy of celecoxib against colon carcinoma. In this study, none of the nude mice died and all animals formed an in situ mass consistent with colorectal tumor. Though liver or lymphoid node metastasis and ascites were not found because of the relatively short observation time and the biological character of HT-29 cells, this model still contributes to the study of the local biology behavior and pathophysi- ological changes of colon cancer. This study showed that both the volume and weight of the tumor can be reduced significantly by cele- coxib treatment. This effect was dose-dependent, as demonstrated by the rate of tumor growth inhibition. Moreover, this effect can be seen even at the lowest dose of celecoxib (0.5 mg/L). There are many possible anticancer mechanisms of celecoxib. The most obvious is the inhibition of COX-2 activity [2]. By inhibiting the enzyme activity of COX-2, celecoxib reduces the synthesis of PGE2. PGE2 might enhance the proliferation and invasive potential of colon carcinoma cells by activating major intracellular signal transduction pathways [25], such as cAMP/PAK/EP [26], c-Met-R/β-catenin [27], Raf/MEK/ERK [28], among others. In addition, recent reports show that PGE2 stimulates angiogenesis, which provides oxygen and nutrients essential for tumor growing [29]. The positive correlation in this study be- tween PGE2 levels and the weight of the tumor shows that, by inhibiting the activity of COX-2, celecoxib re- duced the synthesis of PGE2 and the growth of tumor is suppressed. Celecoxib might exert its effect by reducing the expression of COX-2. In this study, the expression of COX-2 is lower in the treatment groups than in the control group, resulting in the inhibition of the synthesis of PGE2. COX-2 expression could be suppressed by a few possible mechanisms. Tjandrawnata et al. [30] found that PGE2 can up-regulate the expression of COX-2mRNA. When PGE2 levels are reduced, COX-2 ex- pression decreases, which further suppresses the syn- thesis of PGE2. Alternatively, the findings of Chun et al. [31] suggest that celecoxib can down-regulate COX-2 expression by blocking activation of p38 mitogen-acti- vated protein (MAP) kinase and the transcription factor AP-1. Finally, Shishodia et al. [32] have reported that celecoxib inhibits NF-κB activation through inhibition of IKK and Akt activation, leading to down-regulation of synthesis of COX-2. Thereby, not only by directly inhibiting the activity of COX-2, but by down-regulating the synthesis of COX-2, celecoxib takes effect. In this study, the TUNEL assay was used to detect apoptosis, demonstrating that more HT-29 cells under- went apoptosis in the treatment groups than in the control group. These data also show that celecoxib enhanced apoptosis of colon cancer cells in a dose-dependent manner. Recent reports have implicated many different mechanisms in the induction of apoptosis in tumor cells by celecoxib. First, PGE2 can inhibit apoptosis by induc- ing expression of the Bcl-2 proto-oncogene. Also, PGE2 and other prostaglandins often elevate intracellular cAMP concentrations, which can suppress apoptosis. COX-2 inhibitors may prevent colon cancer by interfering with both or either of the above processes [25]. Alternatively, Arico et al. [33] have reported that celecoxib induces apoptosis through the major anti- apoptotic PDK1/Akt/PKB signal transduction pathway. Experimental Oncology 30, 42–51, 2008 (March) 4930, 42–51, 2008 (March) 49March) 49) 49 49 Another possible mechanism, reported by Wu et al. [34], is activation of caspase-9 and caspase-3, and release of cytochrome C in a Bcl-2-independent man- ner. Grosch et al. [35] indicated that celecoxib can inhibit the transition from the G0/G1 to the S phase of the cell cycle in colon cancer cells in a concentration- dependent manner, and induce apoptosis in HT-29 cells. Moreover, this study showed that the effects of celecoxib were independent of the COX-2 status of the cells, strongly suggesting that the anticancer activity of celecoxib is independent of its ability to inhibit COX-2. In other studies, the mechanisms by which selective COX-2 inhibitors induce apoptosis in cancer cells also was found to be COX-2 independent, by affecting such pathways as the 15-lipoxygenase-1 [36], PPAR-δ [2, 37] and NF-κB [38] pathways, for example. So, celecoxib might induce the apoptosis of colon cancer cells by dependent and independent pathways. Angiogenesis plays a critical role in providing oxygen and nutrients essential for tumor growth. Antiangiogenic therapy has great potential to become the new method for conquering cancer in the future [39]. In recent studies, there is evidence that COX-2 may indirectly induce angio- genesis in vitro by increasing the production of angiogenic factors, such as VEGF. In these studies, selective COX-2 inhibitors were shown to be antiangiogenic [7]. Our study also showed that celecoxib suppressed angiogenesis in the treatment groups. The MVD of tu- mors from mice treated with celecoxib was lower than in the control group. Additionally, celecoxib significantly decreased the expression of VEGF and MMP-2 mRNA in the treatment groups compared with the control group. Both VEGF and MMP-2 expression are closely related to angiogenesis. VEGF has been described as the fun- damental and strongest regulator of angiogenesis and vascular permeability [7]. Celecoxib suppresses the ex- pression of VEGF by inhibiting the synthesis of PGE2 and the activation of the EPR/cAMP/PKA signal transduction pathway by which the expression of VEGF was upregu- lated [7, 40]. This pathway is the primary mechanism by which selective COX-2 inhibitors prevent angiogenesis. In our study positive correlations between MVD and PGE2 levels and VEGF mRNA were the best evidence of celecoxib inhibiting this signal pathway. MMP-2 plays an important role in matrix degrada- tion, an important process in tumor angiogenesis. Moreover, the digestion of vascular basement mem- branes and an invasive/angiogenic phenotype has been closely associated with the overexpression of MMP-2. When the basement membranes are deg raded, growth factors are released which can promote tumor angio- genesis [41]. Recently Takahashi et al. [42] reported that overexpression of COX-2 in tumor cells up-regulated the expression of MMP-2, an effect which is blocked by selective COX-2 inhibitors. The results of our study also showed that celecoxib suppressed the expression of MMP-2. Moreover, the expression of MMP-2 was positively related to the MVD. This is another prob- able mechanism of antiangiogenesis by a selective COX-2 inhibitor. There are two potential mechanisms by selective COX-2 inhibitors suppress the expression of MMP-2. The first is by suppressing transcription of MMP-2 [43], which is probably a COX-2-independent effect. The second was described by Attiga et al. [44], that selective COX-2 inhibitors suppress the synthesis of MMP-2 by decreasing the COX-2 metabolites which stimulate the synthesis of MMP-2. There are other po- tential mechanisms by which selective COX-2 inhibitors inhibit angiogensis, such as inhibiting TXA2, alpha V beta 3 integrin, MARK/ERK2 and Akt/GSK signal pathway. In summary, this study tested the hypothesis that the selective COX-2 inhibitor celecoxib can inhibit the growth and angiogenesis of orthotopically implanted tumors in a mouse model of human colon cancer by suppressing COX-2, the synthesis of PGE2 and the expression of VEGF mRNA and MMP-2 mRNA. We did not find any pathologic damage of gastrointestinal tract in any animals, sug- gesting that celecoxib may have minimal side effects, as least in the gastrointestinal tract, in a clinical setting. The further development of safer selective COX-2 inhibitors could be a promising approach for the treatment of colon cancer. However, celecoxib alone did not induce com- plete tumor regression in our study. Accordingly, a careful study of combination therapy with chemotherapeutic agents, or radiotherapy, could lead to more successful and promising treatment for colon cancer [45]. ACKNOWLEDGMENTS We express our gratitude to Wenhong Shen (Jiang- su Institute of Hematology, the First Affiliated Hospital of Soochow University, Jiangsu, China) for her assis- tance in the RIA assay and Yuhai Chai (Department of Pathology, Soochow University, Jiangsu, China) for his assistance in IHC assay. We highly appreciate Dr. Jian- nong Chen for PCR assay. This work was supported by grants from the 135 Medical Talent Project of Ji- angsu Province (No.37RC2002037) and the Important Research Topic Foundation of Health Department of Jiangsu Province of P.R. China (K2000507), China. REFERENCES 1. Jemal A, Murray T, Ward E, et al. Cancer statistics, 2005. CA Cancer J Clin 2005; 55: 10–30. 2. Brown JR, DuBois RN. COX-2: a molecular target for colorectal cancer prevention. J Clin Oncol 2005; 23: 2840–55. 3. Appleby SB, Ristimaki A, Neilson K, et al. Structure of the human cyclo-oxygenase-2 gene. Biochem J 1994; 302: 723–7. 4. Masferrer JL, Leahy KM, Koki AT, et al. Antiangiogenic and antitumor activities of cyclooxygenase-2 inhibitors. Cancer Res 2000; 60: 1306–11. 5. Raju R, Cruz-Correa M. Chemoprevention of colorectal cancer. Dis Colon Rectum 2006; 49: 113–25. 6. Steinbach G, Lynch PM, Philips RK, et al. The effect of celecoxib,a cyclooxygenase -2 inhibitor,in familial adenoma- tous polyposis. N Engl J Med 2000; 342: 1946–52. 7. Bisacchi D, Benelli R, Vanzetto C, et al. Anti-angioge- nesis and angioprevention mechanisms: problems and perspec- tives. Cancer Detect Prev 2003; 27: 229–38. 8. Hilmi I, Goh KL. Chemoprevention of colorectal cancer with nonsteroidal anti-inflammatory drugs. Chin J Dig Dis 2006; 7: 1–6. 50 Experimental Oncology 30, 42–51, 2008 (March) 9. Husain SS, Szabo IL, Tamawski AS. NSAID inhibition of GI cancer growth:clinical implications and molecular mech- anisms of action. Am J Gastroentcrol 2002; 97: 542–53. 10. Grosch S, Tegeder I, Niederberger E, et al. COX-2 independent induction of cell cycle arrest and apoptosis in colon cancer cells by the selective COX-2 inhibitor celecoxib. FASEB J 2001; 15: 2742–4. 11. Dannenberg AJ, Lippman SM, Mann JR, et al. Cyclooxy- genase-2 and epidermal growth factor receptor: pharmacologic targets for chemoprevention. J Clin Oncol 2005; 23: 254–66. 12. Hawk ET, Levin B. Colorectal cancer prevention. J Clin Oncol 2005; 23: 379–91. 13. Sinicrope FA, Gill S. Role of cyclooxygenase-2 in colorectal cancer. Cancer Metastasis Rev 2004; 23: 63-75. 14. Shoji T, Konno H, Tanaka T, et al. Orthotopic implan- tation of a colon cancer xenograft induces high expression of cyclooxygenase-2. Cancer Lett 2003; 195: 235–41. 15. Reddy BS, Hirose Y, Lubet R, et al. Chemoprevention of colon cancer by specific cyclooxygenase-2 inhibitor,celecoxib, administered during different stages of carcinogenesis. Cancer Res 2000; 60: 293–7. 16. Sato H, Ishihara S, Kawashima K, et al. Expression of peroxisome proliferator-activated receptor (PPAR) gamma in gastric cancer and inhibitory effects of PPARgamma agonists. Br J Cancer 2000; 83: 1394–400. 17. Fu J,Wang W, Bai X, et al. Coexpression of vascular endothelial growth factor and its receptors in human tumor cell lines. Chinese J of Cancer 2002; 21: 1217–21. 18. Song J, Qian W, Hou X. A Study the mechamisms of apoptosis of gastric cancer line induced by indomethacin. Chinese J of Clin Digest Dis 2003; 15: 249–53. 19. Yan C, Li C, Tian F, et al. Fibronectin induces matrix metalloproteinase-2 expression in ovarian cancer cells. Chin J Oncol 2000; 22: 109–12. 20. Weidner N. Intratumor microvessel density as a prog- nostic factor in cancer. Am J Pathol 1995; 147: 9–19. 21. Fujimura T, Ohta T, Oyama K, et al. Role of cyclo- oxygenase-2 in the carcinogenesis of gastrointestinal tract cancers: a review and report of personal experience. World J Gastroenterol 2006; 12: 1336–45. 22. Watson AJ. Apoptosis and colorectal cancer. Gut 2004; 53: 1701–9. 23. Sanborn R, Blanke CD. Cyclooxygenase-2 inhibition in colorectal cancer: boom or bust? Semin Oncol 2005; 32: 69–75. 24. Kismet K, Akay MT, Abbasoglu O, et al. Celecoxib: a potent cyclooxygenase-2 inhibitor in cancer prevention. Cancer Detect Prev 2004; 28: 127–42. 25. Sheng H, Shao J,Washington MK, et al. Prostaglandin E2 increases growth and motility of colorectal carcinoma cells. J Biol Chem 2001; 276: 18075–81. 26. Shao J, Lee SB, Guo H, et al. Prostaglandin E2 stimulates the growth of colon cancer cells via induction of amphiregulin. Cancer Res 2003; 63: 5218–23. 27. Pai R, Nakamura T, Moon WS, et al. Prostaglandins pro- mote colon cancer cell invasion; signaling by cross-talk between two distinct growth factor receptors. FASEB J 2003; 17: 1640–7. 28. Shao J, Evers BM, Sheng H. Prostaglandin E2 syner- gistically enhances receptor tyrosine kinase-dependent signaling system in colon cancer cells. Biol Chem 2004; 279: 14287–93. 29. Wang D, DuBois RN. Cyclooxygenase 2-derived prostaglandin E2 regulates the angiogenic switch. PNAS 2004; 101: 415–6. 30. Tjandrawinata RR, Dahiya R, Hughes-Fulford M. Induc- tion of cyclooxygenase-2 mRNA by prostaglandin E2 in human prostatic carcinoma cells. Br J Cancer 1997; 75: 1111–8. 31. Chun KS, Kim SH, Song YS, et al. Celecoxib inhibits phorbol ester-induced expression of COX-2 and activation of AP-1 and p38 MAP kinase in mouse skin. Carcinogenesis 2004; 25: 713–22. 32. Shishodia S, Koul D, Aggarwal BB. Cyclooxygenase (COX)-2 inhibitor celecoxib abrogates TNF-induced NFκB activation through inhibition of activation of IκBα kinase and Akt in human non-small cell lung carcinoma: correla- tion with suppression of COX-2 synthesis. J Immunol 2004; 173: 2011–22. 33. Arico S, Pattingre S, Bauvy C, et al. Celecoxib induces apoptosis by inhibiting 3-phosphoinositidedependent protein kinase-1 activity in the human colon cancer HT-29 cell line. J Biol Chem 2002; 277: 27613–21. 34. Wu T, Leng J, Han C, et al. The cyclooxygenase-2 inhibitor celecoxib blocks phosphorylation of Akt and induces apoptosis in human cholangiocarcinoma cells. Mol Cancer Ther 2004; 3: 299–307. 35. Grosch S, Tegeder I, Niederberger E, et al. COX-2 independent induction of cell cycle arrest and apoptosis in colon cancer cells by the selective COX-2 inhibitor celecoxib. FASEB J 2001; 15: 2742–4. 36. Shureiqi I, Chen D, Lee JJ, et al. 15-LOX-1: a novel molecular target of nonsteroidal anti-inflammatory drug-in- duced apoptosis in colorectal cancer cells. J Natl Cancer Inst 2000; 92: 1136–42. 37. Michael MS, Badr MZ, Badawi AF. Inhibition of cyclooxygenase-2 and activation of peroxisome prolifera- tor-activated receptor-γ synergistically induces apoptosis and inhibits growth of human breast cancer cells. Int J Mol Med 2003; 11: 733–6. 38. Tegeder I, Pfeilschifter J, Geisslinger G. Cyclo- oxygenase-independent actions of cyclooxygenase inhibitors. FASEB J 2001; 15: 2057–72. 39. Ferrara N. Vascular endothelial growth factor as a target for anticancer therapy. Oncologist 2004; 9: 2–10. 40. Seno H, Oshima M, Ishikawa TO, et al. Cyclooxygen- ase 2- and prostaglandin E2 receptor EP2-dependent angio- genesis in APC (Delta716) mouse intestinal polyps. Cancer Res 2002; 62: 506–11. 41. Zucker S, Vacirca J. Role of matrix metalloproteinases (MMPs) in colorectal cancer. Cancer Metastasis Rev 2004; 23: 101–17. 42. Takahashi Y, Kawahara F, Noguchi M, et al. Activa- tion of matrix metalloproteinase-2 in human breast cancer cells overexpressing cyclooxygenase-1 or -2. FEBS Lett 1999; 460: 145–8. 43. Pan MR, Chuang LY, Hung WC. Non-steroidal anti- inflammatory drugs inhibit matrix metalloproteinase-2 expres- sion via repression of transcription in lung cancer cells. FEBS Lett 2001; 508: 365–8. 44. Attiga FA, Fernandez PM, Weeraratna AT, et al. Inhibi- tors of prostaglandin synthesis inhibit human prostate tumor cell invasiveness and reduce the release of matrix metallopro- teinases. Cancer Res 2000; 60: 4629–37. 45. Gasparini G, Longo R, Fanelli M, et al. Combination of antiangiogenic therapy with other anticancer therapies: results, challenges, and open questions. J Clin Oncol 2005; 23: 1295–311. Experimental Oncology 30, 42–51, 2008 (March) 5130, 42–51, 2008 (March) 51March) 51) 51 51 ЦЕЛЕКОКСИБ ИНГИБИРУЕТ РОСТ ОПУХОЛИ И АНГИОГЕНЕЗ ПРИ ОРТОТОПИЧЕСКОЙ ИМПЛАНТАЦИИ РАКА ТОЛСТОЙ КИШКИ ЧЕЛОВЕКА Цель: изучить влияние целекоксиба на рост опухоли и ангиогенез в модели ортопической имплантации опухоли толстой кишки человека. Методы: клетки колоректальной аденокарциномы человека НT-29 подкожно имплантировали бестимусным мышам. После имплантации опухоли четыре группы животных получали разные дозы целекоксиба. Через 42 дня изучали изменения веса животных, объем опухолей, эффект ингибирования роста опухоли. С помощью радиоиммунного анализа (RIA) в гомо-RIA) в гомо-) в гомо- генате опухолей определяли содержание простогландина E2 (PGE2). В опухолевой ткани иммуногистохимическим методом выявляли экспрессию циклооксигеназы-2 (COX-2) и CD34 и оценивали плотность микрососудов (MVD). Апоптотические клетки выявляли методом TUNEL. Экспрессия мРНК фактора роста эндотелия сосудов (VEGF) и металлопротеиназы-2 (MMP-2) в опухолях проанализирована методом обратной транскриптазной реакции (RT-PCR). Результаты: статисти- чески достоверных различий в весе животных между разными группами обнаружено не было. Вто же время, с увеличением дозы целекоксиба объем и вес опухоли уменьшался. По сравнению с контрольной группой (C), рост опухоли статистически достоверно ингибировался в L (низкая доза), M (средняя доза) и H (высокая доза) группах животных на 25,30%, 38,80% и 76,92% соответственно. Были обнаружены значительные отличия в экспрессии COX-2 в опухолевых тканях между всеми группами животных, кроме групп L и M. Было показано целекоксиб-зависимое уменьшение уровня PGE2 в гомогенатах опухолей. Уровень PGE2 коррелировал с весом опухоли (r = 0,8814, P < 0,05) и экспрессией COX-2 (r = 0,8249, P < 0,05). По сравнению с контрольной группой опухолевые клетки мышей, получавших целекоксиб, имели значительно более высокий апоптотический индекс. Целекоксиб также снижал экспрессию CD34+ на поверхности опухолевых клеток. Были обнаружены статистически достоверные различия в MVD между всеми исследованными группами, кроме H и M. Целекоксиб способствовал уменьшению экспрессии мРНК VEGF и MMP-2 в группе Н, но не в группах L и M. MVD в опухолевой ткани кореллировал с уровнем PGE2, а также с экспрессией мРНК VEGF и MMP-2 (r = 0,9006, r = 0,8573 и r = 0,6427 соответственно; P < 0,05). Выводы: целекоксиб способствует апоптозу опухолевых клеток, ингибирует рост опухоли и ангиогенез при ортотопической имплантации мышам колоректальной аденокарциномы человека. Такой эффект целекоксиба связан с угнетением синтеза COX-2, PGE2 и экспрессии мРНК VEGF и MMP-2 в опухолевой ткани. Ключевые слова: рак толстой кишки, ортотопическая имплантация, циклооксигеназа-2, ангиогенез, простогландин E2. Copyright © Experimental Oncology, 2008
id nasplib_isofts_kiev_ua-123456789-139184
institution Digital Library of Periodicals of National Academy of Sciences of Ukraine
issn 1812-9269
language English
last_indexed 2025-11-24T11:02:19Z
publishDate 2008
publisher Інститут експериментальної патології, онкології і радіобіології ім. Р.Є. Кавецького НАН України
record_format dspace
spelling Wang, L.
Chen, W.
Xie, X.
He, Y.
Bai, X.
2018-06-19T20:04:21Z
2018-06-19T20:04:21Z
2008
Celecoxib inhibits tumor growth and angiogenesis in an orthotopic implantation tumor model of human colon cancer / L. Wang, W. Chen, X. Xie, Y. He, X. Bai // Experimental Oncology. — 2008. — Т. 30, № 1. — С. 42–51. — Бібліогр.: 45 назв. — англ.
1812-9269
https://nasplib.isofts.kiev.ua/handle/123456789/139184
Aim: To examine the effect of celecoxib on tumor growth and angiogenesis in an orthotopic implantation tumor model of colon cancer. Methods: Human colorectal adenocarcinoma HT-29 cells were implanted subcutaneously in nude mice. Four groups of animals received different doses of celecoxib after tumor implantation. After 42 days, all animals were evaluated for changes in body weight, the volume and weight of colorectal tumors, and tumor growth inhibition. The content of prostaglandin E2 (PGE2) in the tumor tissue homogenate was estimated by radioimmunoassay (RIA). Cyclooxygenase-2 (COX-2) and CD34 expression in tumor tissue was assessed by immunohistochemistry, and the microvessel density (MVD) of tumor tissue was determined. Apoptosis of the tumor cells was detected by the terminal deoxynucleotidyl transferase-mediated dUTP nick-end labeling (TUNEL). The expression of vascular endothelial growth factor (VEGF) mRNA and matrix metalloproteinase-2 (MMP-2) mRNA extracted from the tumor tissue was analyzed by reverse transcriptase polymerase chain reaction (RT-PCR). Results: There was no statistically significant change in the animals’ body weight between the treatment groups. However, with increasing doses of celecoxib, the volume and weight of the tumor decreased. The rates of tumor growth inhibition for the L (low), M (medium) and H (high) groups were 25.30%, 38.80%, and 76.92%, respectively, which were significant compared to the C (control) group. There were significant differences in COX-2 expression in the tumor tissue between all groups, except between the L and M groups. Celecoxib exposure also reduced PGE2 levels in the tumor tissue homogenates. The level of PGE2 correlated to the weight of tumor (r = 0.8814, P < 0.05) and to COX-2 expression (r = 0.8249, P < 0.05). Compared to the control group, the tumor cells from celecoxib-treated mice had a significantly higher apoptotic index. Celecoxib also decreased CD34+ expression in tumors from treated mice. There were significant differences in the MVD between all groups except between groups H and M. Celecoxib significantly reduced the expression of VEGF and MMP-2 mRNA in the group H but not in L and M groups. The MVD in tumor tissue was closely related to the PGE2 levels, as well as the expression of VEGF and MMP-2 mRNA (r = 0.9006, r = 0.8573 and r = 0.6427, respectively; P < 0.05). Conclusions: By inhibiting COX-2, PGE2 synthesis, and VEGF and MMP-2 mRNA expression in tumor tissue, celecoxib enhances tumor cell apoptosis, thereby inhibiting the growth and angiogenesis of orthotopically implanted tumors in a mouse model of human colorectal cancer.
Цель: изучить влияние целекоксиба на рост опухоли и ангиогенез в модели ортопической имплантации опухоли толстой кишки человека. Методы: клетки колоректальной аденокарциномы человека НT-29 подкожно имплантировали бестимусным мышам. После имплантации опухоли четыре группы животных получали разные дозы целекоксиба. Через 42 дня изучали изменения веса животных, объем опухолей, эффект ингибирования роста опухоли. С помощью радиоиммунного анализа (RIA) в гомо- RIA) в гомо ) в гомогенате опухолей определяли содержание простогландина E2 (PGE2 ). В опухолевой ткани иммуногистохимическим методом выявляли экспрессию циклооксигеназы-2 (COX-2) и CD34 и оценивали плотность микрососудов (MVD). Апоптотические клетки выявляли методом TUNEL. Экспрессия мРНК фактора роста эндотелия сосудов (VEGF) и металлопротеиназы-2 (MMP-2) в опухолях проанализирована методом обратной транскриптазной реакции (RT-PCR). Результаты: статистически достоверных различий в весе животных между разными группами обнаружено не было. Вто же время, с увеличением дозы целекоксиба объем и вес опухоли уменьшался. По сравнению с контрольной группой (C), рост опухоли статистически достоверно ингибировался в L (низкая доза), M (средняя доза) и H (высокая доза) группах животных на 25,30%, 38,80% и 76,92% соответственно. Были обнаружены значительные отличия в экспрессии COX-2 в опухолевых тканях между всеми группами животных, кроме групп L и M. Было показано целекоксиб-зависимое уменьшение уровня PGE2 в гомогенатах опухолей. Уровень PGE2 коррелировал с весом опухоли (r = 0,8814, P < 0,05) и экспрессией COX-2 (r = 0,8249, P < 0,05). По сравнению с контрольной группой опухолевые клетки мышей, получавших целекоксиб, имели значительно более высокий апоптотический индекс. Целекоксиб также снижал экспрессию CD34+ на поверхности опухолевых клеток. Были обнаружены статистически достоверные различия в MVD между всеми исследованными группами, кроме H и M. Целекоксиб способствовал уменьшению экспрессии мРНК VEGF и MMP-2 в группе Н, но не в группах L и M. MVD в опухолевой ткани кореллировал с уровнем PGE2 , а также с экспрессией мРНК VEGF и MMP-2 (r = 0,9006, r = 0,8573 и r = 0,6427 соответственно; P < 0,05). Выводы: целекоксиб способствует апоптозу опухолевых клеток, ингибирует рост опухоли и ангиогенез при ортотопической имплантации мышам колоректальной аденокарциномы человека. Такой эффект целекоксиба связан с угнетением синтеза COX-2, PGE2 и экспрессии мРНК VEGF и MMP-2 в опухолевой ткани.
We express our gratitude to Wenhong Shen (Jiangsu Institute of Hematology, the First Affiliated Hospital of Soochow University, Jiangsu, China) for her assistance in the RIA assay and Yuhai Chai (Department of Pathology, Soochow University, Jiangsu, China) for his assistance in IHC assay. We highly appreciate Dr. Jiannong Chen for PCR assay. This work was supported by grants from the 135 Medical Talent Project of Jiangsu Province (No.37RC2002037) and the Important Research Topic Foundation of Health Department of Jiangsu Province of P.R. China (K2000507), China.
en
Інститут експериментальної патології, онкології і радіобіології ім. Р.Є. Кавецького НАН України
Experimental Oncology
Uncategorized
Celecoxib inhibits tumor growth and angiogenesis in an orthotopic implantation tumor model of human colon cancer
Целекоксиб ингибирует рост опухоли и ангиогенез при ортотопической имплантации рака толстой кишки человека
Article
published earlier
spellingShingle Celecoxib inhibits tumor growth and angiogenesis in an orthotopic implantation tumor model of human colon cancer
Wang, L.
Chen, W.
Xie, X.
He, Y.
Bai, X.
Uncategorized
title Celecoxib inhibits tumor growth and angiogenesis in an orthotopic implantation tumor model of human colon cancer
title_alt Целекоксиб ингибирует рост опухоли и ангиогенез при ортотопической имплантации рака толстой кишки человека
title_full Celecoxib inhibits tumor growth and angiogenesis in an orthotopic implantation tumor model of human colon cancer
title_fullStr Celecoxib inhibits tumor growth and angiogenesis in an orthotopic implantation tumor model of human colon cancer
title_full_unstemmed Celecoxib inhibits tumor growth and angiogenesis in an orthotopic implantation tumor model of human colon cancer
title_short Celecoxib inhibits tumor growth and angiogenesis in an orthotopic implantation tumor model of human colon cancer
title_sort celecoxib inhibits tumor growth and angiogenesis in an orthotopic implantation tumor model of human colon cancer
topic Uncategorized
topic_facet Uncategorized
url https://nasplib.isofts.kiev.ua/handle/123456789/139184
work_keys_str_mv AT wangl celecoxibinhibitstumorgrowthandangiogenesisinanorthotopicimplantationtumormodelofhumancoloncancer
AT chenw celecoxibinhibitstumorgrowthandangiogenesisinanorthotopicimplantationtumormodelofhumancoloncancer
AT xiex celecoxibinhibitstumorgrowthandangiogenesisinanorthotopicimplantationtumormodelofhumancoloncancer
AT hey celecoxibinhibitstumorgrowthandangiogenesisinanorthotopicimplantationtumormodelofhumancoloncancer
AT baix celecoxibinhibitstumorgrowthandangiogenesisinanorthotopicimplantationtumormodelofhumancoloncancer
AT wangl celekoksibingibiruetrostopuholiiangiogenezpriortotopičeskoiimplantaciirakatolstoikiškičeloveka
AT chenw celekoksibingibiruetrostopuholiiangiogenezpriortotopičeskoiimplantaciirakatolstoikiškičeloveka
AT xiex celekoksibingibiruetrostopuholiiangiogenezpriortotopičeskoiimplantaciirakatolstoikiškičeloveka
AT hey celekoksibingibiruetrostopuholiiangiogenezpriortotopičeskoiimplantaciirakatolstoikiškičeloveka
AT baix celekoksibingibiruetrostopuholiiangiogenezpriortotopičeskoiimplantaciirakatolstoikiškičeloveka