Celecoxib inhibits tumor growth and angiogenesis in an orthotopic implantation tumor model of human colon cancer
Aim: To examine the effect of celecoxib on tumor growth and angiogenesis in an orthotopic implantation tumor model of colon cancer. Methods: Human colorectal adenocarcinoma HT-29 cells were implanted subcutaneously in nude mice. Four groups of animals received different doses of celecoxib after tumo...
Збережено в:
| Опубліковано в: : | Experimental Oncology |
|---|---|
| Дата: | 2008 |
| Автори: | , , , , |
| Формат: | Стаття |
| Мова: | Англійська |
| Опубліковано: |
Інститут експериментальної патології, онкології і радіобіології ім. Р.Є. Кавецького НАН України
2008
|
| Теми: | |
| Онлайн доступ: | https://nasplib.isofts.kiev.ua/handle/123456789/139184 |
| Теги: |
Додати тег
Немає тегів, Будьте першим, хто поставить тег для цього запису!
|
| Назва журналу: | Digital Library of Periodicals of National Academy of Sciences of Ukraine |
| Цитувати: | Celecoxib inhibits tumor growth and angiogenesis in an orthotopic implantation tumor model of human colon cancer / L. Wang, W. Chen, X. Xie, Y. He, X. Bai // Experimental Oncology. — 2008. — Т. 30, № 1. — С. 42–51. — Бібліогр.: 45 назв. — англ. |
Репозитарії
Digital Library of Periodicals of National Academy of Sciences of Ukraine| _version_ | 1859475217417502720 |
|---|---|
| author | Wang, L. Chen, W. Xie, X. He, Y. Bai, X. |
| author_facet | Wang, L. Chen, W. Xie, X. He, Y. Bai, X. |
| citation_txt | Celecoxib inhibits tumor growth and angiogenesis in an orthotopic implantation tumor model of human colon cancer / L. Wang, W. Chen, X. Xie, Y. He, X. Bai // Experimental Oncology. — 2008. — Т. 30, № 1. — С. 42–51. — Бібліогр.: 45 назв. — англ. |
| collection | DSpace DC |
| container_title | Experimental Oncology |
| description | Aim: To examine the effect of celecoxib on tumor growth and angiogenesis in an orthotopic implantation tumor model of colon cancer. Methods: Human colorectal adenocarcinoma HT-29 cells were implanted subcutaneously in nude mice. Four groups of animals received different doses of celecoxib after tumor implantation. After 42 days, all animals were evaluated for changes in body weight, the volume and weight of colorectal tumors, and tumor growth inhibition. The content of prostaglandin E2 (PGE2) in the tumor tissue homogenate was estimated by radioimmunoassay (RIA). Cyclooxygenase-2 (COX-2) and CD34 expression in tumor tissue was assessed by immunohistochemistry, and the microvessel density (MVD) of tumor tissue was determined. Apoptosis of the tumor cells was detected by the terminal deoxynucleotidyl transferase-mediated dUTP nick-end labeling (TUNEL). The expression of vascular endothelial growth factor (VEGF) mRNA and matrix metalloproteinase-2 (MMP-2) mRNA extracted from the tumor tissue was analyzed by reverse transcriptase polymerase chain reaction (RT-PCR). Results: There was no statistically significant change in the animals’ body weight between the treatment groups. However, with increasing doses of celecoxib, the volume and weight of the tumor decreased. The rates of tumor growth inhibition for the L (low), M (medium) and H (high) groups were 25.30%, 38.80%, and 76.92%, respectively, which were significant compared to the C (control) group. There were significant differences in COX-2 expression in the tumor tissue between all groups, except between the L and M groups. Celecoxib exposure also reduced PGE2 levels in the tumor tissue homogenates. The level of PGE2 correlated to the weight of tumor (r = 0.8814, P < 0.05) and to COX-2 expression (r = 0.8249, P < 0.05). Compared to the control group, the tumor cells from celecoxib-treated mice had a significantly higher apoptotic index. Celecoxib also decreased CD34+ expression in tumors from treated mice. There were significant differences in the MVD between all groups except between groups H and M. Celecoxib significantly reduced the expression of VEGF and MMP-2 mRNA in the group H but not in L and M groups. The MVD in tumor tissue was closely related to the PGE2 levels, as well as the expression of VEGF and MMP-2 mRNA (r = 0.9006, r = 0.8573 and r = 0.6427, respectively; P < 0.05). Conclusions: By inhibiting COX-2, PGE2 synthesis, and VEGF and MMP-2 mRNA expression in tumor tissue, celecoxib enhances tumor cell apoptosis, thereby inhibiting the growth and angiogenesis of orthotopically implanted tumors in a mouse model of human colorectal cancer.
Цель: изучить влияние целекоксиба на рост опухоли и ангиогенез в модели ортопической имплантации опухоли толстой кишки
человека. Методы: клетки колоректальной аденокарциномы человека НT-29 подкожно имплантировали бестимусным мышам.
После имплантации опухоли четыре группы животных получали разные дозы целекоксиба. Через 42 дня изучали изменения
веса животных, объем опухолей, эффект ингибирования роста опухоли. С помощью радиоиммунного анализа (RIA) в гомо- RIA) в гомо ) в гомогенате
опухолей определяли содержание простогландина E2
(PGE2
). В опухолевой ткани иммуногистохимическим методом
выявляли экспрессию циклооксигеназы-2 (COX-2) и CD34 и оценивали плотность микрососудов (MVD). Апоптотические
клетки выявляли методом TUNEL. Экспрессия мРНК фактора роста эндотелия сосудов (VEGF) и металлопротеиназы-2
(MMP-2) в опухолях проанализирована методом обратной транскриптазной реакции (RT-PCR). Результаты: статистически
достоверных различий в весе животных между разными группами обнаружено не было. Вто же время, с увеличением
дозы целекоксиба объем и вес опухоли уменьшался. По сравнению с контрольной группой (C), рост опухоли статистически
достоверно ингибировался в L (низкая доза), M (средняя доза) и H (высокая доза) группах животных на 25,30%, 38,80% и
76,92% соответственно. Были обнаружены значительные отличия в экспрессии COX-2 в опухолевых тканях между всеми
группами животных, кроме групп L и M. Было показано целекоксиб-зависимое уменьшение уровня PGE2
в гомогенатах
опухолей. Уровень PGE2
коррелировал с весом опухоли (r = 0,8814, P < 0,05) и экспрессией COX-2 (r = 0,8249, P < 0,05).
По сравнению с контрольной группой опухолевые клетки мышей, получавших целекоксиб, имели значительно более высокий
апоптотический индекс. Целекоксиб также снижал экспрессию CD34+ на поверхности опухолевых клеток. Были обнаружены
статистически достоверные различия в MVD между всеми исследованными группами, кроме H и M. Целекоксиб способствовал
уменьшению экспрессии мРНК VEGF и MMP-2 в группе Н, но не в группах L и M. MVD в опухолевой ткани кореллировал с
уровнем PGE2
, а также с экспрессией мРНК VEGF и MMP-2 (r = 0,9006, r = 0,8573 и r = 0,6427 соответственно; P < 0,05).
Выводы: целекоксиб способствует апоптозу опухолевых клеток, ингибирует рост опухоли и ангиогенез при ортотопической
имплантации мышам колоректальной аденокарциномы человека. Такой эффект целекоксиба связан с угнетением синтеза
COX-2, PGE2 и экспрессии мРНК VEGF и MMP-2 в опухолевой ткани.
|
| first_indexed | 2025-11-24T11:02:19Z |
| format | Article |
| fulltext |
42 Experimental Oncology 30, 42–51, 2008 (March)
According to the recent reports, colorectal cancer is
the third most frequently diagnosed cancer in the United
States. In 2005, an estimated 105,950 new cases of
colon cancer occurred. During the same year, an esti-
mated 55,290 people died from colorectal cancer [1].
In China, the incidence of colon cancer has increased
recently, becoming a major threat to the public health.
Therefore, improving early detection and treatment,
especially the efficacy, to reduce mortality and extend
the patients’ lives are of the greatest concern.
Cyclooxygenase (COX), a rate-limiting enzyme for
the metabolism of arachidonic acid to prostanoids,
has two isoforms, constitutive COX-1 and inducible
COX-2, which were identified in 1991 [2, 3]. COX-1 is
expressed in quiescent and normal cells, while in normal
tissue the expression of COX-2 is very low, and, in many
cases, undetectable. COX-2 expression is induced by
a variety of factors, including interleukin-1 (IL-1), tis-
sue anoxia, ultraviolet ray exposure, epidermal growth
factor (EGF), transforming growth factor β (TGF-β),
tumor necrosis factor-α (TNF-α) and tumor promoters
[2]. Recent researches have demonstrated that COX-2
is overexpressed frequently in various gastrointestinal
tract cancers, such as colorectal cancer, esophageal
carcinoma, gastric cancer and pancreatic cancer [4].
Epidemiological and clinical observation and labora-
tory research since 1980s have indicated that non-ste-
roidal anti-inflammatory drugs (NSAIDs) played a crucial
role in tumor inhibition both in vivo and in vitro, particularly
in gastrointestinal tract cancers [5]. These researches
indicated that COX-2 is maybe a target of NSAIDs.
Since the development of selective COX-2 inhibi-
tors to treat inflammatory diseases, Steinbach et al. [6]
first reported in 2000 that in 100 patients with familial
adenomatous polyposis, six months of twice-daily
treatment with 400 mg of celecoxib, a COX-2 inhibitor,
significantly reduced the number of colorectal pol-
yps. More and more studies have demonstrated that
non-selective NSAIDs, as well as selective COX-2
inhibitors, can reduce cellular proliferation, induce
CELECOXIB INHIBITS TUMOR GROWTH AND ANGIOGENESIS
IN AN ORTHOTOPIC IMPLANTATION TUMOR MODEL OF HUMAN
COLON CANCER
L. Wang1, W. Chen1, *, X. Xie2, Y. He3, X. Bai3
1Department of Gastroenterology, the First Affiliated Hospital of Soochow University, Jiangsu, China
2Department of Neurosurgery, the First Affiliated Hospital of Soochow University, Jiangsu, China
3Jiangsu Institute of Hematology, the First Affiliated Hospital of Soochow University, Jiangsu, China
Aim: To examine the effect of celecoxib on tumor growth and angiogenesis in an orthotopic implantation tumor model of colon cancer. Meth-
ods: Human colorectal adenocarcinoma HT-29 cells were implanted subcutaneously in nude mice. Four groups of animals received different
doses of celecoxib after tumor implantation. After 42 days, all animals were evaluated for changes in body weight, the volume and weight of
colorectal tumors, and tumor growth inhibition. The content of prostaglandin E2 (PGE2) in the tumor tissue homogenate was estimated by
radioimmunoassay (RIA). Cyclooxygenase-2 (COX-2) and CD34 expression in tumor tissue was assessed by immunohistochemistry, and
the microvessel density (MVD) of tumor tissue was determined. Apoptosis of the tumor cells was detected by the terminal deoxynucleotidyl
transferase-mediated dUTP nick-end labeling (TUNEL). The expression of vascular endothelial growth factor (VEGF) mRNA and matrix
metalloproteinase-2 (MMP-2) mRNA extracted from the tumor tissue was analyzed by reverse transcriptase polymerase chain reaction
(RT-PCR). Results: There was no statistically significant change in the animals’ body weight between the treatment groups. However, with
increasing doses of celecoxib, the volume and weight of the tumor decreased. The rates of tumor growth inhibition for the L (low), M (medium)
and H (high) groups were 25.30%, 38.80%, and 76.92%, respectively, which were significant compared to the C (control) group. There were
significant differences in COX-2 expression in the tumor tissue between all groups, except between the L and M groups. Celecoxib exposure
also reduced PGE2 levels in the tumor tissue homogenates. The level of PGE2 correlated to the weight of tumor (r = 0.8814, P < 0.05) and
to COX-2 expression (r = 0.8249, P < 0.05). Compared to the control group, the tumor cells from celecoxib-treated mice had a significantly
higher apoptotic index. Celecoxib also decreased CD34+ expression in tumors from treated mice. There were significant differences in the
MVD between all groups except between groups H and M. Celecoxib significantly reduced the expression of VEGF and MMP-2 mRNA in
the group H but not in L and M groups. The MVD in tumor tissue was closely related to the PGE2 levels, as well as the expression of VEGF
and MMP-2 mRNA (r = 0.9006, r = 0.8573 and r = 0.6427, respectively; P < 0.05). Conclusions: By inhibiting COX-2, PGE2 synthesis,
and VEGF and MMP-2 mRNA expression in tumor tissue, celecoxib enhances tumor cell apoptosis, thereby inhibiting the growth and
angiogenesis of orthotopically implanted tumors in a mouse model of human colorectal cancer.
Key Words: colon cancer, orthotopic implantation, cyclooxygenase-2, angiogenesis, prostaglandin E2.
Received: January 17, 2008.
*Correspondence: Fax: +8651265238350
E-mail: weichangchen@126.com
Abbreviations used: AI — apoptotic index; cAMP — cyclic adeno-
sine monophosphate; COX — cyclooxygenase; EP — E-type pros-
taglandin receptor; ERK — extracellular signal regulated protein
kinase; GSK — glycogen synthase kinase; MAPK — mitogen-acti-
vated protein kinase; MEK — MAPK/ERK kinase; MMP-2 — matrix
metalloproteinase-2; MVD — microvessel density; NSAIDs — non-
steroidal anti-inflammatory drugs; PDK1 — 3-phosphoinositide-
dependent protein kinase-1; PKA — protein kinase A; PKB — pro-
tein kinase B; PGs — prostaglandins; RIA – radioimmunoassay;
TIMP — tissue inhibitor of metalloproteinase; TUNEL — terminal
deoxynucleotidyl transferase-mediated dUTP nick-end labeling;
TXA2 — thromboxan A2; VEGF — vascular endothelial growth factor.
Exp Oncol 2008
30, 1, 42–51
Experimental Oncology 30, 42–51, 2008 (March) 4330, 42–51, 2008 (March) 43March) 43) 43 43
apoptosis, promote immunologic surveillance, and/or
reduce neoangiogenesis. These drugs inhibit tumor
angiogenesis by both COX-dependent and COX-in-
dependent mechanisms [7–10]. However, the exact
mechanisms remain poorly understood [11–13].
In this study we established an animal model of or-
thotopic implantation of colon cancer cells to replicate
the clinical conditions of human colon cancer. We then
observed the effects of the selective COX-2 inhibitor
celecoxib on the tumors to investigate its anticancer
mechanism.
MATERIALS AND METHODS
Cell lines and animal model. The human colorectal
adenocarcinoma cell line HT-29 was purchased from
the Institute of Biochemistry and Cell Biology (Shang-
hai Institute for Biological Sciences (SIBS), Chinese
Acade my of the Sciences (CAS), Shanghai, China) and
was maintained in McCoy’s 5A medium containing 10%
fetal bovine serum (GIBCO, USA). Four-week-old female
BALB/c nu/nu mice (Shanghai Laboratory Animal Center,
CAS) were maintained under specific pathogen-free
conditions in a laminar air-flow incubator (25 °C, 40 to
60% humidity, with a 12 h light-dark cycle). To initiate the
tumor growth, HT-29 cells in the log phase of growth were
implanted subcutaneously in nude mice. After 4 weeks,
small pieces of HT-29 tumor tissue (2 mm x 2 mm in di-
ameter) were resected aseptically during the exponential
growth phase (4 weeks) and implanted orthotopically on
the surface of the cecum of 24 nude mice. The cecum
was carefully exteriorized, and the serosa was injured
(2 mm x 2 mm in diameter) at the site where the tumor
was to be implanted. A tumor piece was then fixed on
each injured site of the serosal surface with an 8-0 Vicryl
transmural suture. The abdominal wall and skin were
closed with 8-0 Vicryl sutures [14].
The present study was approved by the ethics com-
mittee of the hospital, and adhered to the tenets of the
Declaration of Helsinky.
COX-2 inhibitor treatment. The selective COX-2
inhibitor, celecoxib, was a generous gift of Pharmacia &
Upjohn Ltd (Suzhou, China). Postoperatively, all animals
were randomly divided into four groups: control (C), and
high (H), middle (M), and low (L) doses of celecoxib. Pure
water or water containing 1.5, 1.0, or 0.5 mg/L celecoxib
was provided daily for these animals to drink freely [15].
The mice were sacrificed at 6 weeks after tumor implanta-
tion. After weighing each animal, the tumors were removed
and the volume and weight were evaluated. The tumor
volume was determined using the formula V = L × W2/
2 where L is length and W is width of colon tumor. The rate
of tumor inhibition (TI) was calculated using the formula
TI = [(average tumor weight of the control group — ave-
rage tumor weight of the treatment group)/average tumor
weight of the control group] × 100%.
Histopathology. For histological examination, the
stomach, intestine, liver and colon of animals were
excised and fixed in 10% neutral buffered formalin
after the animals were sacrificed at 6 weeks. Paraffin
embedded sections (5 μm) were cut and stained with
hematoxlin and eosin for histological examination by
a pathologist who was unaware of the treatment as-
signments. If the orthotopically implantated tumors in-
vaded the serosa, muscularis propria, submucosa, or
mucosa, or there was pathologic damage to either the
stomach or intestine mucosa, or there were liver me-
tastases, the results were observed and recorded.
RIA for PGE2. After colon tumor tissue samples
(50 mg) were washed with 0.9% NS (normal saline),
these tissues were homogenized in 1 ml of 0.9% NS.
Then these solutions were centrifuged (7500 rpm,
10 min). The supernatant (0.1 ml) was collected and
the content of PGE2 was measured with a PGE2 RIA kit
(a gift from Jiangsu Institute of Hematology, Suzhou,
China) according to the manufacturer’s instructions.
PGE2 values were expressed as picogram per milliliter
in the tumor tissue homogenate samples.
RT-PCR for VEGF and MMP-2 mRNA. Tumor
samples were frozen in liquid nitrogen or stored at –80 °C
for mRNA analysis. Total cellular RNA was extracted from
the frozen tumor samples using TRIzol Reagent (Sigma,
MO, USA) according to the manufacturer’s protocol.
Briefly, 40 mg of tumor tissue was homogenized in 1 ml
of TRIzol, and then 0.2 ml of chloroform was added,
and the mixture was centrifuged (12 000 rpm, 15 min,
4 °C). The aqueous layer, which contained the RNA,
was carefully aspirated and 0.5 ml of isopropanol was
added to precipitate the RNA. The resulting solution was
centrifuged (12 000 rpm, 15 min, 4 °C) and the pellet was
washed with 0.6 ml of 75% ethanol, then with 0.8 ml of
100% ethanol and centrifuged again (12 000 rpm, 15 min,
4 °C). Finally, the pellet containing RNA was dissolved in
diethyl pyrocarbonate-treated water (DEPC-H2O) and
was stored frozen at –80 °C until analysis.
The RNA samples were prepared for RT-PCR
analysis by first diluting the mixture of total RNA (2 μg)
and 2 μl random hexamers (0.1 mmol/L) to 15 μl with
DEPC-H2O and incubated at 70 °C for 5 min. Then,
after adding 8 μl of 5 × buffer (Promega co. Madison,
WI,USA), 200 units of Moloneymurine leukemia virus
reverse transcriptase (Promega), 50 units of RNasin
(Promega) and 1.25 μl dNTPs (10 mmol/L), the mixture
was diluted to 25 μl in DEPC-H2O and converted to
cDNA by incubation at 37 °C for 1 h and 95 °C for 5 min.
Finally, the cDNA solution was stored at -20 °C.
PCR was performed using 5 μl of diluted cDNA in a to-
tal volume of 50 μl, including 5 μl 10 × buffer (Promega),
1 μl dNTPs (10 mmol/L), 4 μl MgC12 (25 mmol/L), 2 μl
of sense and antisense primers (10 μmol/L) for VEGF or
MMP-2, 2 μl of sense and antisense primers (10 μmol/L)
for β-actin, and 2.5 units of Taq Polymerase (Promega).
Sequences of the primers for the human VEGF, MMP-
2 and β-actin are shown in Table 1. The samples were
amplified for 30 cycles of PCR reaction in which pre-
denaturation was done for 5 min at 94 °C, denaturation
for 30 s, and extension for 3 min at 72 °C. Annealing time
was 30 s; however, the annealing temperature was 60 °C
for VEGF transcript and 62 °C for MMP-2. After 30 cycles,
the product of the PCR reaction was stored for 7 min at
72 °C and then analyzed.
44 Experimental Oncology 30, 42–51, 2008 (March)
Amplified cDNAs were separated by electropho-
resis on a 1.5% agarose gel containing ethidium
bromide. The density of the electrophoretic band for
each amplification product was evaluated using the
BioCaptMW software. The mRNA values are expressed
as relative units calculated according to the following
formula: density of the VEGF or MMP-2 amplification
product/density of the β-actin amplification product.
Immunohistochemistry for COX-2 protein. Tis-
sue samples were embedded in paraffin, cut into 5 μm
sections, deparaffinized, and subjected to microwave
irradiation for 15 min at 92 to 98 °C in 0.01 M Citric acid
buffer (pH 6.0). Then the slides were immersed in 1%
H2O2 for 30 min to neutralize endogenous peroxidases.
The primary antibody against COX-2 (anti-human COX-
2 mouse IgG, Cayman Chemical, USA) was applied to
tissue sections at a dilution of 1 : 100 and incubated
overnight at 4 °C. The secondary antibody and en-
zymes were obtained in an Ultravision Detection Sys-
tem kit (Lab Vision, USA). The reaction products were
visualized using streptavidin-biotin-peroxidase and 3,
3`-diaminobenzidene chromogen. Finally, the sections
were counterstained with hematoxylin, dehydrated,
and mounted in diphenylxylene. The expression level
of COX-2 was calculated by multiplying a quantitative
measure of the extent of COX-2 staining extent by
the quantitative measure of the staining intensity. The
COX-2 positive staining extent was recorded using
a 5-grade system, based on the percentage of tumor
cells stained: grade 0 = 0% to 4%; grade 1 = 5% to
24%; grade 2 = 25% to 49%; grade 3 = 50% to 74%;
and grade 4 = 75% to 100%. Staining intensity was
recorded using 3-grade system: grade 0 = negative;
1 = weakly positive; 2 = positive. All slides were inde-
pendently evaluated by two blinded observers, both
of whom were experienced pathologists.
Assay for microvessel density (MVD). Microves-
sels in the tumor tissue were immunostained using
anti-human CD34 mouse monoclonal antibody and
the streptavidin-biotin-peroxidase complex technique
(Lab Vision, USA). MVD was evaluated according to the
method first described by Weidner et al. [20]. The entire
tumor sections was observed under a light microscope
(Magnification: 40 x) to find the area that showed the
most intense microvessel density, i.e. the highest density
of brown stained CD34-positive cells (also referred to
as the hot spot). Three different areas within a section
were chosen and the stained microvessels were counted
under a light microscope at 200x magnification. The aver-
age count was considered the MVD for each slide.
Assessing the apoptotic index (AI). Terminal
deoxynucleotidyl transferase-mediated dUTP nick-end
labeling (TUNEL) was performed using a commercial
kit (In Situ Cell Detection kit, POD, Roche Diagnostics,
Germany) according to the manufacturer’s instruc-
tions. By this method, the nuclei of apoptotic tumor
cells were stained brown. One thousand tumor cells,
including the apoptotic tumor cells, were counted
for each sample. The apoptotic index (AI) was calcu-
lated as follows: AI (%) = (number of apoptotic tumor
cells/1000) × 100.
Statistical analysis. The data are expressed as the
mean plus or minus the standard deviation (SD). Analyses
between multiple groups were determined by ANOVA.
Analyses between two groups were determined using the
SNK test. The relationships between PGE2 and the weight
of tumor, between MVD and the PGE2, between COX-
2 expression and the PGE2, between MVD and VEGF
mRNA expression and between MVD and MMP-2 mRNA
expression were examined by simple linear regression
analysis. All statistical analyses were performed using a
statistical software package (SPSS, Version 10.0, USA).
Statistical significance was defined as P-values less than
0.05. All P-values were two-sided.
RESULTS
General Observations. None of the nude mice
died after implantation and all animals formed colorec-
tal tumor masses before sacrifice. Three animals in
group C could touch the mass (about 4 mm in diam-
eter) on the inferior belly in the third week. After all ani-
mals were sacrificed, opening the abdominal cavity of
each animal revealed masses whose size ranged from
0.50 cm × 0.45 cm to 1.35 cm × 0.95 cm (Fig. 1, a).
In addition, staining with haematoxlin and eosin con-
firmed that, in some animals, the tumor cells both the
muscularis propria and submucosa (Fig. 1, b).
The mean body weight of the control animals was
lower than in the treatment groups, but the difference was
not statistically significant (P > 0.05; Fig. 2). However, the
volume and weight of the tumor in group C were signifi-
cantly higher than in the treatment groups, and were sig-
nificantly different among all groups (P < 0.05; Table 2).
Tumor growth was inhibited by 25.30% in the L group,
38.80% in the M group, and 76.92% in the H group, as
compared to the control group. No obvious ascites was
found in the abdominal cavity of any animal.
Also, no animal showed signs of liver metastasis,
hyperemia, edema, erosion, bleeding or ulceration
of the stomach and intestine mucosa, confirmed by
histopathology.
PGE2 levels and COX-2 immunohistochemistry.
The PGE2 is one important product of metabolism of
arachidonic acid to prostanoids. The COX-2 plays a
role in this process. By measuring the PGE2 levels, we
can analyze the activity of COX-2. In our research, the
PGE2 levels in the tumor tissue were higher in group
C than that in the treatment groups (P < 0.05). With
increasing doses of celecoxib, the PGE2 levels in the
treatment groups were reduced (P < 0.05; Table 3).
Table 1. RT-PCR primers
Sense Antisense Product size (bp) Refe rence
β-actin ATCTGGCACCACACCTTCTACAATGAGCTGCG CGTCATACTCCTGTGATCCACATCTGC 838 16
VEGF GGGCCTCCGAAACCATGAACTT CGCATCAGGGGCACACAG 259 17
β-actin GAAACTACCTTCAACTCCATC CGAGGCCAGGATGGAGCCGCC 219 18
MMP-2 ACCTGGATGCCGTCGTGGAC TGTGGCAGCACCAGGGCAGC 447 19
Experimental Oncology 30, 42–51, 2008 (March) 4530, 42–51, 2008 (March) 45March) 45) 45 45
a
b
Fig. 1. Macroscopic and microscopic appearance of ortho-
topically implanted tumors in a mouse model of colon cancer.
a: Different tumor masses were found in the colon of each animal,
and celecoxib obviously inhibited the growth of tumor. b: Staining
with haematoxlin and eosin showed that the tumor cells invaded
muscularis propria and submucosa (Magnification: × 400)
15
16
17
18
19
20
21
22
23
Pro-
operation
1W 2W 3W 4W 5W 6W
Weeks
M
ea
n
Bo
dy
W
ei
gh
t o
f a
ni
m
al
(g
)
C L
M H
*
Fig. 2. Celecoxib did not alter the mean body weight of animals
in this study. While the mean body weight of group C animals
was lower than in the treatment groups, there was no statistically
significant difference among all groups (P > 0.05)
Table 2. The volume and weight of colon tumor in situa
Group volume of tumor, cm3 weight of tumor, g
C 0.53 ± 0.07* 0.59 ± 0.06*
L 0.34 ± 0.10* 0.44 ± 0.08*
M 0.25 ± 0.05* 0.36 ± 0.05*
H 0.06 ± 0.03* 0.14 ± 0.03*
Note: aValues represent the mean ± SD; *P < 0.05 between all groups.
Table 3. The level of PGE2 and COX-2 expression in tumor tissuea
Group PGE2 pg/mL COX-2
C 608.88 ± 76.71* 8.67 ± 1.03**
L 425.27 ± 71.70* 6.83 ± 1.17** b
M 244.77 ± 29.04* 5.50 ± 1.05**b
H 97.92 ± 15.57* 3.83 ± 1.17**
Notes: aValues represent the mean ± SD; *P < 0.05; bThere were significant
differences in the COX-2 expression of tumor tissue between all groups
except between L and M groups; **P < 0.05.
c
h
l
m
Fig. 3. Expression of COX-2 in tumor tissue as determined by
immunostaining. COX-2 expression was detected using the
streptavidin-biotin-peroxidase method as described in the Mate-
rials and Methods section The extent of COX-2 expression in the
treatment groups (group L, M and H) decreased gradually with
the increasing dose of celecoxib. (Magnification: X 400)
46 Experimental Oncology 30, 42–51, 2008 (March)
The expression of COX-2 in the tumor tissue was
higher in group C than in the treatment groups (P < 0.05).
There were significant differences between all groups
except the L and M groups in COX-2 expression in tu-
mor tissue (P < 0.05), and the expression decreased
correspondingly with the increasing dose of celecoxib
(Table 3, Fig. 3). In addition, the PGE2 levels corre-
lated positively with the weight of the tumor (r = 0.8814,
P < 0.05; Fig. 4, a). Between the PGE2 level and the
extent of COX-2 expression significant association was
also seen (r = 0.8249, P < 0.05; Fig. 4, b). By inhibiting
COX-2, celecoxib could reduce synthesis of PGE2 in the
tumor tissue with the increasing dose of celecoxib.
Fig. 4. Correlation between PGE2 and either the weight of
the tumor (a) or the expression of COX-2 (b). The correlation
coefficient between PGE2 and the weight of tumor was 0.8814
(P < 0.05), whereas the correlation coefficient between PGE2
and expression of COX-2 was 0.8249 (P < 0.05)
Apoptosis in the tumor cells. Apoptosis of the
tumor cells was detected by TUNEL assay to determine
the apoptotic index (AI) in the different groups. Our
experiment showed that the AI was significantly lower
in group C (2.77 ± 0.70) than in the treatment groups
(P < 0.05) (Fig. 5). As the dose of celecoxib increased,
so did the AI, from 5.90 (± 0.65) in the L group, to
7.47 (± 0.96) in the M group and 9.27 (± 0.97) in the
H group. These differences were statistically significant
(P < 0.05). The results revealed that celecoxib could
dose-dependently enhance tumor cell apoptosis.
Microvessel density (MVD). The MVD is the impor-
tant biomarker for angiogenesis of tumor. Our experiment
investigated the anti- angiogenesis of celecoxib by mea-
suring the MVD in the tumor tissue. The MVD in group C
(30.50 ± 4.60) was significantly higher than in the treat-
ment groups (P < 0.05). Celecoxib obviously decreased
the MVD of groups L (24.33 ± 3.78), M (13.17 ± 3.19),
and H (9.00 ± 3.58). There were significant differences in
c
h
l
m
Fig. 5. Detection of apoptotic HT-29 cells by the TUNEL assay. The
apoptosis of the tumor cells was detected using the TUNEL method
as described in the Materials and Methods section. TUNEL-positive
cells (apoptotic cells) are stained brown (Magnification: × 400).
There were more apoptotic cells in the samples from celecoxib-
treated mice than in the samples from the control group
Experimental Oncology 30, 42–51, 2008 (March) 4730, 42–51, 2008 (March) 47March) 47) 47 47
the MVD (P < 0.05) between all groups except between
groups H and M (Fig. 6). A significant correlation was
found between MVD and PGE2 levels in the tumor (r =
0.9006, P < 0.05; Fig. 7). The results showed that cele-
coxib could inhibit the angiogenesis of tumor and PGE2
could have a significant correlation with angiogenesis.
Fig. 7. Correlation between PGE2 and MVD in tumors from ce-
lecoxib-treated mice. The correlation coefficient between PGE2
and MVD was 0.9006 (P < 0.05)
VEGF and MMP-2 mRNA expression. VEGF and
MMP-2 play an important role in the angiogenesis of
tumor. Additionally MMP-2 might correlate to invasion
and metastasis of tumor. Our experiment showed that
celecoxib significantly reduced the expression of VEGF
and MMP-2 mRNA in the treatment groups compared
with to the control group (P < 0.05). There were signifi-
cant differences in the expression of VEGF and MMP-2
mRNA (P < 0.05) between all groups except groups L
and M (Table 4, Fig. 8 and 9).
Table 4. Expression levels of VEGF mRNA and MMP-2 mRNA in tumor tissuea
Group VEGF/β-actin MMP-2/β-actin
C 0.66 ± 0.10* 0.59 ± 0.14**
L 0.49 ± 0.06*b 0.42 ± 0.04**c
M 0.43 ± 0.08*b 0.34 ± 0.06**c
H 0.23 ± 0.06* 0.22 ± 0.08**
Notes: aValues represent the mean ± SD; bThere were significant diffe-
rences in the expression levels of VEGF mRNA between all groups except
between group L and M; *P <0.05; cThere were significant differences in
the expression levels of MMP-2 mRNA between all groups except between
groups L and M; **P < 0.05.
Fig. 8. Expression of VEGF mRNA in tumor tissue as determined
by RT-PCR.
Fig. 9. Expression of MMP-2 mRNA in tumor tissue as deter-
mined by RT-PCR
c
h
l
m
Fig. 6. Detection of microvessels in tumor tissue by immu-
nostaining for CD34. CD34 expression was detected using
the streptavidin-biotin-peroxidase method as described in the
Materials and Methods section. The microvessels were more
numerous in the control group than in the treatment groups
(Magnification: × 200)
48 Experimental Oncology 30, 42–51, 2008 (March)
In addition, the MVD of tumor tissue significantly
correlated to the expression of VEGF and MMP-2 mRNA
in the tumor tissue (r = 0.8573, r = 0.6427, respectively;
P < 0.05; Fig. 10, A and B). By inhibiting VEGF and
MMP-2 mRNA expression in tumor tissue, celecoxib
inhibited the angiogenesis of colorectal cancer
Fig. 10. Correlation between MVD and the expression of VEGF
(a) and MMP-2 mRNA (b) in tumor tissue. The correlation coef-
ficient between MVD and the expression of VEGF mRNA was
0.8573 (P <0.05), whereas the coefficient between MVD and
expression of MMP-2 mRNA was 0.6427 (P < 0.05)
DISCUSSION
In the past 20 years, epidemiological, molecular
and clinical studies have proved that COX-2 plays an in-
creasingly important role in the occurrence and devel-
opment of colon cancer by various mechanisms [5, 12,
13]. Since selective COX-2 inhibitors (e.g. celecoxib)
have lower toxicity and side effects compared to the
traditional NSAIDs (e.g. aspirin, sulindac, piroxicam,
ibuprofen, ibuprofen, and indomethacin), we have
investigated the effect of celecoxib on the growth and
angiogenesis of orthotopically implanted tumors in
a mouse model of human colon cancer [21–24].
Our first priority was to establish a suitable pre-
clinical animal model. According to the ‘seed and soil’
theory of S. Paget, the animal model of orthotopic
implantation of colon cancer is the most suitable to
study the anti-cancer mechanism of celecoxib,
because this model more accurately replicates the
clinical condition of human colon cancer, thereby more
accurately reflecting the efficacy of celecoxib against
colon carcinoma. In this study, none of the nude mice
died and all animals formed an in situ mass consistent
with colorectal tumor. Though liver or lymphoid node
metastasis and ascites were not found because of the
relatively short observation time and the biological
character of HT-29 cells, this model still contributes to
the study of the local biology behavior and pathophysi-
ological changes of colon cancer.
This study showed that both the volume and weight
of the tumor can be reduced significantly by cele-
coxib treatment. This effect was dose-dependent, as
demonstrated by the rate of tumor growth inhibition.
Moreover, this effect can be seen even at the lowest
dose of celecoxib (0.5 mg/L).
There are many possible anticancer mechanisms
of celecoxib. The most obvious is the inhibition of
COX-2 activity [2]. By inhibiting the enzyme activity
of COX-2, celecoxib reduces the synthesis of PGE2.
PGE2 might enhance the proliferation and invasive
potential of colon carcinoma cells by activating major
intracellular signal transduction pathways [25], such
as cAMP/PAK/EP [26], c-Met-R/β-catenin [27],
Raf/MEK/ERK [28], among others. In addition, recent
reports show that PGE2 stimulates angiogenesis, which
provides oxygen and nutrients essential for tumor
growing [29]. The positive correlation in this study be-
tween PGE2 levels and the weight of the tumor shows
that, by inhibiting the activity of COX-2, celecoxib re-
duced the synthesis of PGE2 and the growth of tumor
is suppressed.
Celecoxib might exert its effect by reducing the
expression of COX-2. In this study, the expression of
COX-2 is lower in the treatment groups than in the
control group, resulting in the inhibition of the synthesis
of PGE2. COX-2 expression could be suppressed by
a few possible mechanisms. Tjandrawnata et al. [30]
found that PGE2 can up-regulate the expression of
COX-2mRNA. When PGE2 levels are reduced, COX-2 ex-
pression decreases, which further suppresses the syn-
thesis of PGE2. Alternatively, the findings of Chun et al.
[31] suggest that celecoxib can down-regulate COX-2
expression by blocking activation of p38 mitogen-acti-
vated protein (MAP) kinase and the transcription factor
AP-1. Finally, Shishodia et al. [32] have reported that
celecoxib inhibits NF-κB activation through inhibition
of IKK and Akt activation, leading to down-regulation
of synthesis of COX-2. Thereby, not only by directly
inhibiting the activity of COX-2, but by down-regulating
the synthesis of COX-2, celecoxib takes effect.
In this study, the TUNEL assay was used to detect
apoptosis, demonstrating that more HT-29 cells under-
went apoptosis in the treatment groups than in the control
group. These data also show that celecoxib enhanced
apoptosis of colon cancer cells in a dose-dependent
manner. Recent reports have implicated many different
mechanisms in the induction of apoptosis in tumor cells
by celecoxib. First, PGE2 can inhibit apoptosis by induc-
ing expression of the Bcl-2 proto-oncogene. Also, PGE2
and other prostaglandins often elevate intracellular cAMP
concentrations, which can suppress apoptosis. COX-2
inhibitors may prevent colon cancer by interfering with
both or either of the above processes [25].
Alternatively, Arico et al. [33] have reported that
celecoxib induces apoptosis through the major anti-
apoptotic PDK1/Akt/PKB signal transduction pathway.
Experimental Oncology 30, 42–51, 2008 (March) 4930, 42–51, 2008 (March) 49March) 49) 49 49
Another possible mechanism, reported by Wu et al.
[34], is activation of caspase-9 and caspase-3, and
release of cytochrome C in a Bcl-2-independent man-
ner. Grosch et al. [35] indicated that celecoxib can
inhibit the transition from the G0/G1 to the S phase of
the cell cycle in colon cancer cells in a concentration-
dependent manner, and induce apoptosis in HT-29
cells. Moreover, this study showed that the effects of
celecoxib were independent of the COX-2 status of the
cells, strongly suggesting that the anticancer activity of
celecoxib is independent of its ability to inhibit COX-2.
In other studies, the mechanisms by which selective
COX-2 inhibitors induce apoptosis in cancer cells also
was found to be COX-2 independent, by affecting
such pathways as the 15-lipoxygenase-1 [36], PPAR-δ
[2, 37] and NF-κB [38] pathways, for example. So,
celecoxib might induce the apoptosis of colon cancer
cells by dependent and independent pathways.
Angiogenesis plays a critical role in providing oxygen
and nutrients essential for tumor growth. Antiangiogenic
therapy has great potential to become the new method
for conquering cancer in the future [39]. In recent studies,
there is evidence that COX-2 may indirectly induce angio-
genesis in vitro by increasing the production of angiogenic
factors, such as VEGF. In these studies, selective COX-2
inhibitors were shown to be antiangiogenic [7].
Our study also showed that celecoxib suppressed
angiogenesis in the treatment groups. The MVD of tu-
mors from mice treated with celecoxib was lower than
in the control group. Additionally, celecoxib significantly
decreased the expression of VEGF and MMP-2 mRNA in
the treatment groups compared with the control group.
Both VEGF and MMP-2 expression are closely related
to angiogenesis. VEGF has been described as the fun-
damental and strongest regulator of angiogenesis and
vascular permeability [7]. Celecoxib suppresses the ex-
pression of VEGF by inhibiting the synthesis of PGE2 and
the activation of the EPR/cAMP/PKA signal transduction
pathway by which the expression of VEGF was upregu-
lated [7, 40]. This pathway is the primary mechanism by
which selective COX-2 inhibitors prevent angiogenesis.
In our study positive correlations between MVD and
PGE2 levels and VEGF mRNA were the best evidence
of celecoxib inhibiting this signal pathway.
MMP-2 plays an important role in matrix degrada-
tion, an important process in tumor angiogenesis.
Moreover, the digestion of vascular basement mem-
branes and an invasive/angiogenic phenotype has been
closely associated with the overexpression of MMP-2.
When the basement membranes are deg raded, growth
factors are released which can promote tumor angio-
genesis [41]. Recently Takahashi et al. [42] reported that
overexpression of COX-2 in tumor cells up-regulated
the expression of MMP-2, an effect which is blocked
by selective COX-2 inhibitors. The results of our study
also showed that celecoxib suppressed the expression
of MMP-2. Moreover, the expression of MMP-2 was
positively related to the MVD. This is another prob-
able mechanism of antiangiogenesis by a selective
COX-2 inhibitor. There are two potential mechanisms
by selective COX-2 inhibitors suppress the expression
of MMP-2. The first is by suppressing transcription of
MMP-2 [43], which is probably a COX-2-independent
effect. The second was described by Attiga et al. [44],
that selective COX-2 inhibitors suppress the synthesis
of MMP-2 by decreasing the COX-2 metabolites which
stimulate the synthesis of MMP-2. There are other po-
tential mechanisms by which selective COX-2 inhibitors
inhibit angiogensis, such as inhibiting TXA2, alpha V beta
3 integrin, MARK/ERK2 and Akt/GSK signal pathway.
In summary, this study tested the hypothesis that the
selective COX-2 inhibitor celecoxib can inhibit the growth
and angiogenesis of orthotopically implanted tumors in
a mouse model of human colon cancer by suppressing
COX-2, the synthesis of PGE2 and the expression of VEGF
mRNA and MMP-2 mRNA. We did not find any pathologic
damage of gastrointestinal tract in any animals, sug-
gesting that celecoxib may have minimal side effects, as
least in the gastrointestinal tract, in a clinical setting. The
further development of safer selective COX-2 inhibitors
could be a promising approach for the treatment of colon
cancer. However, celecoxib alone did not induce com-
plete tumor regression in our study. Accordingly, a careful
study of combination therapy with chemotherapeutic
agents, or radiotherapy, could lead to more successful
and promising treatment for colon cancer [45].
ACKNOWLEDGMENTS
We express our gratitude to Wenhong Shen (Jiang-
su Institute of Hematology, the First Affiliated Hospital
of Soochow University, Jiangsu, China) for her assis-
tance in the RIA assay and Yuhai Chai (Department of
Pathology, Soochow University, Jiangsu, China) for his
assistance in IHC assay. We highly appreciate Dr. Jian-
nong Chen for PCR assay. This work was supported
by grants from the 135 Medical Talent Project of Ji-
angsu Province (No.37RC2002037) and the Important
Research Topic Foundation of Health Department of
Jiangsu Province of P.R. China (K2000507), China.
REFERENCES
1. Jemal A, Murray T, Ward E, et al. Cancer statistics, 2005.
CA Cancer J Clin 2005; 55: 10–30.
2. Brown JR, DuBois RN. COX-2: a molecular target
for colorectal cancer prevention. J Clin Oncol 2005; 23:
2840–55.
3. Appleby SB, Ristimaki A, Neilson K, et al. Structure of the
human cyclo-oxygenase-2 gene. Biochem J 1994; 302: 723–7.
4. Masferrer JL, Leahy KM, Koki AT, et al. Antiangiogenic
and antitumor activities of cyclooxygenase-2 inhibitors. Cancer
Res 2000; 60: 1306–11.
5. Raju R, Cruz-Correa M. Chemoprevention of colorectal
cancer. Dis Colon Rectum 2006; 49: 113–25.
6. Steinbach G, Lynch PM, Philips RK, et al. The effect of
celecoxib,a cyclooxygenase -2 inhibitor,in familial adenoma-
tous polyposis. N Engl J Med 2000; 342: 1946–52.
7. Bisacchi D, Benelli R, Vanzetto C, et al. Anti-angioge-
nesis and angioprevention mechanisms: problems and perspec-
tives. Cancer Detect Prev 2003; 27: 229–38.
8. Hilmi I, Goh KL. Chemoprevention of colorectal cancer
with nonsteroidal anti-inflammatory drugs. Chin J Dig Dis
2006; 7: 1–6.
50 Experimental Oncology 30, 42–51, 2008 (March)
9. Husain SS, Szabo IL, Tamawski AS. NSAID inhibition
of GI cancer growth:clinical implications and molecular mech-
anisms of action. Am J Gastroentcrol 2002; 97: 542–53.
10. Grosch S, Tegeder I, Niederberger E, et al. COX-2
independent induction of cell cycle arrest and apoptosis in
colon cancer cells by the selective COX-2 inhibitor celecoxib.
FASEB J 2001; 15: 2742–4.
11. Dannenberg AJ, Lippman SM, Mann JR, et al. Cyclooxy-
genase-2 and epidermal growth factor receptor: pharmacologic
targets for chemoprevention. J Clin Oncol 2005; 23: 254–66.
12. Hawk ET, Levin B. Colorectal cancer prevention. J Clin
Oncol 2005; 23: 379–91.
13. Sinicrope FA, Gill S. Role of cyclooxygenase-2 in
colorectal cancer. Cancer Metastasis Rev 2004; 23: 63-75.
14. Shoji T, Konno H, Tanaka T, et al. Orthotopic implan-
tation of a colon cancer xenograft induces high expression of
cyclooxygenase-2. Cancer Lett 2003; 195: 235–41.
15. Reddy BS, Hirose Y, Lubet R, et al. Chemoprevention of
colon cancer by specific cyclooxygenase-2 inhibitor,celecoxib,
administered during different stages of carcinogenesis. Cancer
Res 2000; 60: 293–7.
16. Sato H, Ishihara S, Kawashima K, et al. Expression of
peroxisome proliferator-activated receptor (PPAR) gamma in
gastric cancer and inhibitory effects of PPARgamma agonists.
Br J Cancer 2000; 83: 1394–400.
17. Fu J,Wang W, Bai X, et al. Coexpression of vascular
endothelial growth factor and its receptors in human tumor
cell lines. Chinese J of Cancer 2002; 21: 1217–21.
18. Song J, Qian W, Hou X. A Study the mechamisms
of apoptosis of gastric cancer line induced by indomethacin.
Chinese J of Clin Digest Dis 2003; 15: 249–53.
19. Yan C, Li C, Tian F, et al. Fibronectin induces matrix
metalloproteinase-2 expression in ovarian cancer cells. Chin
J Oncol 2000; 22: 109–12.
20. Weidner N. Intratumor microvessel density as a prog-
nostic factor in cancer. Am J Pathol 1995; 147: 9–19.
21. Fujimura T, Ohta T, Oyama K, et al. Role of cyclo-
oxygenase-2 in the carcinogenesis of gastrointestinal tract
cancers: a review and report of personal experience. World J
Gastroenterol 2006; 12: 1336–45.
22. Watson AJ. Apoptosis and colorectal cancer. Gut 2004;
53: 1701–9.
23. Sanborn R, Blanke CD. Cyclooxygenase-2 inhibition in
colorectal cancer: boom or bust? Semin Oncol 2005; 32: 69–75.
24. Kismet K, Akay MT, Abbasoglu O, et al. Celecoxib:
a potent cyclooxygenase-2 inhibitor in cancer prevention.
Cancer Detect Prev 2004; 28: 127–42.
25. Sheng H, Shao J,Washington MK, et al. Prostaglandin
E2 increases growth and motility of colorectal carcinoma cells.
J Biol Chem 2001; 276: 18075–81.
26. Shao J, Lee SB, Guo H, et al. Prostaglandin E2
stimulates the growth of colon cancer cells via induction of
amphiregulin. Cancer Res 2003; 63: 5218–23.
27. Pai R, Nakamura T, Moon WS, et al. Prostaglandins pro-
mote colon cancer cell invasion; signaling by cross-talk between two
distinct growth factor receptors. FASEB J 2003; 17: 1640–7.
28. Shao J, Evers BM, Sheng H. Prostaglandin E2 syner-
gistically enhances receptor tyrosine kinase-dependent signaling
system in colon cancer cells. Biol Chem 2004; 279: 14287–93.
29. Wang D, DuBois RN. Cyclooxygenase 2-derived
prostaglandin E2 regulates the angiogenic switch. PNAS 2004;
101: 415–6.
30. Tjandrawinata RR, Dahiya R, Hughes-Fulford M. Induc-
tion of cyclooxygenase-2 mRNA by prostaglandin E2 in human
prostatic carcinoma cells. Br J Cancer 1997; 75: 1111–8.
31. Chun KS, Kim SH, Song YS, et al. Celecoxib inhibits
phorbol ester-induced expression of COX-2 and activation
of AP-1 and p38 MAP kinase in mouse skin. Carcinogenesis
2004; 25: 713–22.
32. Shishodia S, Koul D, Aggarwal BB. Cyclooxygenase
(COX)-2 inhibitor celecoxib abrogates TNF-induced NFκB
activation through inhibition of activation of IκBα kinase
and Akt in human non-small cell lung carcinoma: correla-
tion with suppression of COX-2 synthesis. J Immunol 2004;
173: 2011–22.
33. Arico S, Pattingre S, Bauvy C, et al. Celecoxib induces
apoptosis by inhibiting 3-phosphoinositidedependent protein
kinase-1 activity in the human colon cancer HT-29 cell line.
J Biol Chem 2002; 277: 27613–21.
34. Wu T, Leng J, Han C, et al. The cyclooxygenase-2
inhibitor celecoxib blocks phosphorylation of Akt and induces
apoptosis in human cholangiocarcinoma cells. Mol Cancer
Ther 2004; 3: 299–307.
35. Grosch S, Tegeder I, Niederberger E, et al. COX-2
independent induction of cell cycle arrest and apoptosis in
colon cancer cells by the selective COX-2 inhibitor celecoxib.
FASEB J 2001; 15: 2742–4.
36. Shureiqi I, Chen D, Lee JJ, et al. 15-LOX-1: a novel
molecular target of nonsteroidal anti-inflammatory drug-in-
duced apoptosis in colorectal cancer cells. J Natl Cancer Inst
2000; 92: 1136–42.
37. Michael MS, Badr MZ, Badawi AF. Inhibition of
cyclooxygenase-2 and activation of peroxisome prolifera-
tor-activated receptor-γ synergistically induces apoptosis and
inhibits growth of human breast cancer cells. Int J Mol Med
2003; 11: 733–6.
38. Tegeder I, Pfeilschifter J, Geisslinger G. Cyclo-
oxygenase-independent actions of cyclooxygenase inhibitors.
FASEB J 2001; 15: 2057–72.
39. Ferrara N. Vascular endothelial growth factor as a target
for anticancer therapy. Oncologist 2004; 9: 2–10.
40. Seno H, Oshima M, Ishikawa TO, et al. Cyclooxygen-
ase 2- and prostaglandin E2 receptor EP2-dependent angio-
genesis in APC (Delta716) mouse intestinal polyps. Cancer
Res 2002; 62: 506–11.
41. Zucker S, Vacirca J. Role of matrix metalloproteinases
(MMPs) in colorectal cancer. Cancer Metastasis Rev 2004;
23: 101–17.
42. Takahashi Y, Kawahara F, Noguchi M, et al. Activa-
tion of matrix metalloproteinase-2 in human breast cancer
cells overexpressing cyclooxygenase-1 or -2. FEBS Lett 1999;
460: 145–8.
43. Pan MR, Chuang LY, Hung WC. Non-steroidal anti-
inflammatory drugs inhibit matrix metalloproteinase-2 expres-
sion via repression of transcription in lung cancer cells. FEBS
Lett 2001; 508: 365–8.
44. Attiga FA, Fernandez PM, Weeraratna AT, et al. Inhibi-
tors of prostaglandin synthesis inhibit human prostate tumor
cell invasiveness and reduce the release of matrix metallopro-
teinases. Cancer Res 2000; 60: 4629–37.
45. Gasparini G, Longo R, Fanelli M, et al. Combination
of antiangiogenic therapy with other anticancer therapies:
results, challenges, and open questions. J Clin Oncol 2005;
23: 1295–311.
Experimental Oncology 30, 42–51, 2008 (March) 5130, 42–51, 2008 (March) 51March) 51) 51 51
ЦЕЛЕКОКСИБ ИНГИБИРУЕТ РОСТ ОПУХОЛИ И АНГИОГЕНЕЗ
ПРИ ОРТОТОПИЧЕСКОЙ ИМПЛАНТАЦИИ РАКА ТОЛСТОЙ
КИШКИ ЧЕЛОВЕКА
Цель: изучить влияние целекоксиба на рост опухоли и ангиогенез в модели ортопической имплантации опухоли толстой кишки
человека. Методы: клетки колоректальной аденокарциномы человека НT-29 подкожно имплантировали бестимусным мышам.
После имплантации опухоли четыре группы животных получали разные дозы целекоксиба. Через 42 дня изучали изменения
веса животных, объем опухолей, эффект ингибирования роста опухоли. С помощью радиоиммунного анализа (RIA) в гомо-RIA) в гомо-) в гомо-
генате опухолей определяли содержание простогландина E2 (PGE2). В опухолевой ткани иммуногистохимическим методом
выявляли экспрессию циклооксигеназы-2 (COX-2) и CD34 и оценивали плотность микрососудов (MVD). Апоптотические
клетки выявляли методом TUNEL. Экспрессия мРНК фактора роста эндотелия сосудов (VEGF) и металлопротеиназы-2
(MMP-2) в опухолях проанализирована методом обратной транскриптазной реакции (RT-PCR). Результаты: статисти-
чески достоверных различий в весе животных между разными группами обнаружено не было. Вто же время, с увеличением
дозы целекоксиба объем и вес опухоли уменьшался. По сравнению с контрольной группой (C), рост опухоли статистически
достоверно ингибировался в L (низкая доза), M (средняя доза) и H (высокая доза) группах животных на 25,30%, 38,80% и
76,92% соответственно. Были обнаружены значительные отличия в экспрессии COX-2 в опухолевых тканях между всеми
группами животных, кроме групп L и M. Было показано целекоксиб-зависимое уменьшение уровня PGE2 в гомогенатах
опухолей. Уровень PGE2 коррелировал с весом опухоли (r = 0,8814, P < 0,05) и экспрессией COX-2 (r = 0,8249, P < 0,05).
По сравнению с контрольной группой опухолевые клетки мышей, получавших целекоксиб, имели значительно более высокий
апоптотический индекс. Целекоксиб также снижал экспрессию CD34+ на поверхности опухолевых клеток. Были обнаружены
статистически достоверные различия в MVD между всеми исследованными группами, кроме H и M. Целекоксиб способствовал
уменьшению экспрессии мРНК VEGF и MMP-2 в группе Н, но не в группах L и M. MVD в опухолевой ткани кореллировал с
уровнем PGE2, а также с экспрессией мРНК VEGF и MMP-2 (r = 0,9006, r = 0,8573 и r = 0,6427 соответственно; P < 0,05).
Выводы: целекоксиб способствует апоптозу опухолевых клеток, ингибирует рост опухоли и ангиогенез при ортотопической
имплантации мышам колоректальной аденокарциномы человека. Такой эффект целекоксиба связан с угнетением синтеза
COX-2, PGE2 и экспрессии мРНК VEGF и MMP-2 в опухолевой ткани.
Ключевые слова: рак толстой кишки, ортотопическая имплантация, циклооксигеназа-2, ангиогенез, простогландин E2.
Copyright © Experimental Oncology, 2008
|
| id | nasplib_isofts_kiev_ua-123456789-139184 |
| institution | Digital Library of Periodicals of National Academy of Sciences of Ukraine |
| issn | 1812-9269 |
| language | English |
| last_indexed | 2025-11-24T11:02:19Z |
| publishDate | 2008 |
| publisher | Інститут експериментальної патології, онкології і радіобіології ім. Р.Є. Кавецького НАН України |
| record_format | dspace |
| spelling | Wang, L. Chen, W. Xie, X. He, Y. Bai, X. 2018-06-19T20:04:21Z 2018-06-19T20:04:21Z 2008 Celecoxib inhibits tumor growth and angiogenesis in an orthotopic implantation tumor model of human colon cancer / L. Wang, W. Chen, X. Xie, Y. He, X. Bai // Experimental Oncology. — 2008. — Т. 30, № 1. — С. 42–51. — Бібліогр.: 45 назв. — англ. 1812-9269 https://nasplib.isofts.kiev.ua/handle/123456789/139184 Aim: To examine the effect of celecoxib on tumor growth and angiogenesis in an orthotopic implantation tumor model of colon cancer. Methods: Human colorectal adenocarcinoma HT-29 cells were implanted subcutaneously in nude mice. Four groups of animals received different doses of celecoxib after tumor implantation. After 42 days, all animals were evaluated for changes in body weight, the volume and weight of colorectal tumors, and tumor growth inhibition. The content of prostaglandin E2 (PGE2) in the tumor tissue homogenate was estimated by radioimmunoassay (RIA). Cyclooxygenase-2 (COX-2) and CD34 expression in tumor tissue was assessed by immunohistochemistry, and the microvessel density (MVD) of tumor tissue was determined. Apoptosis of the tumor cells was detected by the terminal deoxynucleotidyl transferase-mediated dUTP nick-end labeling (TUNEL). The expression of vascular endothelial growth factor (VEGF) mRNA and matrix metalloproteinase-2 (MMP-2) mRNA extracted from the tumor tissue was analyzed by reverse transcriptase polymerase chain reaction (RT-PCR). Results: There was no statistically significant change in the animals’ body weight between the treatment groups. However, with increasing doses of celecoxib, the volume and weight of the tumor decreased. The rates of tumor growth inhibition for the L (low), M (medium) and H (high) groups were 25.30%, 38.80%, and 76.92%, respectively, which were significant compared to the C (control) group. There were significant differences in COX-2 expression in the tumor tissue between all groups, except between the L and M groups. Celecoxib exposure also reduced PGE2 levels in the tumor tissue homogenates. The level of PGE2 correlated to the weight of tumor (r = 0.8814, P < 0.05) and to COX-2 expression (r = 0.8249, P < 0.05). Compared to the control group, the tumor cells from celecoxib-treated mice had a significantly higher apoptotic index. Celecoxib also decreased CD34+ expression in tumors from treated mice. There were significant differences in the MVD between all groups except between groups H and M. Celecoxib significantly reduced the expression of VEGF and MMP-2 mRNA in the group H but not in L and M groups. The MVD in tumor tissue was closely related to the PGE2 levels, as well as the expression of VEGF and MMP-2 mRNA (r = 0.9006, r = 0.8573 and r = 0.6427, respectively; P < 0.05). Conclusions: By inhibiting COX-2, PGE2 synthesis, and VEGF and MMP-2 mRNA expression in tumor tissue, celecoxib enhances tumor cell apoptosis, thereby inhibiting the growth and angiogenesis of orthotopically implanted tumors in a mouse model of human colorectal cancer. Цель: изучить влияние целекоксиба на рост опухоли и ангиогенез в модели ортопической имплантации опухоли толстой кишки человека. Методы: клетки колоректальной аденокарциномы человека НT-29 подкожно имплантировали бестимусным мышам. После имплантации опухоли четыре группы животных получали разные дозы целекоксиба. Через 42 дня изучали изменения веса животных, объем опухолей, эффект ингибирования роста опухоли. С помощью радиоиммунного анализа (RIA) в гомо- RIA) в гомо ) в гомогенате опухолей определяли содержание простогландина E2 (PGE2 ). В опухолевой ткани иммуногистохимическим методом выявляли экспрессию циклооксигеназы-2 (COX-2) и CD34 и оценивали плотность микрососудов (MVD). Апоптотические клетки выявляли методом TUNEL. Экспрессия мРНК фактора роста эндотелия сосудов (VEGF) и металлопротеиназы-2 (MMP-2) в опухолях проанализирована методом обратной транскриптазной реакции (RT-PCR). Результаты: статистически достоверных различий в весе животных между разными группами обнаружено не было. Вто же время, с увеличением дозы целекоксиба объем и вес опухоли уменьшался. По сравнению с контрольной группой (C), рост опухоли статистически достоверно ингибировался в L (низкая доза), M (средняя доза) и H (высокая доза) группах животных на 25,30%, 38,80% и 76,92% соответственно. Были обнаружены значительные отличия в экспрессии COX-2 в опухолевых тканях между всеми группами животных, кроме групп L и M. Было показано целекоксиб-зависимое уменьшение уровня PGE2 в гомогенатах опухолей. Уровень PGE2 коррелировал с весом опухоли (r = 0,8814, P < 0,05) и экспрессией COX-2 (r = 0,8249, P < 0,05). По сравнению с контрольной группой опухолевые клетки мышей, получавших целекоксиб, имели значительно более высокий апоптотический индекс. Целекоксиб также снижал экспрессию CD34+ на поверхности опухолевых клеток. Были обнаружены статистически достоверные различия в MVD между всеми исследованными группами, кроме H и M. Целекоксиб способствовал уменьшению экспрессии мРНК VEGF и MMP-2 в группе Н, но не в группах L и M. MVD в опухолевой ткани кореллировал с уровнем PGE2 , а также с экспрессией мРНК VEGF и MMP-2 (r = 0,9006, r = 0,8573 и r = 0,6427 соответственно; P < 0,05). Выводы: целекоксиб способствует апоптозу опухолевых клеток, ингибирует рост опухоли и ангиогенез при ортотопической имплантации мышам колоректальной аденокарциномы человека. Такой эффект целекоксиба связан с угнетением синтеза COX-2, PGE2 и экспрессии мРНК VEGF и MMP-2 в опухолевой ткани. We express our gratitude to Wenhong Shen (Jiangsu Institute of Hematology, the First Affiliated Hospital of Soochow University, Jiangsu, China) for her assistance in the RIA assay and Yuhai Chai (Department of Pathology, Soochow University, Jiangsu, China) for his assistance in IHC assay. We highly appreciate Dr. Jiannong Chen for PCR assay. This work was supported by grants from the 135 Medical Talent Project of Jiangsu Province (No.37RC2002037) and the Important Research Topic Foundation of Health Department of Jiangsu Province of P.R. China (K2000507), China. en Інститут експериментальної патології, онкології і радіобіології ім. Р.Є. Кавецького НАН України Experimental Oncology Uncategorized Celecoxib inhibits tumor growth and angiogenesis in an orthotopic implantation tumor model of human colon cancer Целекоксиб ингибирует рост опухоли и ангиогенез при ортотопической имплантации рака толстой кишки человека Article published earlier |
| spellingShingle | Celecoxib inhibits tumor growth and angiogenesis in an orthotopic implantation tumor model of human colon cancer Wang, L. Chen, W. Xie, X. He, Y. Bai, X. Uncategorized |
| title | Celecoxib inhibits tumor growth and angiogenesis in an orthotopic implantation tumor model of human colon cancer |
| title_alt | Целекоксиб ингибирует рост опухоли и ангиогенез при ортотопической имплантации рака толстой кишки человека |
| title_full | Celecoxib inhibits tumor growth and angiogenesis in an orthotopic implantation tumor model of human colon cancer |
| title_fullStr | Celecoxib inhibits tumor growth and angiogenesis in an orthotopic implantation tumor model of human colon cancer |
| title_full_unstemmed | Celecoxib inhibits tumor growth and angiogenesis in an orthotopic implantation tumor model of human colon cancer |
| title_short | Celecoxib inhibits tumor growth and angiogenesis in an orthotopic implantation tumor model of human colon cancer |
| title_sort | celecoxib inhibits tumor growth and angiogenesis in an orthotopic implantation tumor model of human colon cancer |
| topic | Uncategorized |
| topic_facet | Uncategorized |
| url | https://nasplib.isofts.kiev.ua/handle/123456789/139184 |
| work_keys_str_mv | AT wangl celecoxibinhibitstumorgrowthandangiogenesisinanorthotopicimplantationtumormodelofhumancoloncancer AT chenw celecoxibinhibitstumorgrowthandangiogenesisinanorthotopicimplantationtumormodelofhumancoloncancer AT xiex celecoxibinhibitstumorgrowthandangiogenesisinanorthotopicimplantationtumormodelofhumancoloncancer AT hey celecoxibinhibitstumorgrowthandangiogenesisinanorthotopicimplantationtumormodelofhumancoloncancer AT baix celecoxibinhibitstumorgrowthandangiogenesisinanorthotopicimplantationtumormodelofhumancoloncancer AT wangl celekoksibingibiruetrostopuholiiangiogenezpriortotopičeskoiimplantaciirakatolstoikiškičeloveka AT chenw celekoksibingibiruetrostopuholiiangiogenezpriortotopičeskoiimplantaciirakatolstoikiškičeloveka AT xiex celekoksibingibiruetrostopuholiiangiogenezpriortotopičeskoiimplantaciirakatolstoikiškičeloveka AT hey celekoksibingibiruetrostopuholiiangiogenezpriortotopičeskoiimplantaciirakatolstoikiškičeloveka AT baix celekoksibingibiruetrostopuholiiangiogenezpriortotopičeskoiimplantaciirakatolstoikiškičeloveka |