The frequency of human papilloma virus types 16, 18 in upper genital tract of women at high risk of developing ovarian cancer
Aim: To investigate the incidence of human papilloma virus (HPV) types 16, 18 in upper genital tract of women considered at a high risk (HR) of developing epithelial ovarian cancer (EOC). Methods: HPV 16 and 18 E6 ORF specific semiquantitative PCR was used to screen the incidence of HPV in 20 women...
Saved in:
| Published in: | Experimental Oncology |
|---|---|
| Date: | 2014 |
| Main Authors: | , , , |
| Format: | Article |
| Language: | English |
| Published: |
Інститут експериментальної патології, онкології і радіобіології ім. Р.Є. Кавецького НАН України
2014
|
| Subjects: | |
| Online Access: | https://nasplib.isofts.kiev.ua/handle/123456789/145342 |
| Tags: |
Add Tag
No Tags, Be the first to tag this record!
|
| Journal Title: | Digital Library of Periodicals of National Academy of Sciences of Ukraine |
| Cite this: | The frequency of human papilloma virus types 16, 18 in upper genital tract of women at high risk of developing ovarian cancer / O.O. Bilyk, N.T. Pande, T. Pejovic, L.G. Buchynska // Experimental Oncology. — 2014. — Т. 36, № 2. — С. 121-124. — Бібліогр.: 26 назв. — англ. |
Institution
Digital Library of Periodicals of National Academy of Sciences of Ukraine| _version_ | 1859742319867068416 |
|---|---|
| author | Bilyk, O.O. Pande, N.T. Pejovic, T. Buchynska, L.G. |
| author_facet | Bilyk, O.O. Pande, N.T. Pejovic, T. Buchynska, L.G. |
| citation_txt | The frequency of human papilloma virus types 16, 18 in upper genital tract of women at high risk of developing ovarian cancer / O.O. Bilyk, N.T. Pande, T. Pejovic, L.G. Buchynska // Experimental Oncology. — 2014. — Т. 36, № 2. — С. 121-124. — Бібліогр.: 26 назв. — англ. |
| collection | DSpace DC |
| container_title | Experimental Oncology |
| description | Aim: To investigate the incidence of human papilloma virus (HPV) types 16, 18 in upper genital tract of women considered at a high risk (HR) of developing epithelial ovarian cancer (EOC). Methods: HPV 16 and 18 E6 ORF specific semiquantitative PCR was used to screen the incidence of HPV in 20 women at HR of developing EOC and 10 women with no ovarian disease (control). Results: The HR subset of fallopian tubes and ovarian tissues showed greater positivity for HPV E6 ORF (40%) as compared to control (10%) tissues. Of all the samples, two (10%) were positive for HPV 16, two (10%) were positive for HPV 18, and four (20%) showed positivity for mixed HPV 16/18 infection. The presence of HPV E6 ORF was found both in the fallopian tubes and ovarian DNA from 6 (30%) patients. In two cases (10%) we detected HPV ORF only in the fallopian tube derived genomic DNA. Conclusion: It has been shown the presence of HPV in the upper genital tract in women at HR of developing EOC in close proximity of HPV susceptible tissue cervix. Key Words: HPV, high risk of ovarian cancer.
|
| first_indexed | 2025-12-01T18:20:31Z |
| format | Article |
| fulltext |
Experimental Oncology 36, 121–124, 2014 (June) 121
THE FREQUENCY OF HUMAN PAPILLOMA VIRUS TYPES 16, 18
IN UPPER GENITAL TRACT OF WOMEN AT HIGH RISK
OF DEVELOPING OVARIAN CANCER
O.O. Bilyk1,*, N.T. Pande2, T. Pejovic2, L.G. Buchynska1
1R.E. Kavetsky Institute of Experimental Pathology, Oncology and Radiobiology, NAS of Ukraine,
Kyiv 03022, Ukraine
2Oregon Health & Science University, Knight Cancer Institute, Portland, Oregon 97239, USA
Aim: To investigate the incidence of human papilloma virus (HPV) types 16, 18 in upper genital tract of women considered at a high risk
(HR) of developing epithelial ovarian cancer (EOC). Methods: HPV 16 and 18 E6 ORF specific semiquantitative PCR was used to screen
the incidence of HPV in 20 women at HR of developing EOC and 10 women with no ovarian disease (control). Results: The HR subset
of fallopian tubes and ovarian tissues showed greater positivity for HPV E6 ORF (40%) as compared to control (10%) tissues. Of all
the samples, two (10%) were positive for HPV 16, two (10%) were positive for HPV 18, and four (20%) showed positivity for mixed HPV
16/18 infection. The presence of HPV E6 ORF was found both in the fallopian tubes and ovarian DNA from 6 (30%) patients. In two
cases (10%) we detected HPV ORF only in the fallopian tube derived genomic DNA. Conclusion: It has been shown the presence of HPV
in the upper genital tract in women at HR of developing EOC in close proximity of HPV susceptible tissue cervix.
Key Words: HPV, high risk of ovarian cancer.
The devastating and lethal epithelial cancer
of the ovaries (EOC) is characterized by an asympto-
matic clinical course, the absence of a reliable diag-
nostic marker(s), clearly defined etiologic, pathologic,
and genetic parameters at an early stage [1, 2]. Vari-
ous lines of evidence point to hormonal, genetic and
external environment as significant factors in the deve-
lopment of the disease [2, 3]. In addition to the global
and local environmental factors such as occupational
exposure, hormones, parity, and age, it is thought
that there may be a genetic predisposition for deve-
loping EOC [4]. Genetic contribution to cancer risk
is indica ted by the accumulation of ovarian and breast
cancers in either a first-degree relatives or a second-
degree relatives in a cohort of women with ovarian
or/and breast cancers. The most studied risk factor
for ovarian cancer or breast-ovarian cancer syn-
dromes is an inherited germline mutation of highly
penetrant DNA repair genes BRCA1 (locus 17q21) and
BRCA2 (locus 13q12.3). BRCA1 and BRCA2 muta-
tions are responsible for about 5–10% of all ovarian
cancers. The pe netration of heterozygous BRCA1 and
BRCA2 mutations are thought to have a dose effect
dependent upon the mutated allele transcript and
genetic alterations of tumor suppressor genes, par-
ticularly TP53, in addition to the environmental factors
mentioned above [5–7].
The genetic and environmental modifiers and
their synergistic effect on the risk for EOC not associ-
ated with BRCA mutations among women with family
history of ovarian and breast cancers are subjects
of active investigation at clinical and molecular level
[6]. In our previous study, an important DNA repair
protein in the Fanconi Anemia pathway, Fanconi Ane-
mia complementation protein D2 (FANCD2) has been
implicated as an important EOC risk factor in women
without BRCA mutations [7].
HPV is a known etiological moderator of epithelial
malignancies and has been found in 99.7% of women
with high-grade cervical intraepithelial neoplasia [8, 9].
Even though ovarian tissues reside in close proximity
of the cervix, the role of HPVs in predisposing women
for developing EOC has been relatively controversial
and the prevalence of HPV in EOC varies markedly
by geographical area [10, 11].
Our present understanding of the productive viral
infection of HPVs specifies that they are strictly epi-
theliotropic [12]. They infect squamous epithelium and
establish their genomes as low copy number episomes
in proliferating basal cells [13]. As infected cells diffe-
rentiate, the viral DNA is amplified to high copy number,
with concomitant expression of late capsid proteins
L1 and L3, followed by the encapsidation and release
of infectious virus particles [14]. The HPV genome gets
integrated with host cell genome, often accompanied
by the loss of early viral regulatory genes E1 and E2,
and a dysregulated expression of E6/E7 gene pro ducts.
The early viral proteins E6 and E7 directly interact with
TP53 and PRb and subvert their expression and hence
act as potent oncogenes. Additionally, E6 and E7 in-
teract with factors affecting growth and apoptosis and
are critical for neoplastic transformation of the host
cell [15]. Elevated E6 and E7 protein levels are indica-
tors of growth changes and transform epithelial cells.
High risk (HR) HPV E6 and E7 oncoproteins can each
independently induce genomic instability in normal cells
by generation of mitotic defects and aneuploidy through
the induction of centrosome abnormalities [16].
Submitted: May 8, 2014.
Correspondence: E-mail: lenabilyk@gmail.com
Abbreviations used: EOC — epithelial ovarian cancer; HPV — hu-
man papilloma virus; HR — high risk.
Exp Oncol 2014
36, 2, 121–124
122 Experimental Oncology 36, 121–124, 2014 (June)
We designed this study to investigate the presence
of DNA of HPV 16 and 18 in the upper genital tract
in women at HR of developing EOC.
MATERIALS AND METHODS
Patients samples. 30 samples from Oregon Ova-
rian Cancer Tissue Repository which included 10 nor-
mal ovaries were obtained from women who underwent
oophorectomy for unrelated causes and 20 fallopian
tubes and ovaries from HR women undergoing risk
reducing oophorectomy after having obtained signed
informed consent. The study was approved by the Ethi-
cal Committee permission of Institute of Experimen-
tal Pathology, Oncology and Radiobiology of NAS
of Ukraine for studies with human materials.
We define patients considered to be at HR for EOC
as women with two or more first degree relatives with
ovarian and/or breast cancer, or with a personal his-
tory of breast cancer along with first-degree relatives
with breast and/or ovarian cancer. Five HR women
had mutations in BRCA1 or BRCA2 genes. The mean
age at the time of oophorectomy for HR patients was
45.7 ± 2.5 with age ranging from 26 to 74 years and
prevailing majority of women (12/20; 60%) were aged
26–46 years.
DNA extraction. Formalin-fixed, paraffin-embed-
ded samples were obtained as 20 μm slices, depa-
raffinized in xylene, rehydrated in absolute and 70%
ethanol. Vigorous precautions were taken to avoid
sample contamination, including sample preparation
of experimental and positive controls in different labs
and cleansing the microtome with 75% ethanol before
and after cutting each paraffin block. Then samples
were processed with QIAamp DNA Mini kit (Qiagen) ac-
cording manufacturers’ instructions. DNA was eluted
from columns in a volume of 50 μl.
PCR amplification. The quality of DNA from each
tumor specimens was confirmed by PCR using primers
for β-globin (224 bp):
β-globin F: CACTCAGTGTGGCAAAGGTGCCC;
β-globin R: GGCACTGACTCTCTCTGCCT.
We detected the presence of HPV genome with
type-specific primers for E6 fragment of high-risk HPV
types 16 and 18.
The primers sets were as following:
HPV 16 F: TTAGAATGTGTGTACTGCAAGC;
HPV 16 R: TTGTCCAGATGTCTTTGCTT;
HPV 18 F: CACTTCACTGCAAGACATAG;
HPV 18 R: CTATGTTGTGAAATCGTCGT.
All primers were designed using the Vector NTI
software (Invitrogen), homology of designed primers
was tested by BLAST algorithm (NCBI nucleic acid
database).
All PCR reactions were carried out in a total volume
of 50 μl. The reaction mixture contained 1×PCR buf-
fer (Promega, USA), 3 mM MgCl2, 0.2 mM each dNTP,
2.0 μM primers and 1.25u Taq polymerase (Promega,
USA) and either 30 or 10 ng of DNA. Samples were am-
plified on an ABS programmable thermal cycler (Ap-
plied Biosystems, USA). The mixture was denatured for
5 min at 92 °C followed by 33 or 37 cycles as follows:
denaturation at 92 °C for 30 s, annealing at 53 °C for
30 s, extension at 72 °C for 1 min. The final extension
was for 10 min at 72 °C. The amplified gene fragments
281bp for HPV 16 and 326bp for HPV 18 were visualized
on 2% agarose gels. HeLa and Caski cell lines DNA
were used as positive control for HPV 16 and 18 ampli-
fication. Water template was used as negative control.
RESULTS
Detection of HPV 16/18 DNA in upper genital
tract of patients at HR of developing EOC. The pre-
sence of HPV 16 and 18 genomes were detected
by PCR of E6 ORF using HPV type specific primers
in fallopian tubes and ovaries samples from a cohort
of 20 women at HR of developing EOC and 10 con-
trol women. We chose highly specific primers and
optimized the PCR conditions such that there was
no cross reactivity with other HPV types and secondary
amplifications were absent (data not shown). PCR
of control material did not suggest the presence
of confounding factors or contamination. Moreover,
in all cases, the β-globin gene was clearly amplified,
indicating an adequate DNA isolation from samples.
Negative controls consistently yielded no detectable
bands, whereas positive controls showed distinctive
bands (Figure).
1
300 bp — HPV 18
β-globin
HPV 16
β-globin
200 bp —
300 bp —
200 bp —
MW - Pos 2 3 4 5 6
1MW -Pos 2 3 4 5 6 7 8 9 10 11
Figure. HPV E6 specific PCR on genomic DNAs isolated
from formalin fixed and paraffinized fallopian tubes and ova-
rian tissue sections as templates. The products were sepa-
rated on a 2% agarose gel and stained with ethidium bromide.
The marker is marked as MW; lines 1–4, 6, 7 represent the ampli-
fication products for HPV 16, lower panel. Lines 5, 8–11 represent
HPV 16 negative samples. Lines 4 and 6 represent amplification
products for HPV 18, upper panel. Lines 1–3 and 5 represent
HPV 18 negative samples. The control for each of these samples
was 224bp β-globin and is shown. Negative control (water for
PCR) and positive control using genomic DNA either from freshly
cultured CasKi or HeLa cells are shown
When we analyzed each cohort separately,
surprising differences were found. In the control
patients cohort consisting of 10 samples, only one
ovarian sample (10%) tested positive for HPV 16, rest
of the control samples were negative for HPV 18 and
16 E6 ORF. In the 20 HR persons, a total of 8 (40%) pa-
tients tested positive for HPV 16 and 18 genomes (Ta-
ble). Two patients tested positive for HPV had BRCA
mutations. Of all the samples, two (10%) were positive
for HPV 16, two (10%) were positive for HPV 18, and
four (20%) showed positivity for mixed HPV 16/18 in-
fection. The fallopian tubes and ovaries on separate
blocks were available for all 20 HR patients. The pre-
sence of HPV E6 ORF was found both in the fallopian
Experimental Oncology 36, 121–124, 2014 (June) 123
tubes and ovarian DNA from 6 (30%) patients. In two
cases (10%) we detected HPV ORF only in the fallopian
tube derived genomic DNA.
Table. The frequency of HPV infection types 16 and 18 in the upper geni-
tal tract of women at HR of developing EOC
HPV type HR patients,
n (%)
Specimens from HR patients, n (%)
Fallopian tubes Fallopian tubes + ovaries
HPV 16 2 (10.0) 1 (5.0) 1 (5.0)
HPV 18 2 (10.0) 1 (5.0) 1 (5.0)
HPV 16/18 4 (20.0) 0 4 (20.0)
Total 8 (40.0) 2 (10.0) 6 (30.0)
DISCUSSION
The HR HPVs are critical etiologic factors for de-
velopment of malignancies in the lower female genital
tract [8]. The significance of HR HPVs in upper genital
tract, including ovarian cancer is controversial. There
has been variable frequency reported by various
groups regarding the presence or absence of HPV
in ovarian tissues and its putative role in cancer de-
velopment [10, 11]. There have also been recurrent
reports where viral sequences have been detected
in vessel endothelial cells adjacent to cervical and oral
cancers [17, 18]. In our previous study, PCR analysis
demonstrated HPV DNA in 17.0% (9 from 53) ovarian
serous carcinomas [19]. All HPV 16 and 18 DNA-po-
sitive OC tissues showed immunopositivity for E6 on-
coprotein, which was adjacent to peritumoral area
and was detected in glandular structures of ovarian
carcinomas. In our small subset of nine samples that
tested positive for diffused HPV E6 staining, we ob-
served an acute downmodulation of p53 expression.
Results from this current study show the pre-
sence of HR HPVs in the upper genital tract of women
at HR of developing EOC. The specific and sensitive
PCR assay developed in our labs could detect HPV
DNA derived from a very small number of contribu-
ting cells. The possibility of false positive was ruled
out with consistent and concordant results among
cross-technique and biological replicates (left
or right ovarian tissues and corresponding fallopian
tubes) and negative controls included in the study.
Quite interesting ly, we did detect HPV 16, 18 E6 ORF
in the upper genital tissues of HR cohort in a larger
proportion compared to previously reported ova rian
carcinomas [19]. However, one of the limitations
of this study was the small sample size and therefore
a higher than previously reported HPV positivity might
not reflect a true statistical distribution.
It is known that different subtypes of epithelial
ovarian carcinoma are associated with various genetic
and environmental risk factors and molecular events
during oncogenesis [20, 21]. In BRCA carriers can-
cer initiation may occur in the ovary, fallopian tube,
or peritoneum but tumor growth and progression are
favored in the ovary [22–24]. These results showing
the HPV infection clamber through the genital tract
may probably occur by a nonconventional mechanism
where endothelial cells possibly acquired whole viral
particles by phagocytosis and in turn presented them
to ovarian epithelial cells or other differentiating cells
of the upper genital tract where additionally to genetic
factors appears to be possible environmental modifier
of ovarian cancer risk in women at HR of developing
EOC. Enhanced opportunistic infectivity in women
with an inherent greater genomic instability is highly
possible. There are reports in the literature that Fan-
coni anemia patients have an inherent susceptibility
to human HPV-associated anogenital malignancies
including ovarian carcinoma [25, 26]. But we also need
to unequivocally establish this supposed mechanism
of HPV transmission in vivo using a three dimensional
organotypic culture model and genetic instability
of ovarian epithelial cells causing susceptibility to HPV
infection. Since our sample size was small, we need
to further confirm these results in a larger statistically
significant sample set.
ACKNOWLEDGEMENTS
This work was supported by the Fulbright In-
ternational Scholar Exchange program and in part
supported by the grant 011OU005761 “Fundamental
basis of molecular and cellular biotechnology” from
the National Academy of Sciences of Ukraine.
REFERENCES
1. Permuth-Wey J, Sellers TA. Epidemiology of ovarian
cancer. Methods Mol Biol 2009; 472: 413–37.
2. Holschneider CH, Berek JS. Ovarian cancer: epide-
miology, biology, and prognostic factors. Semin Surg Oncol
2000; 19: 3–10.
3. Salehia F, Dunfield L, Phillipsed KP, et al. Risk factors
for ovarian cancer: an overview with emphasis on hormonal
factors. J Toxicol Environm Health, Part B: Critical Reviews
2008; 11: 301–21.
4. Moyer VA, U.S. Preventive Services Task Force.
Risk assessment, genetic counseling, and genetic testing for
BRCA-related cancer in women: U.S. preventive services
task force recommendation statement. Ann Intern Med 2014;
160: 271–81.
5. Narod SA. Modifiers of risk of hereditary breast and
ovarian cancer. Nat Rev Cancer 2002; 2: 113–23.
6. Kovayashi H, Ohno S, Sasaki Y, Matsuura M. Heredi-
tary breast and ovarian cancer susceptibility genes (Review).
Oncol Rep 2013; 30: 1019–29.
7. Pejovic T, Yates JE, Liu HY, et al. Cytogenetic instability
in ovarian epithelial cells from women at risk of ovarian cancer.
Cancer Res 2006; 66: 9017–25.
8. zur Hausen H. Papilloma viruses in the causation
of human cancers — a brief historical account. Virology 2009;
384: 260–5.
9. Munoz N, Bosch FX, de Sanjosé S, et al. Epidemiologic
classification of human papilloma virus types associated with
cervical cancer. N Engl J Med 2003; 348: 518–27.
10. Svahn MF, Faber MT, Christensen J, et al. Prevalence
of human papilloma virus in epithelial ovarian cancer tissue.
A meta-analysis of observational studies. Acta Obstet Gynecol
Scand 2014; 93: 6–19.
11. Rosa MI, Silva GD, de Azedo Simoes PW, et al.
The prevalence of human papillomavirus in ovarian can-
cer: a systematic review. Int J Gynecol Cancer 2013; 23: 437–41.
12. Sapp M, Bienkowska-Haba M. Viral entry mecha-
nisms: human papillomavirus and a long journey from extra-
cellular matrix to the nucleus. FEBS J 2009; 276: 7206–16.
124 Experimental Oncology 36, 121–124, 2014 (June)
13. Doorbar J. Molecular biology of human papillomavirus
infection and cervical cancer. Clin Science 2006; 110: 525–41.
14. Demeret C, Le Moal M, Yaniv M, et al. Control
of HPV 18 DNA replication by cellular and viral transcription
factors. Nucl Acids Res 1995; 23: 4777–84.
15. Pett M, Coleman N. Integration of high-risk human
papillomavirus: a key event in cervical carcinogenesis? J Pathol
2007; 212: 356–67.
16. Ghittoni R, Accardi R, Hasan U, et al. The biological
properties of E6 and E7 oncoproteins from human papilloma
viruses. Virus Genes 2010; 40: 1–13.
17. Füle T, Máthé M, Suba Z, et al. The presence of human
papillomavirus 16 in neural structures and vascular endothelial
cells. Virology 2006; 348: 289–96.
18. D’anna R, Le Buanec H, Alessandr G, et al. Selective
activation of cervical microvascular endothelial cells by Hu-
man Papilloma virus 16-E7 oncoprotein. J Natl Cancer Inst
2001; 93: 1843–51.
19. Bilyk OO, Pande NT, Buchynska LG. Analysis of p53,
pRb and Cyclin D1 expression and human papillomavirus
in primary ovarian serous carcinomas. Exp Oncol 2011;
33: 150–6.
20. Li J, Fadare O, Xian L, et al. Ovarian serous car-
cinoma: recent concepts on its origin and carcinogenesis.
J Hematol Oncol 2012; 5 (8): doi: 10.1186/1756–8722–5-8.
21. Le ND, Leung A, Brooks-Wilson A, et al. Occupational
exposure and ovarian cancer risk. Cancer Causes Control
2014: doi: 10.1007/s10552–014–0384–4.
22. Lynch HT, Snyder C, Casey MJ. Hereditary ovarian
and breast cancer: what have we learned? Ann Oncol 2013;
8: 83–95.
23. Crum CP, Drapkin R, Kindelberger D, et al. Lessons
from BRCA: the tubal fimbria emerges as an origin for pelvic
serous cancer. Clin Med Res 2007; 5: 35–44.
24. George S, Shaw P. BRCA and early events in the de-
velopment of serous ovarian cancer. Front Oncol 2014;
4: doi: 10.3389/fonc.2014.00005.
25. Lowy DR, Gillison ML. A new link between Fanconi
anemia and human papilloma virus-associated malignancies.
J Nat Cancer Inst 2003; 95: 1648–50.
26. Kutler DI, Wreesmann VB, Goberdhan A, et al. Hu-
man papillomavirus DNA and p53 polymorphism in squamous
cell carcinomas from Fanconi anemia patients. J Natl Cancer
Inst 2003; 95: 1718–21.
Copyright © Experimental Oncology, 2014
|
| id | nasplib_isofts_kiev_ua-123456789-145342 |
| institution | Digital Library of Periodicals of National Academy of Sciences of Ukraine |
| issn | 1812-9269 |
| language | English |
| last_indexed | 2025-12-01T18:20:31Z |
| publishDate | 2014 |
| publisher | Інститут експериментальної патології, онкології і радіобіології ім. Р.Є. Кавецького НАН України |
| record_format | dspace |
| spelling | Bilyk, O.O. Pande, N.T. Pejovic, T. Buchynska, L.G. 2019-01-20T18:04:10Z 2019-01-20T18:04:10Z 2014 The frequency of human papilloma virus types 16, 18 in upper genital tract of women at high risk of developing ovarian cancer / O.O. Bilyk, N.T. Pande, T. Pejovic, L.G. Buchynska // Experimental Oncology. — 2014. — Т. 36, № 2. — С. 121-124. — Бібліогр.: 26 назв. — англ. 1812-9269 https://nasplib.isofts.kiev.ua/handle/123456789/145342 Aim: To investigate the incidence of human papilloma virus (HPV) types 16, 18 in upper genital tract of women considered at a high risk (HR) of developing epithelial ovarian cancer (EOC). Methods: HPV 16 and 18 E6 ORF specific semiquantitative PCR was used to screen the incidence of HPV in 20 women at HR of developing EOC and 10 women with no ovarian disease (control). Results: The HR subset of fallopian tubes and ovarian tissues showed greater positivity for HPV E6 ORF (40%) as compared to control (10%) tissues. Of all the samples, two (10%) were positive for HPV 16, two (10%) were positive for HPV 18, and four (20%) showed positivity for mixed HPV 16/18 infection. The presence of HPV E6 ORF was found both in the fallopian tubes and ovarian DNA from 6 (30%) patients. In two cases (10%) we detected HPV ORF only in the fallopian tube derived genomic DNA. Conclusion: It has been shown the presence of HPV in the upper genital tract in women at HR of developing EOC in close proximity of HPV susceptible tissue cervix. Key Words: HPV, high risk of ovarian cancer. This work was supported by the Fulbright International Scholar Exchange program and in part supported by the grant 011OU005761 “Fundamental basis of molecular and cellular biotechnology” from the National Academy of Sciences of Ukraine. en Інститут експериментальної патології, онкології і радіобіології ім. Р.Є. Кавецького НАН України Experimental Oncology Original contributions The frequency of human papilloma virus types 16, 18 in upper genital tract of women at high risk of developing ovarian cancer Article published earlier |
| spellingShingle | The frequency of human papilloma virus types 16, 18 in upper genital tract of women at high risk of developing ovarian cancer Bilyk, O.O. Pande, N.T. Pejovic, T. Buchynska, L.G. Original contributions |
| title | The frequency of human papilloma virus types 16, 18 in upper genital tract of women at high risk of developing ovarian cancer |
| title_full | The frequency of human papilloma virus types 16, 18 in upper genital tract of women at high risk of developing ovarian cancer |
| title_fullStr | The frequency of human papilloma virus types 16, 18 in upper genital tract of women at high risk of developing ovarian cancer |
| title_full_unstemmed | The frequency of human papilloma virus types 16, 18 in upper genital tract of women at high risk of developing ovarian cancer |
| title_short | The frequency of human papilloma virus types 16, 18 in upper genital tract of women at high risk of developing ovarian cancer |
| title_sort | frequency of human papilloma virus types 16, 18 in upper genital tract of women at high risk of developing ovarian cancer |
| topic | Original contributions |
| topic_facet | Original contributions |
| url | https://nasplib.isofts.kiev.ua/handle/123456789/145342 |
| work_keys_str_mv | AT bilykoo thefrequencyofhumanpapillomavirustypes1618inuppergenitaltractofwomenathighriskofdevelopingovariancancer AT pandent thefrequencyofhumanpapillomavirustypes1618inuppergenitaltractofwomenathighriskofdevelopingovariancancer AT pejovict thefrequencyofhumanpapillomavirustypes1618inuppergenitaltractofwomenathighriskofdevelopingovariancancer AT buchynskalg thefrequencyofhumanpapillomavirustypes1618inuppergenitaltractofwomenathighriskofdevelopingovariancancer AT bilykoo frequencyofhumanpapillomavirustypes1618inuppergenitaltractofwomenathighriskofdevelopingovariancancer AT pandent frequencyofhumanpapillomavirustypes1618inuppergenitaltractofwomenathighriskofdevelopingovariancancer AT pejovict frequencyofhumanpapillomavirustypes1618inuppergenitaltractofwomenathighriskofdevelopingovariancancer AT buchynskalg frequencyofhumanpapillomavirustypes1618inuppergenitaltractofwomenathighriskofdevelopingovariancancer |