Application of serex-analysis for identification of human colon cancer antigens

Background: Colorectal, lung and breast tumors are the most devastating and frequent malignances in clinical oncology. SEREX-analysis of colon cancer leads to identification of more than hundred antigens which are potential tumor markers. With idea that immunoscreening with pool of allogeneic sera i...

Ausführliche Beschreibung

Gespeichert in:
Bibliographische Detailangaben
Veröffentlicht in:Experimental Oncology
Datum:2015
Hauptverfasser: Garifulin, O.M., Kykot, V.O., Gridina, N.Y., Kiyamova, R.G., Gout, I.T., Filonenko, V.V.
Format: Artikel
Sprache:Englisch
Veröffentlicht: Інститут експериментальної патології, онкології і радіобіології ім. Р.Є. Кавецького НАН України 2015
Schlagworte:
Online Zugang:https://nasplib.isofts.kiev.ua/handle/123456789/145484
Tags: Tag hinzufügen
Keine Tags, Fügen Sie den ersten Tag hinzu!
Назва журналу:Digital Library of Periodicals of National Academy of Sciences of Ukraine
Zitieren:Application of serex-analysis for identification of human colon cancer antigens / O.M. Garifulin, V.O. Kykot, N.Y. Gridina, R.G. Kiyamova, I.T. Gout, V.V. Filonenko // Experimental Oncology. — 2015. — Т. 37, № 3. — С. 173-180. — Бібліогр.: 46 назв. — англ.

Institution

Digital Library of Periodicals of National Academy of Sciences of Ukraine
_version_ 1860169351543390208
author Garifulin, O.M.
Kykot, V.O.
Gridina, N.Y.
Kiyamova, R.G.
Gout, I.T.
Filonenko, V.V.
author_facet Garifulin, O.M.
Kykot, V.O.
Gridina, N.Y.
Kiyamova, R.G.
Gout, I.T.
Filonenko, V.V.
citation_txt Application of serex-analysis for identification of human colon cancer antigens / O.M. Garifulin, V.O. Kykot, N.Y. Gridina, R.G. Kiyamova, I.T. Gout, V.V. Filonenko // Experimental Oncology. — 2015. — Т. 37, № 3. — С. 173-180. — Бібліогр.: 46 назв. — англ.
collection DSpace DC
container_title Experimental Oncology
description Background: Colorectal, lung and breast tumors are the most devastating and frequent malignances in clinical oncology. SEREX-analysis of colon cancer leads to identification of more than hundred antigens which are potential tumor markers. With idea that immunoscreening with pool of allogeneic sera is more productive for antigen isolation, SEREX-analysis was applied to four cases of stages II–IV primary colon tumor and 22 new antigens were isolated. Objective: To characterize 22 primary colon cancer antigens isolated by SEREX-technique. Materials and Methods: Allogenic screening, real-time PCR analysis. Results: After allogeneic immunoscreening, for 5 of 22 (22%) isolated antigens were confirmed colon cancer restricted serological profile solely positive for 14% of tested colon cancer sera. Through these five antigens, KY-CC-17/β-actin has cytoskeleton function; KY-CC-14/ACTR1A and KY-CC-19/TSGA2 participate in chromosome segregation; KY-CC-12/FKBP4 regulates steroid receptor function and KY-CC-15/PLRG1 is a component of spliceosome complex. For the last four antigens tested were found aberrant mRNA expression in some cases of colon tumor. Conclusion: The exploration of identified antigens may define suitable targets for immunotherapy or diagnostic of colon cancer. Key Words: colon cancer, SEREX-analysis, allogeneic immunoscreening.
first_indexed 2025-12-07T17:58:13Z
format Article
fulltext Experimental Oncology 37, 173–180, 2015 (September) 173 APPLICATION OF SEREX-ANALYSIS FOR IDENTIFICATION OF HUMAN COLON CANCER ANTIGENS O.M. Garifulin1, V.O. Kykot2 , N.Y. Gridina1, R.G. Kiyamova1,3*, I.T. Gout4, V.V. Filonenko1 1Institute of Molecular Biology and Genetics, NAS of Ukraine, Kyiv 03143, Ukraine 2National Cancer Institute, Kyiv 03022, Ukraine 3Institute of Fundamental Medicine and Biology, Kazan Federal University, Kazan 420008, Russian Federation 4Department of Biochemistry and Molecular Biology, Royal Free and University College Medical School, Cower Street, London WC1E 6BT, United Kingdom Background: Colorectal, lung and breast tumors are the most devastating and frequent malignances in clinical oncology. SEREX-analy- sis of colon cancer leads to identification of more than hundred antigens which are potential tumor markers. With idea that immunoscreen- ing with pool of allogeneic sera is more productive for antigen isolation, SEREX-analysis was applied to four cases of stages II–IV pri- mary colon tumor and 22 new antigens were isolated. Objective: To characterize 22 primary colon cancer antigens isolated by SEREX- technique. Materials and Methods: Allogenic screening, real-time PCR analysis. Results: After allogeneic immunoscreening, for 5 of 22 (22%) isolated antigens were confirmed colon cancer restricted serological profile solely positive for 14% of tested colon cancer sera. Through these five antigens, KY-CC-17/β-actin has cytoskeleton function; KY-CC-14/ACTR1A and KY-CC-19/TSGA2 par- ticipate in chromosome segregation; KY-CC-12/FKBP4 regulates steroid receptor function and KY-CC-15/PLRG1 is a component of spliceosome complex. For the last four antigens tested were found aberrant mRNA expression in some cases of colon tumor. Conclusion: The exploration of identified antigens may define suitable targets for immunotherapy or diagnostic of colon cancer. Key Words: colon cancer, SEREX-analysis, allogeneic immunoscreening. Colon cancer as frequent case of colorectal tumors along with lung and breast tumors are a significant cause of morbidity and mortality in Western popula- tions associated with a high risk of metastases, recur- rence, and early patient death. Colon cancer formation through adenoma to adenocarcinoma and later to its metastatic counterpart involved a multistep cell pro- cesses those may associated with aberrant expression of hundreds of genes [1, 2]. It was a long-standing challenge in cancer research if tumor cells proteins may specifically recognized as self-antigens (tumor associated antigens — TAAs) by patient’s immune system. Immunologic methods such as T cell epitope cloning [3] and recently emerged as a powerful me- thod for identification of TAAs serological expression cloning (SEREX) [4] applied to different tumors have led to the discovery of a subset of antigens recognized by CTLs and/or by humoral system in tumor-specific manner [5]. TAAs often represent genes with altered normal expression, oncogene i.e. overexpressed or with activity in tumor cells (activated only in neo- plastic cells and silence in normal cells, overexpressed in tumor cells, mutated genes), those can predict its possible association with tumorigenesis [6]. Several tumor-specific antigens such as NY-ESO-1, MAGE-1, MAGE-3, SSX2, Melan-A, and tyrosinase proteins are promising sensitive and specific target molecules for cancer screening and diagnosis, cancer immuno- therapy and development of antigen-specific cancer vaccines [7–9]. In recent years a subset of TAAs reacted exclu- sively or much higher frequently with sera from colon cancer patients were uncovered by SEREX-analysis of colon primary tumors as well as colon cancer cell lines and colon tumor metastasis [10–12]. As it was showed, a frequency of TAAs for human primary colon tumors is more rare than it was found for its metasta- ses. It is possible that patients with metastasis may have a more augmented IgG response than patients with original tumor [11]. Therefore, SEREX-analysis of primary colon cancer may define new TAAs useful for early tumor diagnosis and immunotherapy inter- vention. Previously we described of immunogeni city of newly identified colon cancer antigens in sera of patients of different types of tumors [13]. Here we describe identification of these TAAs by SEREX methodology in more detail and characterize in terms of gene identity, tumor-specific immunogenicity and expression in normal colon and colon tumor tissues. MATERIALS AND METHODS Tissue samples. The colon primary tumor sam- ples were obtained from the National Cancer Institute (Kyiv, Ukraine) as surgical specimens, frozen in liquid nitrogen and stored at −80 °C. The histological clas- sification of tumors was confirmed by histopathological examination at the Department of Pathology, National Cancer Institute (Kyiv, Ukraine). Tumor serum samples were obtained at the same Institute from 20 patients (35–62 years old) including sera samples from 14 co- lon cancer patients and 6 gastric cancer patients. Control sera were obtained from 18 individuals with no evidence of malignancy (27–62 years old). All Submitted: August 05, 2015. *Correspondence: E-mail: r.g.kiyamova@imbg.org.ua Abbreviations used: SEREX — method of identification of human tumor antigens by serological expression cloning; TAAs — tumor- associated antigens. Exp Oncol 2015 37, 3, 173–180 ORIGINAL CONTRIBUTIONS 174 Experimental Oncology 37, 173–180, 2015 (September) sera samples were processed in the same way and stored with 50% glycerol at −20 °C. Consent forms were obtained from all patients. The study protocol was approved by the Ethics Committee of the Institute of Molecular Biology and Genetics. mRNA preparation and construction of cDNA libraries. Normal colon and colon primary tumor samples were obtained as surgical specimens and frozen in liquid nitrogen with following storage at −80 °C. Total RNA was prepared by the guanidinium thiocyanate method [14], and mRNA was puri- fied by the Dynabeads Oligo(dT)25 kit (Dynal, Oslo, Norway). 5 ug of mRNA was used for construction of oligo(dT)-primed double-stranded cDNA ligated into the lambda ZAP II expression vector (Stratagene, La Jolla, CA). A total of four cDNA libraries were con- structed with titers of 1–3•106, and the average inserts size of 1.2–1.5 kb (Table 1). Table 1. Colon cancer cDNA libraries analyzed by SEREX cDNA Library Colon tumor (histology; stage) Titer Serum type Clones scree- ned Posi- tive clones Ge- nes 1C Poorly differentiated, metastases in lymph nodes; stage IV 2×105 Autologous 2×105 5 2 2C Moderately differen- tiated, lymph node hyperplasia; stage III 2×106 Autologous 2.5×105 3 2 3C Moderately differen- tiated; stage II 1×105 Autologous 1×105 1 1 4C Moderately differen- tiated; stage III 0.2×105 Allogene- ic (pool of 6 sera from stages II–IV colon cancer pa- tients) 0.2×105 37 17 Total 46 22 Immunoscreening. Sera used for immuno- screening were stored at −20 °C with 50% glycerol. In order to remove antibodies reactive with the vector system sera prior to immunoscreening were diluted at 1:10 in TBS and absorbed through overnight incuba- tion at 4 °C with Sepharose 4B (Pharmacia, Uppsala, Sweden) coupled to lysates from E. coli XL1 and lamb- da ZAP II-infected E. coli XL1 synthesized as described previously [15]. Final sera dilutions (1:100) were pre- pared in TBS with 0.2% non-fat dried milk (Marwell, England) and 0.01% NaN3 as preservative. The cDNA libraries were not amplified prior to immunoscreening procedure. Immunoscreening of cDNA libraries was performed as described [10], except recombinant phage plated at concentration of 104/15 cm plate. Allogeneic immunoscreening of positive clones was developed with sera dilution at 1:100 as de- scribed [10]. Serum reactivity was detected with the alkaline phosphatase substrate, 4-nitro blue tetrazo- lium chloride/5-bromo-4-chloro-3-indolylphosphate (Sigma, St. Louis, MO, USA). Serum was considered as reactive when positive staining was observed during immunoscreening. DNA Sequencing. Monoclonalized phage cDNA clones were converted to pBluescript phagemids by in vivo excision according to user manual (Stratagene, La Jolla, CA, USA). The cDNA inserts were sequenced with universal M13mp18 primer using the DYEnamic ET Terminator Cycle Sequencing Kit ( Amersham Bio- sciences, Buckinghamshire, England) and ABI Prism automated DNA sequencer (Perkin Elmer, Norwalk, CT). RT-PCR analysis. PCR primers (Invitrogen, Paisley, Scotland) with melting temperature between 60–65 °C were designed to amplify cDNA fragments of 400–500 bp represented adjacent exons of cor- respondent genes in order to check possible genomic DNA contamination in PCR product bands. The integrity of synthesized cDNAs was determined by the amplifica- tion of β-actin. RT-PCR was performed using HotStarTag DNA polymerase (Qiagen, GmbH, Germany) with 35 cy- cles of 1 min at 94 °C, 1 min at 65 °C, and 1 min at 72 °C, followed by 7 min at 72 °C. The sequences of primers used for amplification were as follows: KY-CC-8: forward, 5´CAGCGTTATTCTCATTGCCTG; reverse, 5´CTCCACT- GACATCTTCCATTG; KY-CC-12: forward, 5´CAGAAGGTC- CTGCAGCTCTAC; reverse, 5´GATGGACATATGTTCAT- GTGC; KY-CC-14: forward, 5´GACAGGCTCCTGAGT- GAAGTG; reverse, 5´CCTAGGATGGTCAGCAGCAAG; KY-CC-15: forward, 5´TTATACGGCATTATCATGGAC; reverse, 5´AAGATGCATGGTGCCATTGTC; KY-CC-19: forward, 5´ACGGCCGAGCTCATTCACCTG; reverse, 5´TCTCGGCTCACTTCATCTTAG. Real-time RT-PCR. For real-time RT-PCR were used 6 normal colon cDNAs and 9 colon cancer cDNAs with the same primer pairs combination as described above. Thermal cycling and fluorescent monitoring were performed using an ABI7700 Sequence Analyzer (Applied Biosystems, Foster City, CA, USA). As endo- genous control was used β-actin. Triplicate PCR reac- tions were prepared for each cDNA sample with SYBR Green I PCR mix (Qiagen, GmbH, Germany). PCR consisted of 40 cycles of 94 °C denaturation (1 min), 65 °C annealing (1 min), and 72 °C extension (1 min) with following denaturation at 65–94 °C for 20 min to determine PCR products melting curve. The point at which a PCR product is first detected above a fixed threshold (Ct) was determined for each sample, and the average of triplicate samples was calculated. Respective Ct va lues were normalized (ΔCt) by sub- tracting the Ct value obtained for β-actin control. For 6 normal colon cDNA samples normalized ΔCt was calculated as the mean value. The relative concentra- tions of genes-specific mRNAs in colon cancer cDNAs compare to normal colon tissue (ΔΔCt) were calcu- lated by subtracting the normalized mean ΔCt value obtained for normal colon cDNAs from those obtained with 9 colon tumor samples (ΔΔCt = ΔCt of tumor — ΔCt of normal colon), and the relative concentration was determined as 2-ΔΔCt. RESULTS SEREX defined cDNAs clones. Immunoscre ening of the four primary colon cancer cDNA expression li- braries with autologous or allogeneic serums produced a total of 48 serum-positive clones. Sequence analysis Experimental Oncology 37, 173–180, 2015 (September) 175 of cDNAs from isolated clones revealed 22 different genes those have been deposited at LICR SEREX data- base (http://www.licr.org/SEREX.html) under KY-CC- 1-KY-CC-22 designation. For libraries 1C-3C screened with autologous serums were isolated 9 clones those represent 5 different genes. For library 4C screened with pool of 6 allogeneic sera obtained from colon cancer (stages II–IV) patients were isolated 37 clones those represent 17 different genes. The largest proportion of antigens has been isolated during allogeneic im- munoscreening of library 4C in contrast to the other free libraries screened with autologous serums (see Table 1). All of isolated antigens, except KY-CC-20 are genes with known function (Table 2). Searching for homology to previously SEREX-defined genes at LICR SEREX database (http://www.licr.org/SEREX.html) revealed that 6 (KY-CC-2, 5, 6, 15, 16, 21) through 22 antigens isolated at this work have been identi- fied previously in different tumors and only KY-CC-16, 21 found for colon cancer. Despite as much as five libraries have been analyzed, SEREX-defined clones were unique for each immunoscreened library (see Table 2). Analysis of antigen’s molecular functions showed that at least 8 antigens are involved in the re- alisation of the genetic information (KY-CC-1/RPL18, KY-CC-2/se2–2, KY-CC-5/EEF1A1, KY-CC-8/BRCA2, KY-CC-13/RPLP0, KY-CC-15/PLRG1, KY-CC-18/ GNB2L1, KY-CC-22/TRIP11) (see Table 2). The 7 anti- gens participate in cell proliferation, development and apoptosis (KY-CC-7/PDAP1, KY-CC-8/BRCA2, KY- CC-10/TRIM2, KY-CC-11/BTN3A3, KY-CC-18/GNB2L1, KY-CC-19/TSGA2, KY-CC-21/UACA), other 2 (KY-CC-3/ COX1, KY-CC-4/TALDO1) revealed metabolic activity, 6 antigens (KY-CC-9/CXCR4, KY-CC-11/BTN3A3, KY- CC-12/FKBP4, KY-CC-16/BRAP, KY-CC-18/GNB2L1, KY-CC-22/TRIP11) are involved in cell signalling and 5 antigens (KY-CC-6/COL1A1, KY-CC-12/FKBP4, KY- CC-14/ACTR1A, KY-CC-16/BRAP, KY-CC-17/ACTB) participate in restructuring of the cytoskeleton and cell adhesion (see Table 2). It should be noted that some antigens at least KY-CC-8/BRCA2, KY-CC-11/BTN3A3, KY-CC-12/FKBP4, KY-CC-18/GNB2L1 and KY-CC-22/ Table 2. Characterization of antigens identified by immunoscreening of colon cancer cDNA expression libraries Antigen Gene homology Molecular Function KY-CC-1/RPL18 Ribosomal protein L18 (RPL18) RNA synthesis. Part of the 60S ribosomal subunit KY-CC-2/se2–2 CEP290 gene, Aliase CTCL tu- mor antigen se2–2 Part of the tectonic-like complex which is required for tissue-specific ciliogenesis and may regulate ciliary membrane composition. Activates ATF4-mediated transcription KY-CC-3/COX1 Cytochrome c oxidase subunit I (COX1) Cytochrome c oxidase is the component of the respiratory chain that catalyzes the reduction of oxy- gen to water KY-CC-4/TALDO1 Transaldolase 1 (TALDO1) The key enzyme of the pentose phosphate pathway and important for the balance of metabolites in the pentose-phosphate pathway KY-CC-5/EEF1A1 Translation elongation factor 1 alpha 1 (EEF1A1) Promotes the GTP-dependent binding of aminoacyl-tRNA to the A-site of ribosomes during protein biosynthesis KY-CC-6/COL1A1 Collagen, type I, alpha 1 (COL1A1) The collagen type I, alpha 1, play role in fibril forming, putative downregulated c-Myc target gene KY-CC-7/PDAP1 PDGFA associated protein 1 (PDAP1) Enhances PDGFA-stimulated cell growth in fibroblasts, but inhibits the mitogenic effect of PDGFB KY-CC-8/BRCA2 BRCA2 region, mRNA se- quence CG016 Important for cell cycle control and DNA repair through homologous recombination, also involved in embryonic cellular proliferation KY-CC-9/CXCR4 Chemokine (C-X-C motif), re- ceptor 4 (fusin) (CXCR4) Receptor for the CХC chemokine. Acts as a receptor for extracellular ubiquitin. Involved in hemato- poiesis, cardiac ventricular septum formation and mediates LPS-induced inflammatory response KY-CC-10/TRIM2 Tripartite motif-containing 2 (TRIM2) UBE2D1-dependent E3 ubiquitin-protein ligase that mediates the ubiquitination of NEFL and of phosphorylated BCL2L11. Plays a neuroprotective function KY-CC-11/BTN3A3 Butyrophilin, subfamily 3, mem- ber A3 (BTN3A3) Plays a role in T-cell responses in the adaptive immune response. Also, the proteins of this family play role in cell proliferation and development KY-CC-12/FKBP4 FK506 binding protein 4 (59kD) (FKBP4) Immunophilin protein with PPIase and co-chaperone activities. Component of steroid receptors hete rocomplexes through interaction with heat-shock protein 90 (HSP90). Acts also as a regulator of microtubule dynamics KY-CC-13/RPLP0 Ribosomal protein, large, P0 (RPLP0) Ribosomal protein (60S) is the functional equivalent of E. coli protein L10 KY-CC-14/ACTR1A ARP1 actin-related protein 1 homolog A, centractin alpha (yeast) (ACTR1A) Component of a multi-subunit complex involved in microtubule based vesicle motility. It is associ- ated with the centrosome KY-CC-15/PLRG1 Pleiotropic regulator 1 (PRL1 homolog) (PLRG1) Component of the PRP19-CDC5L complex that forms an integral part of the spliceosome and is re- quired for activating pre-mRNA splicing KY-CC-16/BRAP BRCA1 associated protein (BRAP) Negatively regulates MAP kinase activation by limiting the formation of Raf/MEK complexes proba- bly by inactivation of the KSR1 scaffold protein. May also act as a cytoplasmic retention protein with a role in regulating nuclear transport KY-CC-17/ACTB Actin, beta (ACTB) Actins are highly conserved proteins that are involved in various types of cell motility and are ubiqui- tously expressed in all eukaryotic cells KY-CC-18/GNB2L1 Guanine nucleotide binding protein (G protein), beta poly- peptide 2-like 1 (GNB2L1) Involved in the recruitment, assembly and/or regulation of a variety of signaling molecules and plays a role in many cellular processes. It is a part of the 40S ribosomal subunit KY-CC-19/TSGA2 H. sapience testes specific A2 homolog (mouse) (TSGA2) May play an important role in male meiosis (By similarity). It is necessary for proper building of the axonemal central pair and radial spokes KY-CC-20/IM- AGE:4893383 EST: IMAGE: 4893383 No data available for molecular function KY-CC-21/UACA Uveal autoantigen with coiled- coil domains and ankyrin re- peats (UACA) Regulates APAF1 expression and plays an important role in the regulation of stress-induced apop- tosis. Promotes apoptosis by regulating three pathways, apoptosome up-regulation, LGALS3/galec- tin-3 down-regulation and NF-kappa-B inactivation KY-CC-22/TRIP11 TRIP11 H. sapiens thyroid hor- mone receptor interactor 11 Binds the ligand binding domain of the thyroid receptor (THRB) in the presence of triiodothyronine and enhances THRB-modulated transcription. Golgi auto-antigen 176 Experimental Oncology 37, 173–180, 2015 (September) TRIP11exhibit multiple functions and were classified in different categories. Allogeneic immunoscreening of SEREX-de- fined antigens. In order to determine colon cancer related serological profile of identified antigens alloge- neic immunoscreening have been performed with sera obtained from 14 colon cancer and 6 gastric tract cancer patients, as well as 18 healthy donors. Eight of 22 tested antigens reacted with both normal and cancer sera samples; two antigens were positive only for normal sera; seven antigens showed no reaction with any sera and five antigens solely positive only for colon cancer sera (Table 3). For some antigens reacted with cancer and normal sera previously showed their association with au- toimmune, inflammatory-related or non-cancerous (viral) diseases (see Table 3). In addition, KY-CC-1/RPL18, KY-CC-8/CG016, KY-CC-18/GNB2L1 and KY-CC-22/ FLJ20542 may represent novel tumor-independent occurring autoantigens firstly isolated in this work. KY-CC-21/UACA, KY-CC-18/GNB2L1 and KY-CC-6/ COL1A1 autoantigens revealed the highest percentage reactivity with both normal and cancer serums tested, ranging from 29% to 100% (see Table 3). Five antigens with colon-cancer specific serological profile, namely KY-CC-12/FKBP4, KY-CC-14/ACTR1A, KY-CC-15/ PLRG1, KY-CC-19/TSGA2, KY-CC-17/β-actin were reac- ting totally for 14% of tested colon cancer sera samples (Table 4). Through these antigens only KY-CC-15/ PLRG1 was previously identified by SEREX-analysis in hepatocellular carcinoma (data unpublished), for the others have not been documented their reactivity with any tumor patients sera. Table 3. SEREX-defined antigens with not colon cancer related serological profile Antigen Serum reactivity (number of positive sera/number of sera analysed) Association with autoimmune dise ase2/refe- rence Colon tumor1 Gastrict tract tu- mor Healthy donors KY-CC-1/RPL18 1/14 0/6 1/18 No data KY-CC-2/se2–2 0/14 2/6 1/18 No data KY-CC-3/COX1 0/14 0/6 0/18 HT [16] KY-CC-4/TALDO1 0/14 0/6 0/18 MS [17] KY-CC-5/EEF1A1 2/14 0/6 3/18 No data KY-CC-6/COL1A1 12/12 NT 11/11 PBC [18], AP [19] KY-CC-7/PDAP1 0/14 0/6 0/18 No data KY-CC-8/CG016 1/14 0/6 1/18 No data KY-CC-9/CXCR4 0/14 0/6 0/18 No data KY-CC-10/TRIM2 0/14 0/6 0/18 No data KY-CC-11/BTN3A3 0/14 0/6 0/18 MS [20] KY-CC-13/RPLP0 0/14 0/6 1/18 SLE [21] KY-CC-16/BRAP 0/14 0/6 0/18 No data KY-CC-18/GNB2L1 5/9 NT 9/11 No data KY-CC-20/IMAGE:4893383 1/7 NT 2/11 No data KY-CC-21/UACA 5/14 1/6 5/18 Panuveitis [22] KY-CC-22/FLJ20542 1/14 0/6 2/18 No data Note: 1Data of serum reactivity not include reactivity with autologous or pool of allogeneic sera used for initial SEREX-analysis. 2Abbreviations: PBC — pri- mary biliary cirrhosis; AP — adult periodontitis; MS — multiple sclerosis; SLE — systemic lupus erythematosus; HT — Hashimoto’s thyroiditis. mRNA expression profile of serologically de- fined colon cancer specific antigens. KY-CC-12/ FKBP4, KY-CC-14/ACTR1A, KY-CC-15/PLRG1 and KY-CC-19/TSGA2 defined by allogeneic immuno- screening as colon cancer specific antigens were tested RT-PCR and real-time RT-PCR for 6 normal colon cDNAs and 9 colon cancer cDNAs. Antigens tested by RT-PCR were positive for all co- lon cancer cDNAs; KY-CC-15/PLRG1 and KY-CC-19/ TSGA2 were positive for all 6 normal colon cDNAs, therefore KY-CC-12/FKBP4 and KY-CC-14/ACTR1A were positive only for 4 normal colon cDNAs and very weak bands observed for these genes for the other 2 normal colon cDNAs (data not shown). The rela- tionship between tested antigens mRNA expression levels and serological reactivity was not examined for respective colon cancer patients due to their sera were not available for typing. According to the result of real-time RT-PCR, KY- CC-14/ACTR1A mRNA showed increased expression level at 2.5–7.7 times for 8 through 9 tested colon can- cer cDNAs compare to normal colon (Figure, a). So, KY- CC-14/ACTR1A may have slightly upregulated mRNA expression level as mean at 3.5 times in colon tumors. KY-CC-19 0.1 1.0 10.0 100.0 1 2 3 4 5 6 7 8 9 Colon cancer cDNAs Fo ld c ha ng e KY-CC-15 0.1 1.0 10.0 100.0 1 2 3 4 5 6 7 8 9 Colon cancer cDNAs Fo ld c ha ng e KY-CC-14 1 2 3 4 5 6 7 8 1 2 3 4 5 6 7 8 9 Colon cancer cDNAs Fo ld c ha ng e KY-CC-12 0.01 0.10 1.00 10.00 1 2 3 4 5 6 7 8 9 Colon cancer cDNAs Fo ld c ha ng e a c b d Figure. Real-time RT-PCR results for relative expression level of identified colon cancer related antigens in 9 tested colon cancer cDNA samples. Expression level of antigens in normal colon referred as 1 in all cases KY-CC-15/PLRG1 and KY-CC-19/TSGA2 showed heterogeneous mRNA expression profile in colon tumor samples with exceptionally high levels of transcripts com- pare to normal colon associated with the colon cancer case N7 (80 and 88 times elevation, correspondently) (Figure, b, c). KY-CC-19/TSGA2 mRNA expression also increased at 7 times in tumor case N3 and at 10 times in tumor case N9, despite for colon cancer cases NN 1, 2, 4, 5, 8 its normal expression down regulated at 2–3.5 times (Figure, b). KY-CC-15/PLRG1 mRNA in addition to tumor case N7 have slightly increased ex- pression at 3 times in tumor case N3 and near the same level of expression compare to normal colon in tumor Experimental Oncology 37, 173–180, 2015 (September) 177 cases NN 1, 2, 4, 5, 6, 8, 9 (difference range at 0.48–1.96) (Figure, c). KY-CC-15/PLRG1 and KY-CC-19/TSGA2 rep- resent the genes with selective activation of normal expression in some cases of colon cancer and may be immunogenic as aberrantly expressed. By real-time RT-PCR result KY-CC-12/FKBP4 mRNA normal expression down regulated at 11–25 times in tu- mor cases NN 2, 3, 8 and at 3.1 and 3.7 times in tumor cases NN 4, 6, respectively (Figure, d). In the others four cases of tested tumors, KY-CC-12/FKBP4 mRNA expression was near at the same range (difference at 0.7–1.2 times) as in normal colon. KY-CC-12/ FKBP4 showed a great down regulation of normal ex- pression in approximately of ⅓ of colon cancer cases. DISCUSSION Utilization of SEREX-analysis led to identification of a broad spectrum normal and tumor sera IgG reactive proteins currently consisted of over 2000 enters at LICR SEREX database (http://www.licr.org/SEREX.html). Exploration of these proteins in term of tumor-specific immunity discovered a subset of antigens as attrac- tive targets for cancer diagnosis and immunotherapy. It have been previously showed that primary colon tumors analyzed by SEREX methodology may display a small number antigens detected by autologous sera [10, 12], despite metastasis counterpart more productive for serum reactive clones [10]. Recently, application of SEREX-analysis to colon cancer cell lines and testis cDNA expression libraries immuno- screened with colon cancer patients allogeneic sera led to identification of about ten new antigens with colon tumor restricted serological profile. It is also has been found a decline in quantity of serum reactive anti- gens for colon tumor stages II–III patients sera [11, 13]. With idea that serum samples from tumor patients may differ by cancer-related IgG response and tumor con- sists a mix of different cells, not one cell line, we used for serological screening of one primary colon tumor cDNA expression library pool of 6 allogeneic sera along with autologous serum immunoscreening of the ot hers three synthesized tumor cDNA libraries [13]. Here we describe antigens isolated in more detail. Of isolated 22 different antigens the largest pro- portion (17 antigens) were derived from the cDNA expression library screened with pool of allogeneic sera. In contrast, only 5 antigens were obtained from the cDNA expression libraries screened with autologous sera (see Table 1). SEREX-defined an- tigens were unique for each cDNA library analyzed, i.e. no similar antigens have been found (see Ta- ble 2). For 16 of 22 SEREX-defined antigens there are no data about their immunogenecity in any type of cancer according to SEREX database data (http://www.licr.org/SEREX.html). So, it is possible that complete list of serum IgG reactive antigens for colon cancer should be far from completion and many other antigens can be isolated using for immuno- screening a pool of allogeneic sera those increases a chance to recognize a more primary colon tumor antigens. Antigens identified were characterized ac- cording their molecular functions and it was shown that the most of them are involved in the implementa- tion of the genetic information including replication, transcription, translation and reparation (see Table 2). Analysis of frequency of the allogeneic sera antibody response of healthy donors and colon cancer as well as gastric tract tumors patients to the 22 identified antigens showed that 5 (22%) antigens, namely KY- CC-12/FKBP4, KY-CC-14/ACTR1A, KY-CC-15/PLRG1, KY-CC-17/β-actin, KY-CC-19/TSGA2 have colon cancer-restricted serological profile. Except KY-CC-15/ PLRG1, previously identified by SEREX in hepatocellular carcinoma (data unpublished), the others four antigens are firstly isolated at this work and all solely positive for 14% of tested colon cancer allogeneic sera (Table 4). During allogeneic immunoscreening some antigens showed no reactivity with any type of sera tested (see Table 3). We suggest that using a more extended set of normal and cancer serum samples as well as mo- dernization of conditions for large-scale allogeneic immunoscreening should be this problem solving. Table 4. SEREX-defined antigens with colon cancer related serological profile Antigen Serum reactivity (number of positive sera/number of sera analysed) Previously isolated by SEREX in2 Colon tumor1 Gastrict tract tu- mor Healthy donorsTotal Reactive serum KY-CC-12/FKBP4 1/14 9 0/6 0/18 No data KY-CC-14/ACTR1A 1/14 9 0/6 0/18 No data KY-CC-15/PLRG1 1/14 8 0/6 0/18 Hepatocellular carcinoma KY-CC-17/β-actin 1/14 8 0/6 0/18 No data KY-CC-19/TSGA2 1/14 9 0/6 0/18 No data Note: 1Data of serum reactivity not include reactivity with autologous or pool of allogeneic sera used for initial SEREX-analysis. 2Data obtained at LICR SEREX database. We were surprised for housekeeping cytoskeletal protein β-actin identified as colon cancer antigen. Previously have been reported that some patients with type 1 autoimmune hepatitis have anti-actin an- tibody [23] and β-actin also a candidate autoantigen in autoimmune inner ear disease [24]. Therefore, recently was showed that the cause for the anti- actin immune response in medullary breast cancer (MCB) relates to the actin exposure on the surface of apoptotic MCB cells, allow this intracellular an- tigen to be exposed to the local humoral immune system [25]. We suggest that apoptosis or intensive necrosis of colon cancer cells may also provoke of hu- moral immune response to β-actin. As it was showed for the other housekeeping gene — ATP6S1, putative accessory unit of the vacuolar H+-ATPase complex, despite the broad tissue expression it may stimulate humoral responses in a significant proportion of mela- noma and non-small cell lung carcinoma patients treated by vaccination with irradiated autologous tumor cells without provoking clinical autoimmunity [26]. So, study of β-actin immunogenecity and au- toimmunity in different tumours patients may define it is usefulness for detection of apoptotic positive colon cancer variants or cancer treatment. 178 Experimental Oncology 37, 173–180, 2015 (September) As it has been recorded previously, immunogene- city of SEREX-defined antigens may depend on muta- tion and/or overexpression of correspondent genes in tumor cells those also can be contributed to tumor formation [6, 27]. Sequenced cDNAs for colon cancer- specific serum reactive clones have no any muta- tions according to comparison with relative matches in GenBank data. Real-time RT-PCR for KY-CC-12/ FKBP4, KY-CC-14/ACTR1A, KY-CC-15/PLRG1, KY- CC-19/TSGA2 revealed aberrant distribution its mRNA normal level in some tested colon cancer tissues that can made them implications in tumor etiologic and immunogenecity context. KY-CC-12/FKBP4 (FKBP52) belongs to a distinct group of structurally related immunophilins and par- ticipates in association with Hsp90 to form chaperoned mammalian steroid receptor complexes into a confor- mation that is optimal for binding hormone [28–30]. FKBP4 is expressed at varying levels in all human tis- sues as well as cultured cells tested and its expression is reduced in fibroblastic CCL39 mutant-transformed cells or cells able to grow in low serum-containing me- dium, suggesting that FKBP4 might participate in the negative feedback control to cell proliferation [31]. Also we found the reduction of FKBP4 mRNA expres- sion in colon tumor comparing to normal colon tissue (Figure, d). Due to one molecule of FKBP4 have stoi- chiometry in steroid receptor heterocomplexes with two molecules of hsp90 determined for glucocorticoid receptor [30, 32], progesterone receptor [33], and estrogen receptor [34] misbalance in this ratio due to decreasing in FKBP4 expression possible for colon cancer as well as increasing in heat shock proteins ex- pression reported for gastrointestinal tumors [35] may lead to appearance of nonfunctional steroid receptor. In case of ER-β those can mediated protective effects of estrogen replacement therapy and its protein ex- pression is markedly and specifically reduced in colon cancers compared to adjacent normal colon in vivo [36], process described above may be alternative way to in- activation of ER-β in ER-β positive colon cancer cells as more early event in molecular etiologic of this tumor. Down regulation of FKBP4 expression in colon cancer cells can disrupt normal protein processing for which multiple isoforms have been found [28], as well as con- centration in cell to form complex with hsp90 with fol- lowing generation of aberrant set of peptides presenting by MHC. Recently the same mechanism was proposed for down-regulated genes found by SEREX-analysis as immunogeneic antigens [11]. KY-CC-14/ACTR1A (actin-related protein 1 ho- molog A, centractin alpha (yeast)) is an actin-related protein, and is approximately 60% identical at the amino acid level to conventional actin. It comprises the most abundant 42.6 kD subunit in the dynactin complex involved in a diverse array of cellular functions, inclu- ding ER-to-Golgi transport, the centripetal movement of lysosomes and endosomes, spindle formation, chro- mosome movement, nuclear positioning, and axono- genesis [37]. We found for approximately half of tested colon tumors increasing of ACTR1A mRNA expression at 3–8 times compare to normal tissue (Figure, c), those can predict immunogenecity of correspondent protein. Recently have been found that dynactin complex may participate in maintaining of multicentric chromosomes during chromosome segregation in tumor cells [38]. So, ACTR1A may associated as one of many components for survival of cancer cells with multiple chromosome aberration. The next study of dynactin complex in tu- mor cells may define appropriated targets for therapy oriented on disruption of control mechanism aberrant chromosome segregation. KY-CC-19/TSGA2 represents protein, also known as RSPH1, is present in the sperm flagellum [39]. This protein is a homolog for mouse testes specific A2 pro- tein and has unknown function in the humans [40]. Mouse TsgA2, initially believed to be confined to the testis in male mice [41, 42]. TsgA2 have been iso- lated using testis-specific polyclonal antibodies from an expression cDNA library prepared from the mouse testis [41]. Immunohistochemical examination revealed TsgA2 specific association with the metaphase chro- mosomes and spindles suggesting that the protein plays important roles in male meiosis [41]. We found that KY-CC-19/TSGA2 mRNA expression in human not restricted only to reproductive tissues because it was found in testis, normal colon and colon tumors. In two through 9 colon tumors tested TSGA2 mRNA expression was elevated at about 10 times and for the other one at near 90 times compare to normal colon (Figure, a). Such overexpression of TSGA2 in some cases of colon tumors may be a reason for its immunogenecity. Ac- cording to postulated for TsgA2 important role in meta- phase chromosomes segregation it is also possible, as in case of ACTR1A, that multiple chromosome aber- ration in tumor cells require some specific modification in molecular machinery acted in cell division and human TSGA2 one of that for tumorgenesis process. KY-CC-15/PLRG1 represents human homolog to pleiotropic regulator 1 found in Arabidopsis [43]. The human proteins CDC5L (hCDC5) and PLRG1 are both highly conserved components of a multiprotein complex that is a subunit of the spliceosome and interaction between them is essential for pre-mRNA splicing progression [44, 45]. It has been shown that overexpression of CDC5L in mammalian cells shorte- ned the G2 phase of the cell cycle and a dominant negative mutant of the protein lacking the activation domain slowed G2 progression and delayed entry into mitosis [46] and also PLRG1 deficiency causes an earlier cell cycle arrest, as cells cannot progress through S phase [45]. We found that in one case of co- lon tumor mRNA expression of KY-CC-15/PLRG1 was elevated at 80 times compare to normal colon those can be as reason for IgG antibody response in case of tumors with shortened G2 phase, i.e. with rapidly growth characteristic. In conclusion, we found that using pool of al- logeneic sera obtained from colon cancer patients for SEREX-analysis of colon primary cancer may Experimental Oncology 37, 173–180, 2015 (September) 179 be an optimal way to overcome a difficulty with isola- tion of low number immunoreactive antigens for this tumor. We suggest that best way to complete SEREX characterization of all possible colon cancer antigens is using different stage colon tumors for serum im- munoscreening each with pools of sera obtained also for different stage tumors. It was found that primary colon tumors have new unique antigens in comparison to previously isolated, because majority of the last have been obtained for colon cancer cell lines. We con- firmed for five through 22 antigens isolated at this work its colon-cancer restricted serological profile requests its next exploration to define suitable targets for colon tumor therapy or diagnostic. ACKNOWLEDGMENTS We thank Dr. U. Sahin and Dr. O. Tureci at III. Medi- zinische Klinik and Poliklinik, Johannes Gutenberg Universitat Mainz, Germany, for introduction to us allo- geneic SEREX-analysis procedure and help in RT-PCR analysis of cDNAs. This study was supported by Rus- sian Science Foundation (project 15–15–20032). REFERENCES 1. Velculescu VE, Zhang L, Vogelstein B, et al. Serial analy- sis of gene expression. Science 1995; 270: 484–7. 2. Lin YM, Furukawa Y, Tsunoda T, et al. Molecular diag- nosis of colorectal tumors by expression profiles of 50 genes expressed differentially in adenomas and carcinomas. Onco- gene 2002; 21: 4120–8. 3. van der Bruggen P, Traversari C, Chomez P, et al. A gene encoding an antigen recognized by cytolytic T lymphocytes on a human melanoma. Science 1991; 254: 1643–7. 4. Sahin U, Tureci O, Schmitt H, et al. Human neoplasms elicit multiple specific immune responses in the autologous host. Proc Natl Acad Sci USA 1995; 92: 11810–3. 5. Stockert E, Jager E, Chen YT, et al. A survey of the hu- moral immune response of cancer patients to a panel of human tumor antigens. Exp Med 1998; 187: 1349–54. 6. Scanlan MJ, Gordon CM, Williamson B, et al. Identifi- cation of cancer/testis genes by database mining and mRNA expression analysis. Int J Cancer 2002; 98: 485–92. 7. Stockert E, Jager E, Chen YT, et al. A survey of the hu- moral immune response of cancer patients to a panel of human tumor antigens. J Exp Med 1998; 187: 1349–54. 8. Giesen E, Jilaveanu LB, Parisi F, et al. NY-ESO-1 as a po- tential immunotherapeutic target in renal cell carcinoma. On- cotarget 2014; 5: 5209–17. 9. Kumara S, Grieco MJ, Caballero OL, et al. MAGE- A3 is highly expressed in a subset of colorectal cancer patients. Cancer Immunity 2012; 12: 16–25. 10. Scanlan MJ, Chen YT, Williamson B, et al. Characte- rization of human colon cancer antigens recognized by autolo- gous antibodies. Int J Cancer 1998; 76: 652–8. 11. Scanlan MJ, Welt S, Gordon CM, et al. Cancer-related serological recognition of human colon cancer: identification of potential diagnostic and immunotherapeutic targets. Cancer Res 2002; 62: 4041–7. 12. Hongda C, Simone W, Sha T, et al. Blood autoantibo- dies against tumor-associated antigens as biomarkers in early detection of colorectal cancer. Cancer Letters 2014; 346: 178–87. 13. Kiyamova R, Garifulin O, Gryshkova V, et al. Prelimi- nary study of thyroid and colon cancers-associated antigens and their cognate autoantibodies as potential cancer biomar- kers. Biomarkers 2012; 4: 362–71. 14. Chomczynski P, Sacchi N. Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal Biochem 1987; 162: 156–9. 15. de Wet JR, Fukushima H, Dewji NN, et al. Chromo- genic immunodetection of human serum albumin and alpha- L-fucosidase clones in a human hepatoma cDNA expression library. DNA 1984; 3: 437–47. 16. Libert F, Ruel J, Ludgate M, et al. Thyroperoxidase, an auto-antigen with a mosaic structure made of nuclear and mitochondrial gene modules. EMBO J 1987; 6: 4193–6. 17. Banki K, Colombo E, Sia F, et al. Oligodendrocyte- specific expression and autoantigenicity of transaldolase in multiple sclerosis. J Exp Med 1994; 180: 1649–63. 18. Tishler M, Alosachie I, Barka N, et al. Primary Sjo- gren’s syndrome and primary biliary cirrhosis: differences and similarities in the autoantibody profile. Clin Exp Rheumatol 1995; 13: 497–500. 19. Anusaksathien O, Singh G, Matthews N, et al. Autoim- munity to collagen in adult periodontal disease: immunoglobu- lin classes in sera and tissue. J Periodontal Res 1992; 27: 55–61. 20. Winer S, Astsaturov I, Cheung RK, et al. T cells of mul- tiple sclerosis patients target a common environmental peptide that causes encephalitis in mice. J Immunol 2001; 166: 4751–6. 21. Zampieri S, Degen W, Ghiradello A, et al. Dephos- phorylation of autoantigenic ribosomal P proteins during Fas-L induced apoptosis: a possible trigger for the development of the autoimmune response in patients with systemic lupus erythematosus. Ann Rheum Dis 2001; 60: 72–6. 22. Yamada K, Senju S, Nakatsura T, et al. Identification of a novel autoantigen UACA in patients with panuveitis. Biochem Biophys Res Commun 2001; 280: 1169–76. 23. Czaja AJ, Cassani F, Cataleta M, et al. Frequency and significance of antibodies to actin in type 1 autoimmune hepatitis. Hepatology 1996; 24: 1068–73. 24. Boulassel MR, Tomasi JP, Deggouj N, et al. Identifica- tion of beta-actin as a candidate autoantigen in autoimmune inner ear disease. Clin Otolaryngol 2000; 25: 535–41. 25. Hansen MH, Nielsen H, Ditzel HJ. The tumor- infiltrating B cell response in medullary breast cancer is oli- goclonal and directed against the autoantigen actin exposed on the surface of apoptotic cancer cells. Proc Natl Acad Sci USA 2001; 98: 12659–64. 26. Hodi FS, Schmollinger JC, Soif fer RJ, et al. ATP6S1 elicits potent humoral responses associated with immune-mediated tumor destruction. Proc Natl Acad Sci USA 2002; 99: 6919–24. 27. Chen YT, Gure AO, Tsang S, et al. Identification of multiple cancer/testis antigens by allogeneic antibody screening of a melanoma cell line library. Proc Natl Acad Sci USA 1998; 95: 6919–23. 28. Peattie DA, Harding MW, Fleming MA, et al. Expres- sion and characterization of human FKBP52, an immu- nophilin that associates with the 90 kDa heat shock protein and is a component of steroid receptor complexes. Proc Natl Acad Sci USA 1992; 89: 10974–8. 29. Ramos P, Guy N, Cox M. Identification and cha- racterization of a putative FKBP52 regulatory surface on the androgen receptor hormone binding domain (567.9). FASEB J 2014; 28: 576–85. 30. Erlejman AG, Lagadari M, Toneatto J, et al. Regulatory role of the 90-kDa-heat-shock protein (Hsp90) and associated factors on gene expression. BBA 2014; 1839: 71–87. 31. Doucet-Brutin S, Renoir M, Le Gallic L, et al. Growth- regulated expression of FKBP-59 immunophilin in normal and transformed fibroblastic cells. Exp Cell Res 1995; 220: 152–60. 180 Experimental Oncology 37, 173–180, 2015 (September) 32. Rexin M, Busch W, Gehring U. Protein components of the nonactivated glucocorticoid receptor. J Biol Chem 1991; 266: 24601–5. 33. Rehberger P, Rexin M, Gehring U. Heterotetrameric structure of the human progesterone receptor. Proc Natl Acad Sci USA 1992; 89: 8001–5. 34. Segnitz B, Gehring U. Subunit structure of the non- activated human estrogen receptor. Proc Natl Acad Sci USA 1995; 92: 2179–83. 35. Ehrenfried JA, Herron BE, Townsend CM Jr, et al. Heat shock proteins are differentially expressed in human gastrointestinal cancers. Surg Oncol 1995; 4: 197–203. 36. Campbell-Thompson M, Lynch IJ, Bhardwaj B. Expres- sion of estrogen receptor (ER) subtypes and ERß isoforms in colon cancer. Cancer Research 2001; 61: 632–40. 37. Lees-Miller JP, Helfman DM, Schroer TA. A verte- brate actin-related protein is a component of a multisubunit complex involved in microtubule-based vesicle motility. Na- ture 1992; 359: 244–6. 38. Faulkner NE, Vig B, Echeverri CJ, et al. Localization of motor-related proteins and associated complexes to active, but not inactive, centromeres. Hum Mol Genet 1998; 7: 671–7. 39. Ramdas S, Cheng L, Puri P, et al. The Flagellar protein RSPH1 is a candidate regulator of the testis and sperm-restricted protein phosphatase, PP1gamma 2. Biol Reprod 2009; 81: 450. 40. Taketo MM, Araki Y, Matsunaga A, et al. Mapping of eight testis-specific genes to mouse chromosomes. Geno- mics 1997; 46: 138–42. 41. Tsuchida J, Nishina Y, Wakabayashi N, et al. Molecular cloning and characterization of meichroacidin (male meiotic metaphase chromosome-associated acidic protein). Dev Biol 1998; 197: 67–76. 42. Ling H, Jing L, Yibing H, et al. The mouse T complex gene Tsga2, encoding polypeptides located in the sperm tail and anterior acrosome, maps to a locus associated with sperm motility and sperm-egg interaction abnormalities. Biol Re- prod 2006; 74: 633–43. 43. Nemeth K, Salchert K, Putnoky P, et al. Pleiotropic control of glucose and hormone responses by PRL1, a nuclear WD protein, in Arabidopsis. Genes Dev 1998; 12: 3059–73. 44. Ajuh P, Sleeman J, Chusainow J, et al. A direct interac- tion between the carboxyl-terminal region of CDC5L and the WD40 domain of PLRG1 is essential for pre-mRNA splicing. J Biol Chem 2001; 276: 42370–81. 45. Karamyshevaa Z, Díaz-Martínezb LA, Warringtonc R, et al. Graded requirement for the spliceosome in cell cycle progression. Cell Cycle 2015; 14: 12. 46. Bernstein HS, Coughlin SR. Pombe Cdc5-related pro- tein. A putative human transcription factor implicated in mi- togen-activated signaling. J Biol Chem 1997; 272: 5833–7. Copyright © Experimental Oncology, 2015
id nasplib_isofts_kiev_ua-123456789-145484
institution Digital Library of Periodicals of National Academy of Sciences of Ukraine
issn 1812-9269
language English
last_indexed 2025-12-07T17:58:13Z
publishDate 2015
publisher Інститут експериментальної патології, онкології і радіобіології ім. Р.Є. Кавецького НАН України
record_format dspace
spelling Garifulin, O.M.
Kykot, V.O.
Gridina, N.Y.
Kiyamova, R.G.
Gout, I.T.
Filonenko, V.V.
2019-01-22T12:47:53Z
2019-01-22T12:47:53Z
2015
Application of serex-analysis for identification of human colon cancer antigens / O.M. Garifulin, V.O. Kykot, N.Y. Gridina, R.G. Kiyamova, I.T. Gout, V.V. Filonenko // Experimental Oncology. — 2015. — Т. 37, № 3. — С. 173-180. — Бібліогр.: 46 назв. — англ.
1812-9269
https://nasplib.isofts.kiev.ua/handle/123456789/145484
Background: Colorectal, lung and breast tumors are the most devastating and frequent malignances in clinical oncology. SEREX-analysis of colon cancer leads to identification of more than hundred antigens which are potential tumor markers. With idea that immunoscreening with pool of allogeneic sera is more productive for antigen isolation, SEREX-analysis was applied to four cases of stages II–IV primary colon tumor and 22 new antigens were isolated. Objective: To characterize 22 primary colon cancer antigens isolated by SEREX-technique. Materials and Methods: Allogenic screening, real-time PCR analysis. Results: After allogeneic immunoscreening, for 5 of 22 (22%) isolated antigens were confirmed colon cancer restricted serological profile solely positive for 14% of tested colon cancer sera. Through these five antigens, KY-CC-17/β-actin has cytoskeleton function; KY-CC-14/ACTR1A and KY-CC-19/TSGA2 participate in chromosome segregation; KY-CC-12/FKBP4 regulates steroid receptor function and KY-CC-15/PLRG1 is a component of spliceosome complex. For the last four antigens tested were found aberrant mRNA expression in some cases of colon tumor. Conclusion: The exploration of identified antigens may define suitable targets for immunotherapy or diagnostic of colon cancer. Key Words: colon cancer, SEREX-analysis, allogeneic immunoscreening.
We thank Dr. U. Sahin and Dr. O. Tureci at III. Medizinische Klinik and Poliklinik, Johannes Gutenberg Universitat Mainz, Germany, for introduction to us allogeneic SEREX-analysis procedure and help in RT-PCR analysis of cDNAs. This study was supported by Russian Science Foundation (project 15–15–20032).
en
Інститут експериментальної патології, онкології і радіобіології ім. Р.Є. Кавецького НАН України
Experimental Oncology
Original contributions
Application of serex-analysis for identification of human colon cancer antigens
Article
published earlier
spellingShingle Application of serex-analysis for identification of human colon cancer antigens
Garifulin, O.M.
Kykot, V.O.
Gridina, N.Y.
Kiyamova, R.G.
Gout, I.T.
Filonenko, V.V.
Original contributions
title Application of serex-analysis for identification of human colon cancer antigens
title_full Application of serex-analysis for identification of human colon cancer antigens
title_fullStr Application of serex-analysis for identification of human colon cancer antigens
title_full_unstemmed Application of serex-analysis for identification of human colon cancer antigens
title_short Application of serex-analysis for identification of human colon cancer antigens
title_sort application of serex-analysis for identification of human colon cancer antigens
topic Original contributions
topic_facet Original contributions
url https://nasplib.isofts.kiev.ua/handle/123456789/145484
work_keys_str_mv AT garifulinom applicationofserexanalysisforidentificationofhumancoloncancerantigens
AT kykotvo applicationofserexanalysisforidentificationofhumancoloncancerantigens
AT gridinany applicationofserexanalysisforidentificationofhumancoloncancerantigens
AT kiyamovarg applicationofserexanalysisforidentificationofhumancoloncancerantigens
AT goutit applicationofserexanalysisforidentificationofhumancoloncancerantigens
AT filonenkovv applicationofserexanalysisforidentificationofhumancoloncancerantigens