Spectrum of mutations in patients with organic acidurias from Ukraine

Aim. To identify mutations in patients from Ukraine with glutaric aciduria I, isolated methylmalonic aciduria, and isovaleric aciduria. Methods. Sanger sequencing. Results. We have identified 37.5 % of alleles (3/8) in patients with methylmalonic aciduria, 100 % of alleles (4/4) in patients with iso...

Full description

Saved in:
Bibliographic Details
Published in:Вiopolymers and Cell
Date:2018
Main Authors: Barvinska, O.I., Olkhovych, N.V., Shkurko, T.O., Gorovenko, N.G.
Format: Article
Language:English
Published: Інститут молекулярної біології і генетики НАН України 2018
Subjects:
Online Access:https://nasplib.isofts.kiev.ua/handle/123456789/154281
Tags: Add Tag
No Tags, Be the first to tag this record!
Journal Title:Digital Library of Periodicals of National Academy of Sciences of Ukraine
Cite this:Spectrum of mutations in patients with organic acidurias from Ukraine / O.I. Barvinska, N.V. Olkhovych, T.O. Shkurko, N.G. Gorovenko // Вiopolymers and Cell. — 2018. — Т. 34, № 2. — С. 107-116. — Бібліогр.: 19 назв. — англ.

Institution

Digital Library of Periodicals of National Academy of Sciences of Ukraine
id nasplib_isofts_kiev_ua-123456789-154281
record_format dspace
spelling Barvinska, O.I.
Olkhovych, N.V.
Shkurko, T.O.
Gorovenko, N.G.
2019-06-15T12:18:51Z
2019-06-15T12:18:51Z
2018
Spectrum of mutations in patients with organic acidurias from Ukraine / O.I. Barvinska, N.V. Olkhovych, T.O. Shkurko, N.G. Gorovenko // Вiopolymers and Cell. — 2018. — Т. 34, № 2. — С. 107-116. — Бібліогр.: 19 назв. — англ.
0233-7657
DOI: http://dx.doi.org/10.7124/bc.000975
https://nasplib.isofts.kiev.ua/handle/123456789/154281
616.575-056.7-07
Aim. To identify mutations in patients from Ukraine with glutaric aciduria I, isolated methylmalonic aciduria, and isovaleric aciduria. Methods. Sanger sequencing. Results. We have identified 37.5 % of alleles (3/8) in patients with methylmalonic aciduria, 100 % of alleles (4/4) in patients with isovaleric aciduria, 100 % of alleles (4/4) in patients with glutaric aciduria type I. MUT gene mutations in patients from Ukraine are represented by one known N219Y missense mutation p. and a R326G missense rearrangement. Analysis of the GCDH gene in patients from Ukraine revealed three known missense mutations: R383C, G390R and A421V. Rearrangements in the IVD gene of our patients were represented by two novel mutations: 49dupTGTGGCG, S133C, and one known mutation: R53P. Conclusions. The mutations observed in Ukrainian patients with organic acidurias were mostly represented by rare or new rearrangements. These data could be useful for the development of molecular diagnostics of Ukrainian patients with glutaric aciduria I, isolated methylmalonic aciduria, and isovaleric aciduria
Мета. Визначення спектру мутацій у пацієнтів з України, що страждають на глутарову ацидурію I типу, ізольовану метилмалонову ацидурію та ізовалеріанову ацидурію. Методи. Сиквенування за Сенгером. Результати. Було виявлено 37,5 % мутантних алелей (три зразки з восьми) у пацієнтів з ізольованою метилмалоновою ацирурією, 100 % алелей (чотири з чотирьох) у хворих з ізовалеріановою ацидурією, 100 % алелей (чотири з чотирьох) у пацієнтів з глутаровою ацидурією I типу. Спектр мутацій у гені MUT у пацієнтів в Україні представлений однією відомою місенс мутацією с. N219Y та місенс заміною p. R326G. В результаті аналізу сиквенсу гену GCDH у пацієнтів було виявлено три відомі місенс перебудови p. R383C, p. G390R та p. A421V. Мутації в гені IVD у наших пацієнтів були представлені двома новими перебудовами c. 49dupTGTGGCG, p. S133C і однією відомою місенс заміною p. R53P. Висновки. Отримані результати показали, що спектр мутацій у пацієнтів з органічними ацидуріями в Україні представлений переважно рідкісними або ж новими перебудовами. Ці дані можуть бути корисними для розробки молекулярно-генетичного алгоритму діагностики у хворих з України, що мають глутарову ацидурію І типу, ізольовану метилмалонову ацидурію та ізовалеріанову ацидурію.
Цель. Определение спектра мутаций у пациентов с Украины с глутаровой ацидурией I типа, изолированной метилмалоновой ацидурией и изовалериановой ацидурией. Методы. Сиквенирование за Сэнгером. Результаты. Было выявлено 37,5 % мутантных аллелей (три образца из восьми) у пациентов с изолированной метилмалоновой ацидурией, 100 % аллелей (четыре из четырех) у больных с изовалериановой ацидурией, 100 % аллелей (четыре из четырех) у пациентов с глутаровой ацидурией I типа. Спектр мутаций в гене MUT у пациентов с Украины представлен одной известной миссенс мутацией с. N219Y и миссенс заменой p. R326G. В результате анализа сиквенса гена GCDH пациентов из Украины было обнаружено три известные миссенс перестройки p. R383C, p. G390R и p. A421V. Мутации в гене IVD у наших пациентов были представлены двумя новыми перестройками c. 49dupTGTGGCG, p. S133C и одной известной миссенс заменой p. R53P. Выводы. Полученные результаты показали, что спектр мутаций у пациентов с органическими ацидуриями в Украине представлен в большинстве редкими или новыми перестройками. Эти данные могут быть полезными для разработки молекулярно-генетического алгоритма диагностики у больных с глутаровой ацидурией I типа, изолированной метилмалоновой ацидурией, и изовалериановой ацидурией в Украине.
en
Інститут молекулярної біології і генетики НАН України
Вiopolymers and Cell
Biomedicine
Spectrum of mutations in patients with organic acidurias from Ukraine
Спектр мутацій у пацієнтів з органічними ацидуріями з України
Спектр мутаций у пациентов с органическими ацидуриями из Украины
Article
published earlier
institution Digital Library of Periodicals of National Academy of Sciences of Ukraine
collection DSpace DC
title Spectrum of mutations in patients with organic acidurias from Ukraine
spellingShingle Spectrum of mutations in patients with organic acidurias from Ukraine
Barvinska, O.I.
Olkhovych, N.V.
Shkurko, T.O.
Gorovenko, N.G.
Biomedicine
title_short Spectrum of mutations in patients with organic acidurias from Ukraine
title_full Spectrum of mutations in patients with organic acidurias from Ukraine
title_fullStr Spectrum of mutations in patients with organic acidurias from Ukraine
title_full_unstemmed Spectrum of mutations in patients with organic acidurias from Ukraine
title_sort spectrum of mutations in patients with organic acidurias from ukraine
author Barvinska, O.I.
Olkhovych, N.V.
Shkurko, T.O.
Gorovenko, N.G.
author_facet Barvinska, O.I.
Olkhovych, N.V.
Shkurko, T.O.
Gorovenko, N.G.
topic Biomedicine
topic_facet Biomedicine
publishDate 2018
language English
container_title Вiopolymers and Cell
publisher Інститут молекулярної біології і генетики НАН України
format Article
title_alt Спектр мутацій у пацієнтів з органічними ацидуріями з України
Спектр мутаций у пациентов с органическими ацидуриями из Украины
description Aim. To identify mutations in patients from Ukraine with glutaric aciduria I, isolated methylmalonic aciduria, and isovaleric aciduria. Methods. Sanger sequencing. Results. We have identified 37.5 % of alleles (3/8) in patients with methylmalonic aciduria, 100 % of alleles (4/4) in patients with isovaleric aciduria, 100 % of alleles (4/4) in patients with glutaric aciduria type I. MUT gene mutations in patients from Ukraine are represented by one known N219Y missense mutation p. and a R326G missense rearrangement. Analysis of the GCDH gene in patients from Ukraine revealed three known missense mutations: R383C, G390R and A421V. Rearrangements in the IVD gene of our patients were represented by two novel mutations: 49dupTGTGGCG, S133C, and one known mutation: R53P. Conclusions. The mutations observed in Ukrainian patients with organic acidurias were mostly represented by rare or new rearrangements. These data could be useful for the development of molecular diagnostics of Ukrainian patients with glutaric aciduria I, isolated methylmalonic aciduria, and isovaleric aciduria Мета. Визначення спектру мутацій у пацієнтів з України, що страждають на глутарову ацидурію I типу, ізольовану метилмалонову ацидурію та ізовалеріанову ацидурію. Методи. Сиквенування за Сенгером. Результати. Було виявлено 37,5 % мутантних алелей (три зразки з восьми) у пацієнтів з ізольованою метилмалоновою ацирурією, 100 % алелей (чотири з чотирьох) у хворих з ізовалеріановою ацидурією, 100 % алелей (чотири з чотирьох) у пацієнтів з глутаровою ацидурією I типу. Спектр мутацій у гені MUT у пацієнтів в Україні представлений однією відомою місенс мутацією с. N219Y та місенс заміною p. R326G. В результаті аналізу сиквенсу гену GCDH у пацієнтів було виявлено три відомі місенс перебудови p. R383C, p. G390R та p. A421V. Мутації в гені IVD у наших пацієнтів були представлені двома новими перебудовами c. 49dupTGTGGCG, p. S133C і однією відомою місенс заміною p. R53P. Висновки. Отримані результати показали, що спектр мутацій у пацієнтів з органічними ацидуріями в Україні представлений переважно рідкісними або ж новими перебудовами. Ці дані можуть бути корисними для розробки молекулярно-генетичного алгоритму діагностики у хворих з України, що мають глутарову ацидурію І типу, ізольовану метилмалонову ацидурію та ізовалеріанову ацидурію. Цель. Определение спектра мутаций у пациентов с Украины с глутаровой ацидурией I типа, изолированной метилмалоновой ацидурией и изовалериановой ацидурией. Методы. Сиквенирование за Сэнгером. Результаты. Было выявлено 37,5 % мутантных аллелей (три образца из восьми) у пациентов с изолированной метилмалоновой ацидурией, 100 % аллелей (четыре из четырех) у больных с изовалериановой ацидурией, 100 % аллелей (четыре из четырех) у пациентов с глутаровой ацидурией I типа. Спектр мутаций в гене MUT у пациентов с Украины представлен одной известной миссенс мутацией с. N219Y и миссенс заменой p. R326G. В результате анализа сиквенса гена GCDH пациентов из Украины было обнаружено три известные миссенс перестройки p. R383C, p. G390R и p. A421V. Мутации в гене IVD у наших пациентов были представлены двумя новыми перестройками c. 49dupTGTGGCG, p. S133C и одной известной миссенс заменой p. R53P. Выводы. Полученные результаты показали, что спектр мутаций у пациентов с органическими ацидуриями в Украине представлен в большинстве редкими или новыми перестройками. Эти данные могут быть полезными для разработки молекулярно-генетического алгоритма диагностики у больных с глутаровой ацидурией I типа, изолированной метилмалоновой ацидурией, и изовалериановой ацидурией в Украине.
issn 0233-7657
url https://nasplib.isofts.kiev.ua/handle/123456789/154281
citation_txt Spectrum of mutations in patients with organic acidurias from Ukraine / O.I. Barvinska, N.V. Olkhovych, T.O. Shkurko, N.G. Gorovenko // Вiopolymers and Cell. — 2018. — Т. 34, № 2. — С. 107-116. — Бібліогр.: 19 назв. — англ.
work_keys_str_mv AT barvinskaoi spectrumofmutationsinpatientswithorganicaciduriasfromukraine
AT olkhovychnv spectrumofmutationsinpatientswithorganicaciduriasfromukraine
AT shkurkoto spectrumofmutationsinpatientswithorganicaciduriasfromukraine
AT gorovenkong spectrumofmutationsinpatientswithorganicaciduriasfromukraine
AT barvinskaoi spektrmutacíiupacíêntívzorganíčnimiaciduríâmizukraíni
AT olkhovychnv spektrmutacíiupacíêntívzorganíčnimiaciduríâmizukraíni
AT shkurkoto spektrmutacíiupacíêntívzorganíčnimiaciduríâmizukraíni
AT gorovenkong spektrmutacíiupacíêntívzorganíčnimiaciduríâmizukraíni
AT barvinskaoi spektrmutaciiupacientovsorganičeskimiaciduriâmiizukrainy
AT olkhovychnv spektrmutaciiupacientovsorganičeskimiaciduriâmiizukrainy
AT shkurkoto spektrmutaciiupacientovsorganičeskimiaciduriâmiizukrainy
AT gorovenkong spektrmutaciiupacientovsorganičeskimiaciduriâmiizukrainy
first_indexed 2025-11-26T00:08:38Z
last_indexed 2025-11-26T00:08:38Z
_version_ 1850593152092602368
fulltext 107 O. I. Barvinska, N. V. Olkhovych, T. O. Shkurko © 2018 O. I. Barvinska et al.; Published by the Institute of Molecular Biology and Genetics, NAS of Ukraine on behalf of Bio- polymers and Cell. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted reuse, distribution, and reproduction in any medium, provided the original work is properly cited UDC 616.575-056.7-07 Spectrum of mutations in patients with organic acidurias from Ukraine O. I. Barvinska1,2, N. V. Olkhovych1, T. O. Shkurko1, N. G. Gorovenko2 1 National Children's Specialized Hospital Okhmatdyt, Ministry of Health of Ukraine 28/1, Chornovola Str., Kyiv, Ukraine, 01135 2 P. L. Shupik National medical academy of post-graduate education 9, Dorohozhytska Str., Kyiv, Ukraine, 04112 oiaminska@gmail.com Aim. To identify mutations in patients from Ukraine with glutaric aciduria I, isolated methyl- malonic aciduria, and isovaleric aciduria. Methods. Sanger sequencing. Results. We have identified 37.5 % of alleles (3/8) in patients with methylmalonic aciduria, 100 % of alleles (4/4) in patients with isovaleric aciduria, 100 % of alleles (4/4) in patients with glutaric aciduria type I. MUT gene mutations in patients from Ukraine are represented by one known N219Y missense mutation p. and a R326G missense rearrangement. Analysis of the GCDH gene in patients from Ukraine revealed three known missense mutations: R383C, G390R and A421V. Rearrangements in the IVD gene of our patients were represented by two novel mutations: 49dupTGTGGCG, S133C, and one known mutation: R53P. Conclusions. The mutations observed in Ukrainian patients with organic acidurias were mostly represented by rare or new rearrangements. These data could be useful for the development of molecular diagnostics of Ukrainian patients with glutaric aciduria I, isolated methylmalonic aciduria, and isovaleric aciduria K e y w o r d s: organic acidurias, MUT, GCDH, IVD. Introduction Organic acidurias are a subgroup of inborn errors of metabolism which includes more than 33 inherited disorders by SSIEM classification 2011 [1] and are characterized by the cumula- tive prevalence of 1:7962 live birth [2]. The most prevalent disorders in this group are iso- lated methylmalonic aciduria (MIM 251000, deficiency of methylmalonyl-CoA mutase (EC 5.4.99.2)), isovaleric aciduria (MIM 243500, deficiency of isovaleryl-CoA dehy- drogenase (EC1.3.99.10)), propionic aciduria (MIM 606054, deficiency of propionyl-CoA carboxylase (EC 6.4.1.3)), and glutaric acid- uria type 1 (MIM 231670, deficiency of glu- taryl-CoA-dehydrogenase (EC 1.3.99.7)). Organic acidurias are caused by the deficiency of enzymes and transporters which take part in metabolism of amino acids, carbohydrates Biomedicine ISSN 1993-6842 (on-line); ISSN 0233-7657 (print) Biopolymers and Cell. 2018. Vol. 34. N 2. P 107–116 doi: http://dx.doi.org/10.7124/bc.000975 https://www.omim.org/entry/251000 https://www.ncbi.nlm.nih.gov/omim/243500 https://www.omim.org/entry/606054 https://www.omim.org/entry/231670 108 O. I. Barvinska, N. V. Olkhovych, T. O. Shkurko et al. or lipid intermediates [3]. Such alterations of metabolism lead to some common clinical manifestations such as developmental delay, seizures, lethargy, coma, vomiting, failure to thrive, hepatomegaly, respiratory distress and some unique ones such as dystonic-dyskinetic disorder, macrocephaly in case of GA I, sweaty odor of feet in case of IVA [3–5]. The most common biochemical features are hyperam- monemia, metabolic acidosis, ketosis and hy- poglycemia. Without treatment these disorders could result in coma or death very quickly. Therefore, early diagnosis is crucial for de- creasing a level of disability, mortality and morbidity of patients. In all developed coun- tries the majority of organic acidurias are de- tected within the newborn screening by tandem mass spectrometry of acylcarnitines in dry blood spots [6]. The diagnosis is confirmed by gas chromatography, mass spectrometry or molecular genetic analysis. Glutaric aciduria I (GA I) and isovaleric aciduria (IVA) are monogenic autosomal reces- sive inherited disorders, caused by mutations in genes GCDH (mapped to 19p13.2, includes 12 exons) and IVD (mapped to 15q.14-15, includes 12 exons) respectively [4, 5]. Noteworthy, methylmalonic aciduria (MMA) is a big heterogenous group of inherited dis- orders which are remarkable for elevation of methylmalonic acid in biological fluids. In terms of biochemical features these disorders are divided into two groups – isolated MMA and combined MMA. Isolated MMA is a clin- ical condition which could be caused by muta- tions in such genes as MUT, MMAA, MMAB and MCEE, while combined MMA manifests in complex with homocystinuria/homocyste- inemia and is caused by mutations in the genes MMACHC, MMADHC, LMBRD1, ABCB4, HCFC1 [7]. The isolated MMA is a more prevalent disorder than the combined one and 60 % of mutations are detected in the MUT gene (mapped to 6p.12.3, consists of 13 exon s) [8]. The current mutation database HGMD Professional 2017.4 describes 361 mu- tations in the MUT gene, 87 rearrangements in the IVD gene, and 208 the in GCDH gene. The absence of highly predominant mutations in the genes MUT, IVD and GCDH and the need to define and distinguish different types of MMA stipulate the use of sequencing as a common method of confirming MMA, IVA and GA I. Aim To investigate a disease-causing mutations spectrum in patients with organic acidurias from Ukraine. Materials and Methods This study included 8 patients (4 males and 4 females) aged from 10 days to 3 years. These individuals were selected for organic aciduria diagnosis confirmation by selective screening of inborn errors of fatty acid and amino acid metabolism (2011–2016). All selected patients with suspected isolated methylmalonic acid- uria, glutaric aciduria type I or isovaleric ac- iduria had elevations of typical acylcarnitines in dry blood spots and organic acids in urine. All parents gave their written informed consent on these investigations. The study was ap- proved by the Committee of Bioethics of NSCH “OKhMATDYT”. Dry blood spots were collected on WhatmanTM N 903 specimen collection papers and dried according to all requirements. 109 Spectrum of mutations in patients with organic acidurias from Ukraine Genomic DNA was extracted from dry blood spots with NEOGENE reagents kit (Ukraine) according to the manufacturer’s pro- tocol. The exons and flanking intronic regions of the MUT, IVD and GCDH genes were amplified by the polymerase chain reaction (PCR) from genomic DNA in SimpliAmp™ Thermal Cycler (Thermo Fisher Scientific) with the amplifica- tion kit GenPak®PCRCore NEOGENE (Ukraine) and primers developed with Primer3 software. The primers are presented in Table 1. The visualization of PCR products was per- formed with capillary electrophoresis on MCE-202 MultiNA Shimadzu (Japan) using DNA 500 Shimadzu kit (Japan), 1000 Shimadzu kit (Japan) and molecular weight marker 25 bp DNA Ladder Invitrogen by Life Technologies (USA), and dye SYBR® Gold Molecular probes by Life Technologies (USA). The PCR products were sequenced directly using forward and reverse primers on genetic analyzer ABI 3130 by Applied Biosystems (USA). The preparation of samples to sequenc- Table 1. Primers for exons and flanking intronic regions of genes GCDH, IVD and MUT GCDH gene MUT gene IVD gene Exon Primers Exon Primers Exon Primers 2–3 F: ggccggattctaggaggaac R: cttagtgcctctgaccctgg 2 F: aggaagcagaaaaggggaaga R: cgtgcatgtgttgttttctttca 1 F: cacggttgattggctcgg R: tgtcccacggtctcaaatct 4–5 F: gtcacctgatcagtctcgct R: cagtgagccaagatcgtgc 3 F: gttggttttgacatgtatgagca R: cctgcaagtaacgacagaaca 2–3 F: tcaagctgtctaggctgaaga R: cacaggtccaaaagatgcagt 6 F: accctctgaaagtggctgtg R: gatcagatctccaggtgaagc 4 F: ggtacagtcctgatgatggttc R: ttcaacagcacagtggatcc 4 F: taagcaggtctgtggcatca R: atccatggccccttcctaac 7–8 F: cctgccttggcctcctaaa R: cgagtccggctgagtaagaa 5 F: cataaatgtacgtgcactgatct R: gcactacagggaagctagga 5–6 F: ctttaccgacaccctggtct R: cttttggtcaccctccttgc 9 F: ggactgtgtgcaaaccgag R: ccacagctgctcagaagga 6 F: aaacactgaactctgactcttct R: actgctgttctttgtatgagct 7 F: gggagcatgggactaggatg R: cacatgtcactgaagcgcta 10 F: agtgacgtccttctgagcag R: catcaaggacaagagggacag 7 F: tcccaagacttaagaggttttgt R: tatgcttgcctgtgtgcatc 8 F: agctccacttctgactggaa R: tcctcaggccttttgtctgt 11 F: ctgctgtccctcttgtcctt R: ccacagtccccatgtgagta 8 F: tctactttcctctcacacccc R: tcctgagcaagtttctcaatgc 9 F: ccgtaactgtggcaagactt R: ctgcatgctgaggaagactg 12 F: agcattcaccatctctgttgg R: aggaacacatctgaacgacttc 9 F: acttgggaaggtcagcactatta R: cctcagccacagtaaaatacaca 10–11 F: ccccatctccatcatcctga R: aggctggtcttgaactcctg 10 F: aagagaattggatgcataaaggc R: tctgtttgacatgagaaactcct 12 F: ccctccctcttgctaccttt R: ttgggagctgttgtggagaa 11 F: cctgcacattaacccctgaat R: agtcagtggctacataccagt 12 F: ctcccattctgtaggttatctgt R: agcataggttactggtttgca 13 F: agccccaaatgccagtagta R: acaccaggcctataagtaaggt F -forward, R- reverse https://www.biocompare.com/104463-Thermo-Fisher-Scientific/ http://neogene.com.ua/index.php?route=product/product&path=18_45&product_id=86 110 O. I. Barvinska, N. V. Olkhovych, T. O. Shkurko et al. ing and analysis was performed with BigDye Terminator v3.1 cycle sequencing kit by Applied Biosystems (USA), BigDye XTermi- nator Purification Kit by Applied Biosystems (USA), PCR clean up Gel extraction by Macherey-Nagel (Germany), according to the protocol of the manufacturer. The assessment of pathogenicity of novel missense mutations was verified with Mutation Taster, Polyphen2, Provean software. Nucleo- tide sequence changes which result in frame- shift were considered pathogenic. The predic- tion of the effect of novel missense mutations on the structure of protein was made with DeepView4.1 software, the modelling involved the use of a crystallographic structure of hu- man methylmalonyl-CoA mutase PDB ID: 2XIJ previously reported by Froese et al. [9] and human isovaleryl-CoA dehydrogenase PDB ID: 1IVH reported by Tifanny et al. [10]. The analysis of mutations was performed using the normal human MUT (NM_000255.3), IVD (NM_002225.3), GCDH (NM_000159.3) se- quences as a reference. The nomenclature of mutations was based on coding sequences according to the standards of the Human Genome Variation Society [11]. Results and Discussion The sequencing of exons and intron flanking regions of the MUT, GCDH, IVD genes was performed to confirm the diagnosis of isolated methylmalonic aciduria in 4 patients, glutaric aciduria type I in 2 patients and isovaleric aciduria in 2 patients with a specific profile of elevated acylcarnitines in dry blood spots and organic acids in urine. According to the gene MUT sequence, two different missense mutations in this gene were identified in 2 patients with suspected isolated type of MMA. Patient 1 carried mutation in 3 exon p. N219Y, c.655 A > T in homozygous state (Table 2). This rearrangement has already been described in the HGMD database and is considered to be a frequent mutation, as its presence in 25 alleles out of 302 in Caucasian population was previously published [8]. Patient 2 had a missense mutation in exon 5 of the MUT gene p. R326G, c.976 A > G in heterozygous state which has not been added to HGMD database yet (Fig. 1A) (Table 2). The analysis of this novel missense mutation with Mutation Taster, PolyPhen2 and Provean Predictor software showed that it had a patho- genic effect (Table 3). The 3D model of meth- ylmalonyl-CoA mutase (MCM) revealed that the replacement of positively charged large amino acid Arg with a small neutral amino acid Gly in the 326th position causes breaking of 4 hydrogen bonds, which Arg326 creates with Thr92, Phe91, Gly380 and Ala330 in the N-terminal domain (Fig. 1B). Consequently, such alterations result in the tertiary conforma- tion changes of methylmalonyl-CoA mutase that likely affect the protein function. The mutation in the second allele of Patient 2 was not detected in any exon from 2 to 13 and its intronic flanking regions. The only addi- tional findings in Patient 2 were three polymor- phisms p. K212K, p. R532H, p. I671V in ho- mozygous state. No mutations were found in exons 2–13 with flanking regions of introns of the MUT gene in two other patients with sus- pected MMA. In these two patients it is neces- sary to search for mutations in regulatory re- gions or introns of the MUT gene or other genes MMAA, MMAB, MCEE which are responsible for other types of isolated MMA [7]. 111 Spectrum of mutations in patients with organic acidurias from Ukraine The sequence of the GCDH gene, performed in order to confirm the diagnosis of glutaric aciduria type I in Patient 3, detected missense rearrangement p. R383C, c.1147 C > T in ho- mozygous state (Table 2). This mutation is con- sidered to be rare, for example, in Spanish pop- ulation it was present in one allele out of 70 and in 3 alleles out of 38 in Japanese population [5, 17]. The diagnosis of glutaric aciduria type I was also confirmed in Patient 4 with the identifica- tion of two known missense mutations p. G390R, c.1168G > C – a rare variant in Caucasian pop- ulation, and p. A421V, c. 1262 C > T – prevalent in Old Order Amish population [14, 15, 18]. The sequencing of the IVD gene in Patient 5 with suspected isovaleric aciduria revealed a known mutation p. R53P, c.158 G > C in het- erozygous state (Table 2). Previously this mu- tation was reported in two alleles out of 16 in the USA studies and in 5 alleles out of 46 in Turkish population [16, 19]. A novel duplica- tion of 7 nucleotides – c.49dupTGTGGCG (Table 2) was detected in the second allele of Patient 5 (Fig. 2A). This mutation causes a frameshift in exon 1, changing amino acid sequence and resulting in crucial alteration of tertiary structure of isovaleryl-CoA dehydro- genase with the loss of all cofactor and sub- strate binding sites. Such a truncated and changed protein could not perform its func- tions. The analysis of the IVD gene of Patient 6 revealed missense rearrangement p. S133C, Table 2. Mutations in patients with organic acidurias Patient No Diagnosis Gene Genotype Reported for the first timeExon Allele 1 Exon Allele 2 1 Methylmalonic aciduria MUT 3 p. N219Y, c.655 A > T 3 p. N219Y, c.655 A > T Aquaviva [12] 2 Methylmalonic aciduria MUT 5 p. R326G, c.976 A > G NA NA Submitted by GeneX in Ensemble 3 Glutaric Aciduria I GCDH 10 p. R383C, c.1147 C > T 10 p. R383C, c.1147 C > T Goodman [13] 4 Glutaric Aciduria I GCDH 11 p. G390R, c.1168G > C 12 p. A421V, c. 1262 C > T Anikster [14], Biery [15] 5 Isovaleric aciduria IVD 1 c.49dupTGTGGCG 2 p. R53P, c.158 G > C This study, Mohsen [16] 6 Isovaleric aciduria IVD 4 p. S133C, c.398 C > G 4 p. S133C, c.398 C > G This study NA – not available Table 3. Description and characteristics of new mutations in patients with organic acidurias New mutation Mutation Taster Polyphen2 Provean Predictor p. R326G in exon 5 of MUT gene Disease causing Probably damaging score of 1.000 Deleterious – 6.991 p. S133C in exon 4 of IVD gene Disease causing Probably damaging score of 1.000 Deleterious – 4.698 http://www.ncbi.nlm.nih.gov/sites/entrez?cmd=Retrieve&db=PubMed&list_uids=9711871&dopt=Abstract http://www.ncbi.nlm.nih.gov/sites/entrez?cmd=Retrieve&db=PubMed&list_uids=15486829&dopt=Abstract 112 O. I. Barvinska, N. V. Olkhovych, T. O. Shkurko et al. Fig. 1. A – Image of MUT gene se- quence of Patient 2 with rearrange- ment c.976 A > G in heterozygous state. B – Fragments of three-dimen- sional models of human wild-type MCM (green amino acid residue) and MCM with mutation p. R326G (red amino acid residue). A B 113 Spectrum of mutations in patients with organic acidurias from Ukraine A B C Fig. 2. A – Image of IVD gene se- quence of Patient 5 with duplication c.49dupTGTGGCG in heterozygous state. B – Image of the IVD gene se- quence of Patient 6 with rearrange- ment c.398 C > G in homozygous state. C – Fragment of three-dimen- sional models of human wild-type іsovaleryl CoA dehydrogenase (IVD) (green amino acid residue) and IVD with mutation p. S133C (red amino acid residue). 114 O. I. Barvinska, N. V. Olkhovych, T. O. Shkurko et al. c.398 C > G in homozygous state (Table 2) (Fig. 2B). This mutation has not been described in mutation database HGMD yet. The analysis of this rearrangement by Mutation Taster, Polyphen2, Provean software predicted it as the disease-causing one (Table 3). This muta- tion causes a change of one polar amino acid Serine to another polar amino acid Cysteine in the N-terminal domain of isovaleryl Co-A de- hydrogenase (IVD). Such replacement causes breaking of one hydrogen bond which Ser133 creates with Ala129 and lengthens the other which Ser133 creates with Ser256 (Fig. 2C). Also, other hydrogen bonds with Tyr134, Ala136, His137, Val130 remain unchanged. Taking into consideration the fact that this amino acid residue is close to FAD-binding site, such alterations could affect cofactor bind- ing and functional activity of protein. To sum up, the sequencing of the MUT, IVD and GCDH genes allowed identifying a spec- trum of mutations in Ukrainian patients with organic acidurias which is represented by known but rare variants (p. R53P in the IVD gene and p. R383C, p. G390R in the GCDH gene) or novel mutations (p. R326G in the MUT gene, p. S133C and c.49dupTGTGGCG in the IVD gene). The only exceptions were missense mutation p. N219Y in the MUT gene and p. A421V in the GCDH gene which are considered to be common variants for Caucasians and Amish population respectively [7, 18]. Conclusions The sequence analysis of the MUT gene con- firmed the diagnosis of classic isolated meth- ylmalonic aciduria in two patients out of 4 suspected ones. In these patients two missense mutations were detected, including one com- monly known mutation p. N219Y (2/8 alleles) and the other undisclosed one – p. R326G (1/8 alleles). According to the results of the GCDH gene sequence, three missense rear- rangements p. R383C (2/4 alleles), p. G390R (1/4 alleles), p. A421V (1/4 alleles) were de- tected in patients with suspected glutaric ac- iduria type I and the previous diagnosis was confirmed. Two missense mutations – recurrent p. R53P (1/4 alleles) and novel p. S133C (2/4 alleles), and one novel duplication c.49dupTGTGGCG (1/4 alleles) in the IVD gene were revealed in patients with a probable diagnosis of isovaleric aciduria. All new mis- sense mutations were analyzed with Mutation Taster, Polyphen2, Provean Predictor software and were predi cted as deleterious ones. Three- dimensional modelling of novel missense mu- tations also revealed alterations in the structure of protein which could affect its functions. In perspective, these data could be used for the development of a molecular genetic diagnostic algorithm for the patients with isolated MMA, GA I and IVA. REFERENCES 1. Zschocke J. SSIEM Classification of Inborn Errors of Metabolism. In: Blau N, Duran M, Gibson K, Dionisi Vici C. Eds Physician’s Guide to the Diagnosis, Treat- ment, and Follow-Up of Inherited Metabolic Diseases. Berlin, Heidelberg: “Springer” 2014; 817–30. 2. Sanderson S, Green A, Preece MA, Burton H. The incidence of inherited metabolic disorders in the West Midlands, UK. Arch Dis Child. 2006;91(11): 896–9. 3. Vaidyanathan K, Narayanan MP, Vasudevan DM. Organic acidurias: an updated review. Indian J Clin Biochem. 2011;26(4):319–25. 4. Couce ML, Aldamiz-Echevarría L, Bueno MA, Bar- ros P, Belanger-Quintana A, Blasco J, García-Sil- va MT, Márquez-Armenteros AM, Vitoria I, Vives I, 115 Spectrum of mutations in patients with organic acidurias from Ukraine Navarrete R, Fernández-Marmiesse A, Pérez B, Pérez-Cerdá C. Genotype and phenotype character- ization in a Spanish cohort with isovaleric acidemia. J Hum Genet. 2017;62(3):355–360. 5. Mushimoto Y, Fukuda S, Hasegawa Y, Kobayashi H, Purevsuren J, Li H, Taketani T, Yamaguchi S. Clin- ical and molecular investigation of 19 Japanese cases of glutaric acidemia type 1. Mol Genet Metab. 2011;102(3):343–8. 6. Therrell BL, Padilla CD, Loeber JG, Kneisser I, Saadallah A, Borrajo GJ, Adams J. Current status of newborn screening worldwide: 2015. Semin Perinatol. 2015;39(3):171–87. 7. Kurkina MV, Baydakova GV, Zakharova EY. Mo- lecular and biochemical characteristics of the iso- lated methylmalonic aciduria in Russian patients. Med Gen. 2016;15(9):17–28. 8. Forny P, Schnellmann AS, Buerer C, Lutz S, Fow- ler B, Froese DS, Baumgartner MR. Molecular Genetic Characterization of 151 Mut-Type Methyl- malonic Aciduria Patients and Identification of 41 Novel Mutations in MUT. Hum Mutat. 2016;37(8): 745–54. 9. Froese DS, Kochan G, Muniz JR, Wu X, Gileadi C, Ugochukwu E, Krysztofinska E, Gravel RA, Op- permann U, Yue WW. Structures of the human GT- Pase MMAA and vitamin B12-dependent methyl- malonyl-CoA mutase and insight into their complex formation. J Biol Chem. 2010;285(49):38204–13. 10. Tiffany KA, Roberts DL, Wang M, Paschke R, Mohsen AW, Vockley J, Kim JJ. Structure of human isovaleryl-CoA dehydrogenase at 2.6 A resolution: structural basis for substrate specificity,. Biochem- istry. 1997;36(28):8455–64. 11. den Dunnen JT. Sequence Variant Descriptions: HGVS Nomenclature and Mutalyzer. Curr Protoc Hum Genet. 2016;90:7.13.1–7.13.19. 12. Acquaviva C, Benoist JF, Callebaut I, Guffon N, Ogi- er de Baulny H, Touati G, Aydin A, Porquet D, Elion J. N219Y, a new frequent mutation among mut(degree) forms of methylmalonic acidemia in Caucasian pa- tients. Eur J Hum Genet. 2001;9(8):577–82. 13. Goodman SI, Stein DE, Schlesinger S, Christen- sen E, Schwartz M, Greenberg CR, Elpeleg ON. Glutaryl-CoA dehydrogenase mutations in glutaric acidemia (type I): review and report of thirty novel mutations. Hum Mutat. 1998;12(3):141–4. 14. Anikster Y, Shaag A, Joseph A, Mandel H, Ben- Zeev B, Christensen E, Elpeleg ON. Glutaric acid- uria type I in the Arab and Jewish communities in Israel. Am J Hum Genet. 1996;59(5):1012–8. 15. Biery BJ, Stein DE, Morton DH, Goodman SI. Gene structure and mutations of glutaryl-coenzyme A de- hydrogenase: impaired association of enzyme sub- units that is due to an A421V substitution causes glutaric acidemia type I in the Amish. Am J Hum Genet. 1996;59(5):1006–11. 16. Mohsen AW, Anderson BD, Volchenboum SL, Bat- taile KP, Tiffany K, Roberts D, Kim JJ, Vockley J. Characterization of molecular defects in isovaleryl- CoA dehydrogenase in patients with isovaleric aci- demia. Biochemistry. 1998;37(28):10325–35. 17. Busquets C, Merinero B, Christensen E, Gelpí JL, Campistol J, Pineda M, Fernández-Alvarez E, Prats JM, Sans A, Arteaga R, Martí M, Campos J, Martínez- Pardo M, Martínez-Bermejo A, Ruiz-Falcó ML, Vaquer- izo J, Orozco M, Ugarte M, Coll MJ, Ribes A. Glutaryl- CoA dehydrogenase deficiency in Spain: evidence of two groups of patients, genetically, and biochemically distinct. Pediatr Res. 2000;48(3):315–22. 18. Fraidakis MJ, Liadinioti C, Stefanis L, Dinopou- los A, Pons R, Papathanassiou M, Garcia-Villoria J, Ribes A. Rare Late-Onset Presentation of Glutaric Aciduria Type I in a 16-Year-Old Woman with a Novel GCDH Mutation. JIMD Rep. 2015;18:85–92. 19. Ozgul RK, Karaca M, Kilic M, Kucuk O, Yucel- Yilmaz D, Unal O, Hismi B, Aliefendioglu D, Sivri S, Tokatli A, Coskun T, Dursun A. Phenotypic and ge- notypic spectrum of Turkish patients with isovaleric acidemia. Eur J Med Genet. 2014;57(10):596–601. Спектр мутацій у пацієнтів з органічними ацидуріями в Україні О. Ю. Барвінська, Н. В. Ольхович, Т. О. Шкурко, Н. Г. Горовенко Мета. Визначення спектру мутацій у пацієнтів з України, що страждають на глутарову ацидурію I типу, ізольовану метилмалонову ацидурію та ізовалеріанову ацидурію. Методи. Сиквенування за Сенгером. Результати. Було виявлено 37,5 % мутантних алелей 116 O. I. Barvinska, N. V. Olkhovych, T. O. Shkurko et al. (три зразки з восьми) у пацієнтів з ізольованою метил- малоновою ацирурією, 100 % алелей (чотири з чоти- рьох) у хворих з ізовалеріановою ацидурією, 100 % алелей (чотири з чотирьох) у пацієнтів з глутаровою ацидурією I типу. Спектр мутацій у гені MUT у паці- єнтів в Україні представлений однією відомою місенс мутацією с. N219Y та місенс заміною p. R326G. В ре- зультаті аналізу сиквенсу гену GCDH у пацієнтів було виявлено три відомі місенс перебудови p. R383C, p. G390R та p. A421V. Мутації в гені IVD у наших пацієнтів були представлені двома новими перебудо- вами c. 49dupTGTGGCG, p. S133C і однією відомою місенс заміною p. R53P. Висновки. Отримані резуль- тати показали, що спектр мутацій у пацієнтів з орга- нічними ацидуріями в Україні представлений пере- важно рідкісними або ж новими перебудовами. Ці дані можуть бути корисними для розробки молекулярно- генетичного алгоритму діагностики у хворих з України, що мають глутарову ацидурію І типу, ізольовану ме- тилмалонову ацидурію та ізовалеріанову ацидурію. К л юч ов і с л ов а: органічні ацидурії, MUT, GCDH, IVD. Спектр мутаций у пациентов с органическими ацидуриями в Украине А. Ю. Барвинская, Н. В. Ольхович, Т. А. Шкурко, Н. Г. Горовенко Цель. Определение спектра мутаций у пациентов с Украины с глутаровой ацидурией I типа, изолирован- ной метилмалоновой ацидурией и изовалериановой ацидурией. Методы. Сиквенирование за Сэнгером. Результаты. Было выявлено 37,5 % мутантных алле- лей (три образца из восьми) у пациентов с изолиро- ванной метилмалоновой ацидурией, 100 % аллелей (четыре из четырех) у больных с изовалериановой ацидурией, 100 % аллелей (четыре из четырех) у па- циентов с глутаровой ацидурией I типа. Спектр мута- ций в гене MUT у пациентов с Украины представлен одной известной миссенс мутацией с. N219Y и мис- сенс заменой p. R326G. В результате анализа сиквенса гена GCDH пациентов из Украины было обнаружено три известные миссенс перестройки p. R383C, p. G390R и p. A421V. Мутации в гене IVD у наших пациентов были представлены двумя новыми пере- стройками c. 49dupTGTGGCG, p. S133C и одной из- вестной миссенс заменой p. R53P. Выводы. По лу чен- ные результаты показали, что спектр мутаций у паци- ентов с органическими ацидуриями в Украине пред- ставлен в большинстве редкими или новыми пере- стройками. Эти данные могут быть полезными для разработки молекулярно-генетического алгоритма диагностики у больных с глутаровой ацидурией I типа, изолированной метилмалоновой ацидурией, и изова- лериановой ацидурией в Украине. К л юч е в ы е с л ов а: органические ацидурии, MUT, GCDH, IVD Received 02.02.2018 _Hlk517186706