Phylogenetic analysis of two Ukrainian isolates of Wheat streak mosaic virus

The study of molecular characteristics and, in particular, the nucleotide (nt) and amino acid (aa) sequences of the viral genomes, is necessary to know the changes in their geographical range, phylogenetic relationships, viruses’ evolution, and their emergence as new epidemics. Aim. Phylogenetic ana...

Full description

Saved in:
Bibliographic Details
Published in:Вiopolymers and Cell
Date:2019
Main Authors: Mishchenko, L.T., Dunich, A.A., Skrypkina, I.Ya., Kozub, N.O.
Format: Article
Language:English
Published: Інститут молекулярної біології і генетики НАН України 2019
Subjects:
Online Access:https://nasplib.isofts.kiev.ua/handle/123456789/154385
Tags: Add Tag
No Tags, Be the first to tag this record!
Journal Title:Digital Library of Periodicals of National Academy of Sciences of Ukraine
Cite this:Phylogenetic analysis of two Ukrainian isolates of Wheat streak mosaic virus / L.T. Mishchenko, A.A. Dunich, I.Ya. Skrypkina, N.O. Kozub // Вiopolymers and Cell. — 2019. — Т. 35, № 1. — С. 64-77. — Бібліогр.: 26 назв. — англ.

Institution

Digital Library of Periodicals of National Academy of Sciences of Ukraine
_version_ 1859851609291358208
author Mishchenko, L.T.
Dunich, A.A.
Skrypkina, I.Ya.
Kozub, N.O.
author_facet Mishchenko, L.T.
Dunich, A.A.
Skrypkina, I.Ya.
Kozub, N.O.
citation_txt Phylogenetic analysis of two Ukrainian isolates of Wheat streak mosaic virus / L.T. Mishchenko, A.A. Dunich, I.Ya. Skrypkina, N.O. Kozub // Вiopolymers and Cell. — 2019. — Т. 35, № 1. — С. 64-77. — Бібліогр.: 26 назв. — англ.
collection DSpace DC
container_title Вiopolymers and Cell
description The study of molecular characteristics and, in particular, the nucleotide (nt) and amino acid (aa) sequences of the viral genomes, is necessary to know the changes in their geographical range, phylogenetic relationships, viruses’ evolution, and their emergence as new epidemics. Aim. Phylogenetic analysis of the coat protein (CP) gene sequences of two new Ukrainian isolates of Wheat streak mosaic virus: Ukraine-Mal-18 and Ukraine-Ep-18. Results. The nucleotide sequences of 676 nt region of the CP gene of two Ukrainian WSMV isolates were compared with the sequences of 72 WSMV isolates/strains from GenBank. The phylogenetic analysis showed that the Ukrainian WSMV isolates cluster with the clade B or WSMV-ΔE isolates (originating from Europe and Asia) and have a typical for this clade triplet deletion at the position 8412-8414 nt in the CP gene. The isolate Ukraine-Mal-18 has the highest level of the sequence identity (93.5%-95.9% nt and 93.6-95.0% aa) with the clade B isolates. The Ukraine-Ep-18 isolate shares 89.2%-91.4% (nt) and 88.6-87.1% (aa) identity with the clade B isolates. Additionally, both Ukrainian WSMV isolates have a number of unique aa substitutions in the central CP gene domain. Conclusions. Ukrainian WSMV isolates belong to the clade B. But Ukraine-Mal-18 and Ukraine-Ep-18 have some differences from other members of the clade: i) a higher divergence compared to other B isolates (the Ukraine-Mal-18 has 12 aa substitutions, the Ukraine-Ep-18 has 25 aa substitutions, whereas the other clade B isolates have no more than 2 aa substitutions); ii) have aa substitution identical with the B1 non-crop isolates of this virus, many aa substitutions are in the same motifs as the substitutions of B1 grass WSMV isolates. Дослідження молекулярних характеристик, зокрема, нуклеотидних (нт) та амінокислотних (аа) послідовностей вірусних геномів, є необхідним для з’ясування змін у географічному ареалі, філогенетичних зв’язків, еволюції вірусів та їх появи у вигляді епідемій. Мета. Філогенетичний аналіз гену капсидного білка (СР) двох нових українських ізолятів вірусу смугастої мозаїки пшениці (ВСМП) Ukraine-Mal-18 та Ukraine-Ep-18. Методи: імуноферментий аналіз, виділення тотальної РНК із рослинного матеріалу, полімеразна ланцюгова реакція зі зворотною транскрипцією, сиквенування, філогенетичний аналіз. Результати. Послідовності гену СР розміром 676 нт двох українських ізолятів ВСМП порівнювали із послідовностями 72 ВСМП ізолятів/штамів із бази даних GenBank. Філогенетичний аналіз показав, що українські ізоляти входять до клади В або WSMV-ΔE (походять із Європи та Азії) та мають типову для цієї клади делецію триплету у позиціях 8412-8414 нт у гені СР. Ukraine-Mal-18 має найвищий відсоток ідентичності за нуклеотидною послідовністю 93,5%-95,9%, за амінокислотною – 93,6-95,0% із ізолятами клади В. Ізолят Ukraine-Ep-18 із ізолятами клади В має ідентичність 89,2-91,4% (нт) та 88,6%- 87,1% (аа). Крім того, у двох українських ізолятів відмічено низку унікальних аа заміщень в центральній ділянці гену СР. Висновки. Українські ВСМП ізоляти входять до клади В. Але Ukraine-Mal-18 та Ukraine-Ep-18 мають деякі відмінності від них: і) вищу дивергенцію, ніж інші ізоляти групи В (Ukraine-Mal-18 має 12 аа заміщень, Ukraine-Ep-18 має 25 аа заміщень, а інші ізоляти клади В мають 0-2 аа заміщення); іі) мають аа заміщення, ідентичні із непшеничними ізолятами групи В1 цього вірусу, багато аа заміщень знаходяться в тих самих ділянках гену СР, що і заміщення трав’яних В1 ізолятів ВСМП. Исследование молекулярных характеристик, в частности, нуклеотидных (нт) и аминокислотных (аа) последовательностей вирусных геномов, необходимо для выяснения изменений географическогоареала, филогенетических связей, эволюции вирусов и их появления в виде эпидемий. Цель. Филогенетический анализ гена капсидного белка (СР) двух новых украинских изолятов вируса полосатой мозаики пшеницы (ВПМП) Ukraine-Mal-18 и Ukraine-Ep-18. Методы. Иммуноферментный анализ, выделение тотальной РНК из растительного материала, полимеразная цепная реакция с обратной транскрипцией, сиквенирование, филогенетический анализ. Результаты. Последовательности гена СР размером 676 нт двух украинских изолятов ВПМП сравнивали с последовательностями 72 ВПМП изолятов / штаммов из базы данных GenBank. Филогенетический анализ показал, что украинские изоляты входят в кладу В или WSMV-ΔE (происходят из Европы и Азии) и имеют типичную для этой клады делецию триплета в позициях 8412-8414 нт в гене СР. Ukraine-Mal-18 имеет наиболее высокий процент идентичности по нуклеотидной последовательности 93,5%-95,9% и аминокислотной – 93,6-95,0% с изолятами клады В. Изолят Ukraine-Ep-18 с изолятами клады B имеет идентичность 89,2-91,4 % (нт) и 88,6% - 87,1% (аа). Кроме того, у двух украинских изолятов отмечен ряд уникальных аа замен в центральном участке гена СР. Выводы. Украинские ВПМП изоляты входят в кладу В. Но Ukraine-Mal-18 и Ukraine-Ep-18 имеют некоторые отличия от них: i) выше дивергенцию, чем другие изоляты В группы (Ukraine-Mal-18 имеет 12 аа замен, Ukraine-Ep-18 имеет 25 аа замен, а другие изоляты клады В имеют от 0 до 2 аа замен); ii) имеют аа замены, идентичны непшеничным изолятам группы В1 этого вируса, много аа замен расположены в тех же участках гена СР, что и замены травяных В1 изолятов ВПМП.
first_indexed 2025-12-07T15:41:39Z
format Article
fulltext 64 L. T. Mishchenko, A. A. Dunich, I. Ya. Skrypkina © 2019 L. T. Mishchenko et al.; Published by the Institute of Molecular Biology and Genetics, NAS of Ukraine on behalf of Biopolymers and Cell. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted reuse, distribution, and reproduction in any medium, provided the original work is properly cited Viruses and Cell ISSN 0233-7657 Biopolymers and Cell. 2019. Vol. 35. N 1. P 64–77 doi: http://dx.doi.org/10.7124/bc.000997 UDC 578/633.11 Phylogenetic analysis of two Ukrainian isolates of Wheat streak mosaic virus L. T. Mishchenko1, A. A. Dunich1, I. Ya. Skrypkina2, N. O. Kozub3 1 ESC "Institute of Biology and Medicine", Taras Shevchenko National University of Kyiv 64/13, Volodymyrska Str., Kyiv, Ukraine, 01601 2 Institute of Molecular Biology and Genetics, NAS of Ukraine 150, Akademika Zabolotnoho Str., Kyiv, Ukraine, 03143 3 Institute of Food Biotechnology and Genomics, NAS of Ukraine 2A, Osipovskogo Str., Kyiv, Ukraine, 04123 lmishchenko@ukr.net, korenevochka1983@ukr.net The study of molecular characteristics and, in particular, the nucleotide (nt) and amino acid (aa) sequences of the viral genomes, is necessary to know the changes in their geographical range, phylogenetic relationships, viruses’ evolution, and their emergence as new epidemics. Aim. Phylogenetic analysis of the coat protein (CP) gene sequences of two new Ukrainian isolates of Wheat streak mosaic virus: Ukraine-Mal-18 and Ukraine-Ep-18. Results. The nucleotide sequences of 676 nt region of the CP gene of two Ukrainian WSMV isolates were compared with the sequences of 72 WSMV isolates/strains from GenBank. The phylogenetic analysis showed that the Ukrainian WSMV isolates cluster with the clade B or WSMV-ΔE isolates (originating from Europe and Asia) and have a typical for this clade triplet deletion at the position 8412-8414 nt in the CP gene. The isolate Ukraine-Mal-18 has the highest level of the sequence identity (93.5 %-95.9 % nt and 93.6-95.0 % aa) with the clade B isolates. The Ukraine-Ep-18 isolate shares 89.2 %-91.4 % (nt) and 88.6-87.1 % (аа) identity with the clade B isolates. Additionally, both Ukrainian WSMV isolates have a number of unique aa substitu- tions in the central CP gene domain. Conclusions. Ukrainian WSMV isolates belong to the clade B. But Ukraine-Mal-18 and Ukraine-Ep-18 have some differences from other members of the clade: i) a higher divergence compared to other B isolates (the Ukraine-Mal-18 has 12 aa substitutions, the Ukraine-Ep-18 has 25 aa substitutions, where as the other clade B isolates have no more than 2 aa substitutions); ii) have aa substitution identical with the B1 non-crop isolates of this virus, many aa substitutions are in the same motifs as the substitutions of B1 grass WSMV isolates. K e y w o r d s: Wheat streak mosaic virus, Triticum aestivum, phylogenetic analysis, sequen- cing, coat protein mailto:lmishchenko@ukr.net mailto:korenevochka1983@ukr.net 65 Phylogenetic analysis of two Ukrainian isolates of Wheat streak mosaic virus Introduction In recent years, not only the number and prev- alence of cereal viruses have increased expres- sively, but also their economic significance [1, 2]. Wheat streak mosaic virus (WSMV) is the most harmful and widespread virus of cereals in all wheat grown areas in the world. WSMV can cause significant yield losses of wheat – up to 60 % [3] and in some cases – up to 100 %. That is why a detail investigation of WSMV is warranted. WSMV is spread and detected in USA, Canada, Argentina, Australia, Asia, and Europe. In Europe, WSMV was found in Romania, Austria, Czech Republic, France, Hungary, Turkey, Italy, Poland, Russia, Slovakia, and Ukraine. In Lithuania and Germany, this virus was first detected only in 2013 [4, 5]. The WSMV hosts are plant species of the family Poaceae. The main of them are: wheat, barley, maize, oat and many other grasses [6-8]. These species are reservoirs of the virus and its vector. The study of molecular characteristics and in particular, the nucleotide sequences of the genome, provides an opportunity to follow the virus phylogenetic relationships with others, to elucidate its evolutionary history and pros- pects. Furthermore, based on these data it is possible to predict the changes and emergence of new properties in the strains or isolates circulating in a specific area. Based on the coat protein (CP) gene se- quences, WSMV isolates have been divided into four clades, named A–D [4, 9, 10]. Clade A represents one isolate from Mexico, known as El-Batán. Clade B or WSMV-ΔE includes Asian and European isolates [4, 11]. B isolates have a deletion of triplet codon GCA (Glycine amino acid) in the CP gene sequence [11]. Except the CP gene, the differences be- tween isolates from different clades were re- vealed in the putative protein P1/helper-com- ponent-proteinase (HC-Pro) protease cleavage site [4, 12]. Recently, Singh & Kundu [8] proposed a new clade B1 for the WSMV isolates infecting grasses. This clade includes Czech isolates: ar1 detected in Agropyron repens (KY419572), pp1 from Phleum pratense (KY419573), and pp2 from Poa pratensis (KY419574). It was shown that these grass WSMV isolates are more similar to the B isolates rather than to A and D isolates. Moreover, the Czech grass isolates are characterized by the presence of a triplet deletion at the position 8412-8414 nt in the CP gene as well as the clade B isolates. On the other hand, the B1 isolates were slight- ly different from previously described the WSMV isolates from Czech Republic and had several aa substitutions located in the central domain of the CP gene [8]. Clade C comprises isolate from Iran (Ac. No AF454458) [13]. Clade D includes isolates from USA, Canada, Argentina, Australia, Canada, Turkey (AF454455), and Iran (EU914917) [13, 14]. Interestingly, some USA WSMVs have Gly deletion in the CP gene as well as B isolates [14]. The clade D isolates are divided into four subclades, D1-D4 [15, 16]. This clade also includes WSMV described as isolate Ger (Ac. No AJ889242). Isolate Ger actually represents the strain PV57 from North America which had been maintained in the virus collection of the former Institute for Resistance Research and Pathogen Diagnostics in Aschersleben, Germany [4]. 66 L. T. Mishchenko, A. A. Dunich, I. Ya. Skrypkina et al. Analysis of the WSMV whole genomes showed that the clustering of some of them into different clades is based not only on geo- graphical origin. Isolate Saadat-Shahr (Ac. No EU914918) is in the clade B, isolate with Ac. No AF454458 is in the clade C, and one more Iranian isolate Naghadeh (Ac. No EU914917) has high genetic similarity with the clade D isolates [4]. Similar situation is with Turkish isolates. Whereas the isolate Turkei (Ac. No FJ606886) clustered with European isolates from the clade B, another Turkish isolates Turkey1 (Ac. No AF454455) and Turkey2 (Ac. No AF454457) clustered with isolates from the clade D [17]. Isolate Agdia (FJ695510) from Czech Republic is also grouped with the clade D isolates. Noteworthy, considerable attention is paid to the study of wheat viruses in Ukraine, in particular, WMSV. The WSMV` investigation was started in 1968 [18]. In the 1990s the disease was marked with different intensity on winter wheat crops in many regions [19]. Further, study on the WSMV circulation in Ukraine has shown that the virus is distributed in the central and eastern regions of the coun- try. Later, an increase in the impact of climate change on the manifestation and circulation of this virus has been marked [3, 20]. Monitoring of wheat crops in the Poltava, Kyiv and Kharkiv regions of Ukraine in the last years has shown minor damage with WSMV. Earlier, some molecular properties of Poltava isolate of WSMV were investigated [3]. In 2018, we noted the streak symptoms in the fields of winter wheat in the Kharkiv region. So, this study describes the phylogenetic analysis of the CP gene sequences of two new Ukrainian isolates of Wheat streak mosaic virus. Materials and Methods Samples collection. Winter wheat leaf samples with streak symptoms were collected in May 2018 in the fields of Kharkiv region (east part of Ukraine). Enzyme-linked immunosorbent assay. Identification of the viruses in sap of wheat leaves was performed by double-antibody sandwich enzyme-linked immunosorbent assay (DAS-ELISA). Specific antibodies against Wheat streak mosaic virus (WSMV) and Barley yellow mosaic virus (BYDV-PAV) (Loewe, Germany) were used. Antigen sam- ples were prepared by grinding leaf tissue in PBS buffer, pH 7.4, at the ratio 1:2 (w/V). Leaf samples from healthy wheat were also in- cluded as negative controls. Positive controls were commercial (Loewe, Germany). The re- sults were recorded on Termo Labsystems Opsis MR reader (USA) with Dynex Revelation Quicklink software at the wavelength of 405 nm. Samples were considered positive when their absorbance values at 405 nm were at least three times higher than those of negative con- trols [21]. RNA extraction, RT-PCR and sequencing. Total RNA was extracted from fresh leaves using RNeasy Plant Mini kit (Qiagen, Great Britain) following the manufacturer’s instruc- tions. Two-step RT-PCR was performed. The reverse transcription was performed using RevertAid Reverse Transcriptase (Thermo Scientific, USA) according to the manufac- turer’s instructions. Amplification was per- formed using thermocycler (Genetic research instrumentation LTD, Great Britain). WSMV CP-specific primers were used: WS-8166F 5′ GAGAGCAATACTGCGTGTACG 3′ and WS- 8909R 5′ GCATAATGGCTCGAAGTGATG 67 Phylogenetic analysis of two Ukrainian isolates of Wheat streak mosaic virus 3′ [22]. DNA product of 750 bp was amplified. Amplification was performed in 12.5 µl of Dream Taq PCR Master Mix (2x) buffer (con- taining Dream Taq DNA polymerase, 2x Dream Taq buffer, 0.4 mmol/l of each dNTP and 4 mmol/l of MgCl2), 7.5 µl of nuclease- free water, 1 µl of each primer (10 µmol/l), and 3 µl of cDNA. The temperature regime for amplification reactions was as follows: initial denaturation for 3 min at 95°C, followed by 35 cycles of 95°C for 30 s, 55°C for 30 s, and 72°C for 1 min. The final extension was at 72°C for 10 min. PCR products were sepa- rated on a 1.5 % agarose gel with DNA mark- ers MassRuler DNA Ladder Mix ready-to-use (SM 0311, Thermo Scientific, USA), stained with ethidium bromide, and visualized under UV light. The PCR products were purified from the agarose gel using a QIAquick Gel Extraction Kit (Qiagen, Great Britain). Sequencing of the purified amplified DNA fragments was carried out with the 3130 Genetic Analyzer (Applied Biosystems, USA). Phylogenetic analysis. Sequences of Ukrainian WSMV isolates were compared with WSMV sequences in the NCBI database with the BLAST program (http:// www.ncbi.nlm. him.gov). WSMV isolates used in this study are listed in Table 1. Nucleotide and amino acid sequences were aligned using Clustal W in MEGA 7 (http://www.megasoftware.net/). Phylogenetic tree for the part of coat protein gene of 2 Ukrainian WSMV isolates and 72 WSMV isolates from different countries was constructed by the Neighbor-Joining method [23] using the best-fitting model (Jukes – Cantor). To check the reliability of the con- structed tree we used bootstrap test with 1000 bootstrap replications. Multiple alignments of the coat protein amino acid sequences (225 аа) of WSMV isolates were performed by BioEdit program. A B Fig. 1. Winter wheat with symptoms of WSMV-infection: a – cv. Mal- ynivka; b – cv. Epokha Odeska http://www.ncbi.nlm.him.gov http://www.ncbi.nlm.him.gov 68 L. T. Mishchenko, A. A. Dunich, I. Ya. Skrypkina et al. Results and Discussion In 2018, winter wheat plants сv. Malynivka and Epokha Odeska with WSMV-like mild and severe streak symptoms were found near Kharkiv in the east part of Ukraine (Fig.1). DAS-ELISA and RT-PCR showed that both wheat samples were infected with WSMV. BYDV-PAV antigens were not detected. These two samples were taken for this study. The WSMV isolate from wheat cv. Malynivka was Table 1. Nucleotide and amino acid sequence identity of part of the CP gene of the Ukrainian WSMV isolates with isolates/strains from other countries (%) No. Isolate / strain name Accession No in GenBank Host Country of origin Ukraine-Mal-18 Ukraine-Ep-18 Clade nt aa nt aa 1 El Batan 3 AF285170 wheat Mexico 66.0 76.7 62.6 70.3 A 2 Ukraine-Mal-18 MH523356 wheat Ukraine ----- ----- 95.7 93.6 B 3 Ukraine-Ep-18 MH523357 wheat Ukraine 95.7 93.6 ----- ------ B 4 Russia AF454459 wheat Russia 95.9 95.0 91.4 88.6 B 5 Marmagne HG810953 wheat France 94.9 95.0 91.2 88.6 B 6 Czech AF454454 wheat Czech Republic 94.9 95.0 90.8 88.6 B 7 Austria LN624217 wheat Austria 94.2 94.1 90.3 87.6 B 8 Hoym HG810954 wheat Germany 94.7 94.6 90.6 88.1 B 9 Hungary AF454456 wheat Hungary 94.4 94.6 90.3 88.1 B 10 Saadat-Shahr EU914918 wheat Iran 88.8 94.6 84.8 88.6 B 11 Toskana FJ606885 wheat Italy 95.0 95.0 91.4 88.6 B 12 Burgund FJ606884 wheat France 94.0 95.0 90.6 88.6 B 13 WSMV-1313 KJ720819 wheat Lithuania 94.7 94.6 90.6 88.1 B 14 SK512 FJ613359 wheat Slovakia 95.0 94.6 91.0 88.1 B 15 SK349 EU723085 wheat Slovakia 95.0 95.0 90.8 88.6 B 16 SK350 EU723086 wheat Slovakia 94.7 95.0 90.6 88.6 B 17 WSMV-Sz_ KP261825 wheat Poland 93.5 94.1 90.1 87.6 B 18 Turkei FJ606886 wheat Turkey 95.0 95.0 91.0 88.6 B 19 TR KC900901 wheat Turkey 93.5 94.6 89.2 88.1 B 20 KosHJR_ FJ216409 wheat Czech Republic 95.4 95.0 91.4 88.6 B 21 Policko-CRI FJ216412 wheat Czech Republic 95.2 95.0 91.2 88.6 B 22 Turondot KY419568 wheat Czech Republic 95.0 95.0 91.2 88.6 B 23 Hymack KY419569 wheat Czech Republic 95.0 95.0 91.2 88.6 B 24 PoleR FJ216410 wheat Czech Republic 95.0 95.0 91.0 88.6 B 25 SlastJR FJ216414 wheat Czech Republic 94.5 94.6 90.5 88.1 B 26 WSMVcz1 FJ216408 wheat Czech Republic 94.7 94.6 90.6 88.1 B 27 Bodycek KY419571 wheat Czech Republic 94.2 94.6 90.3 88.1 B 28 Avenue KY419570 wheat Czech Republic 94.0 93.6 90.1 87.1 B 29 ar1 KY419572 Agropyron repens Czech Republic 84.4 82.2 81.0 76.7 B1 30 Strain pp1 KY419573 Phleum pratense Czech Republic 84.2 81.7 80.8 76.2 B1 31 Strain pp2 KY419574 Poa pratensis Czech Republic 84.2 81.7 80.8 76.2 B1 32 Iran AF454458 wheat Iran 85.6 94.1 81.6 87.6 C 33 Turkey 1 AF454455 wheat Turkey 84.8 93.1 81.0 86.6 D 34 Ger AJ889242 wheat Germany 85.2 91.6 81.6 85.1 D 69 Phylogenetic analysis of two Ukrainian isolates of Wheat streak mosaic virus No. Isolate / strain name Accession No in GenBank Host Country of origin Ukraine-Mal-18 Ukraine-Ep-18 Clade nt aa nt aa 35 Agdia FJ695510 wheat Czech Republic 85.4 92.1 81.8 85.6 D 36 Arg1 FJ348356 wheat Argentina 85.8 93.6 82.0 87.1 D 37 Arg2 FJ348359 wheat Argentina 85.8 93.6 82.0 87.1 D 38 Arg3 FJ348357 wheat Argentina 85.8 93.6 82.0 87.1 D 39 PV91H AF511639 wheat Kansas, USA 85.0 92.6 81.2 86.1 D 40 MO00 AF511629 wheat Missouri, USA 85.2 93.6 81.4 87.1 D 41 KM93 AF511621 wheat Kansas, USA 84.6 91.6 80.8 85.1 D 42 Strain Sidney 81 AF057533 wheat Nebraska, USA 85.2 93.1 81.4 86.6 D 43 ID96 AF511618 wheat Idaho, USA 84.8 94.1 81.0 87.6 D 44 MON96 AF511630 wheat Montana, USA 84.6 93.1 80.8 86.6 D 45 OSU AF511634 unknown unknown 84.4 91.1 80.8 84.7 D 46 CO87 AF511602 wheat Colorado, USA 84.6 90.6 81.0 84.2 D 47 GO93 AF511606 wheat Kansas, USA 84.6 90.6 81.0 84.2 D 48 CK93 AF511598 wheat Kansas, USA 85.0 93.1 81.2 86.6 D 49 KY0083SV AF511624 wheat Kentucky 84.4 92.1 80.6 85.6 D 50 H95S AF511614 sorghum Kansas, USA 85.2 93.6 81.6 87.1 D 51 WA99 AF511643 maize Washington, USA 85.6 93.6 81.6 87.1 D 52 WO93 AF511644 maize Ohio, USA 85.2 93.1 81.4 86.6 D 53 PV106JM AF511638 maize Ohio, USA 84.2 92.6 81.0 86.1 D 54 Type strain AF285169 wheat Kansas, USA 85.0 91.6 81.4 85.1 D 55 PV106H AF511637 maize Ohio, USA 84.6 90.6 81.0 84.2 D 56 GY93 AF511607 maize Kansas, USA 85.0 93.1 81.2 86.6 D 57 H94PM AF511610 Pennisetum glaucum Kansas, USA 85.0 93.6 81.4 87.1 D 58 WH94S AF511611 sorghum Kansas, USA 86.0 93.1 82.2 86.6 D 59 H94USDA AF511612 sorghum Kansas, USA 85.2 93.1 81.4 86.6 D 60 H95LB AF511613 Hordeum pusillum Kansas, USA 84.6 93.6 80.8 87.1 D 61 H95S AF511614 sorghum Kansas, USA 85.2 93.6 81.6 87.1 D 62 H98_Kansas AF511615 Chloris virgata Kansas, USA 85.8 93.6 82.2 87.1 D 63 Naghadeh EU914917 wheat Iran 85.4 94.6 81.4 88.1 D 64 Gibson DQ888803 wheat Australia 85.4 93.6 81.6 87.1 D 65 Mt. Burdett DQ888801 wheat Australia 85.2 93.6 81.4 87.1 D 66 Tamworth 1 AY327866 wheat Australia 85.6 94.1 81.8 87.6 D 67 Bordertown AY327870 wheat Australia 85.6 94.1 81.8 87.6 D 68 Ginninderra DQ462279 wheat Australia 85.6 94.1 81.8 87.6 D 69 SP-1 DQ462278 wheat Australia 85.6 94.1 81.8 87.6 D 70 SP-6 DQ462277 wheat Australia 85.4 93.6 81.6 87.1 D 71 SP-5 DQ462276 wheat Australia 85.6 94.1 81.8 87.6 D 72 Kondonin DQ888805 wheat Australia 85.6 94.1 81.8 87.6 D 73 Galong DQ888804 wheat Australia 85.4 93.6 81.8 87.6 D 74 Yerritup DQ888802 wheat Australia 85.4 93.6 81.8 87.6 D Continued Table 1 70 L. T. Mishchenko, A. A. Dunich, I. Ya. Skrypkina et al. 71 Phylogenetic analysis of two Ukrainian isolates of Wheat streak mosaic virus Fi g. 2 . N ei gh bo r-J oi ni ng tr ee b as ed o n nu cl eo tid e se qu en ce s of 6 76 b p C P ge ne re gi on o f U kr ai ni an W SM V is ol at es a nd W SM V is ol at es fr om o th er c ou nt rie s. Ju ke s- C an to r m od el w as p er fo rm ed . T he sc al e ba r s ho w s t he n um be r o f s ub st itu tio ns p er b as e. O at n ec ro tic m ot tle v i- ru s, O N M V (A c. N o A F4 54 46 1) u se d as a n ou tg ro up se qu en ce . U kr ai ni an is ol at es a re sh ow n in tr ia ng le s. 72 L. T. Mishchenko, A. A. Dunich, I. Ya. Skrypkina et al. 73 Phylogenetic analysis of two Ukrainian isolates of Wheat streak mosaic virus Fig. 3. Comparative analysis of amino acid sequences of Ukrainian WSMV isolates with thev- clade B and B1 strains. Identical aa variations among sequences are repre- sented with boxes. Amino acid varia- tions in the same re- gions are represent- ed with circles. Numbers on top represent the de- duced CP amino acid position. Only the differences are shown. Accession numbers for isolates used for the align- ment are shown in Table1. 74 L. T. Mishchenko, A. A. Dunich, I. Ya. Skrypkina et al. named Ukraine-Mal-18. The isolate from wheat plants cv. Epokha Odeska was named Ukraine-Ep-18. Nucleotide (nt) sequences 676 nt region of the CP gene of the Ukrainian WSMV isolates, located at the genomic position 8167-8843, were compared with the sequences of 72WSMV isolates/strains from GenBank. Analysis showed that the Ukrainian WSMV isolates have the highest percentage of iden- tity with all wheat European isolates from the clade B. Isolate Ukraine-Mal-18 has the high- est level of the sequence identity (93.5 %-95.9 % nt and 93.6-95.0 % aa) with the clade B isolates. The isolate Ukraine-Ep-18 shares identity of 89.2 %-91.4 % (nt) and 88.6- 87.1 % (аа) with the clade B isolates. (Table 1). Phylogenetic analysis showed that Ukrainian WSMV isolates with all European and Asian wheat isolates (except isolate Agdia from Czech Republic, Ger from Germany, Turkey 1 from Tukey and Iranian isolate Naghadeh) are clustered into the clade B (Fig. 2). Ukrainian isolates, like all isolates of the B and B1 clades, have a triplet deletion at the position 8412-8414 nt in the CP gene in com- parison to isolates from the clade D. Ukraine-Mal-18 and Ukraine-Ep-18 share 80.8 to 82.2 % (nt) and 76.2-82.2 % (aa) iden- tity with isolates from the clade B1, which includes the Czech non-wheat strain ar1 from Agropyron repens (KY419572), strain pp1 from Phleum pratense (KY419573), and strain pp2 from Poa pratensis (KY419574). Clade C isolate, represented by Iranian isolate Iran (Ac. No AF454458), showed similarity of 81.6-85.6 % (nt) and 87.6-94.1 % (aa) to the isolates Ukraine-Ep-18 and Ukraine-Mal-18, respectively. Pairwise comparisons of the Ukrainian isolates with sequences of WSMV isolates from the clade D indicated respective nucleotide and amino acid sequence identities ranging from 80.6 to 85.8 % and 84.2 to 94.6 %. Comparative analysis of aa sequences of Ukrainian isolates with the isolates from clades B and B1 revealed significant differences. Thus, the Ukrainian isolate Ukraine-Mal-18 has 12 aa substitutions in the studied region of the CP gene and Ukraine-Ep-18 has 25 aa substitutions, whereas all other isolates of group B have 0 to 2 aa substitutions (Fig. 3). It is necessary to mention that the substitu- tion А→G at position aa 94 is identical among the Ukrainian and B1 isolates (Fig. 3). However, all other substitutions revealed in putative CP amino acid sequences are unique. Additionally, amino acid substitutions were observed at positions aa 112-116 (F.LFL motif in the central region of CP gene). None of WSMV isolates were characterized by such mutations in this region of the CP gene. Noteworthy, many aa substitutions are in the same motifs or near them like substitutions of the B1 grass WSMV isolates (Fig. 3). These are motifs «№1» (TVESC, 100-104 aa), «№4» (NE.RY.EDPVVFY, 135-147аа) that were pre- viously found in the non-crop WSMV isolates of the B1 clade [8]. Also, the aa sequence of the Ukraine-Ep-18 isolate revealed more aa substitutions in the N-terminal domain of the CP gene, compared with other WSMV isolates (Fig. 3). Conclusions In our study we revealed that Ukrainian WSMV isolates are clustered into the clade B https://context.reverso.net/%D0%BF%D0%B5%D1%80%D0%B5%D0%B2%D0%BE%D0%B4/%D0%B0%D0%BD%D0%B3%D0%BB%D0%B8%D0%B9%D1%81%D0%BA%D0%B8%D0%B9-%D1%80%D1%83%D1%81%D1%81%D0%BA%D0%B8%D0%B9/It+is+necessary+to+mention+that https://context.reverso.net/%D0%BF%D0%B5%D1%80%D0%B5%D0%B2%D0%BE%D0%B4/%D0%B0%D0%BD%D0%B3%D0%BB%D0%B8%D0%B9%D1%81%D0%BA%D0%B8%D0%B9-%D1%80%D1%83%D1%81%D1%81%D0%BA%D0%B8%D0%B9/But+all+the+other 75 Phylogenetic analysis of two Ukrainian isolates of Wheat streak mosaic virus or WSMV-ΔE. The Ukrainian isolates, like other isolates of the B and B1 clades, have a triplet deletion at the position 8412-8414 nt in the CP gene sequence which led to the absence of Glycine amino acid. Noteworthy, the Ukraine-Ep-18 and Ukraine-Mal-18 isolates are the most divergent among the WSMV-ΔE isolates based on amino acid CP sequence. Besides, it was shown that the Ukrainian wheat WSMV isolates have identical aa substitution (А→G, 94аа) with the B1 non-crop isolates of this virus. Also, many aa substitutions are in the same motifs or near them (motif «№1» or TVESC at positions aa 100-104 and motif «№4» or NE.RY.EDPVVFY at positions aa 135-147) that were previously found in the non-crop WSMV isolates of the B1 clade [8]. Also, more aa substitutions in the CP sequence of the Ukraine-Ep-18 isolate were revealed in the N-terminal domain of the CP gene, than all the WSMV isolates taken to our study. It is known that tritimoviruses N-terminal domain of the CP gene is less conserved than the cen- tral and C-terminal regions [24]. Also, it was found that major aa variations between the wheat and grasses WSMVs were in the N-terminal region, namely in the motifs 3 and 4 [8]. However, in the wheat isolate Ukraine- Ep-18 we revealed aa substitutions in the mo- tif 4, in comparison to other European wheat WSMVs. Prendeville et al. [25] suggest that mutations in BYDV from wild grass popula- tions can be connected with the virulence fac- tors and can act as positive fitness elements in wild plants. Recently, it has been revealed that the N-terminal region of tritimoviral CP is involved in the host- and strain-specific long- distance movement [26]. Perhaps, aa substitu- tions in this CP region revealed by us for the isolate Ukraine-Ep-18 led to more severe symptoms, compared with the Ukraine-Mal-18 isolate but this requires additional research. Acknowledgements The authors express their gratitude to the col- leagues PhD. Nyska I. M and corresponding member of NAASU Petrenkova V.P. from The Рlant Production Institute and V. Ya. Yuryev of NAASU for the help in selecting the winter wheat samples. REFERENCES. 1. Spaar D, Ordon F, Rabenstein F, Habekuß A, Schlie- phake E, Schubert J. Economic significance and incidence of cereal viruses in Germany and possi- bilities to avoid virus caused yield losses. Vestnik zascity rastenij. 2008; 1: 14–26. 2. Byamukama E, Wegulo S, Yabwalo D, Lang- ham MAC. Impact of Wheat streak mosaic virus on wheat production in the northern Great Plains region of the United States: A review. In: Proceedings of the 13th International Plant Virus Epidemiology Symposium, 6-10 June 2016. Avignon, France:72. 3. Mishchenko LT. Viral diseases of winter wheat. Кyiv: Phytosociocenter, 2009. 352 p. 4. Schubert J, Ziegler A, Rabenstein F. First detection of wheat streak mosaic virus in Germany: molecu- lar and biological characteristics. Arch Virol. 2015;160(7):1761–6. 5. Urbanavičienė L, Šneideris D, Žižytė M. Wheat streak mosaic virus detected in winter wheat in Lithuania. Zemdirbyste-Agriculture. 2015; 102(1): 111−4. 6. Chalupníková J, Kundu JK, Singh K, Bartaková P, Beoni E. Wheat streak mosaic virus: incidence in field crops, potential reservoir within grass species and uptake in winter wheat cultivars. J Integrat Agricult. 2017; 16(3): 60345–57. 7. DrábT, Svobodová E, Ripl J, Jarošová J, Raben- stein F, Melcher U, Kundu JK. SYBR Green I based RT-qPCR assays for the detection of RNA viruses 76 L. T. Mishchenko, A. A. Dunich, I. Ya. Skrypkina et al. of cereals and grasses. Crop Pasture Sci. 2014; 65(12): 1323–8. 8. Singh K, Kundu JK. Variations in Wheat streak mosaic virus coat protein sequence among crop and non-crop hosts. Crop Pasture Sci. 2017; 68(4): 328–336. 9. Stenger DC, Seifers DL, French R. Patterns of poly- morphism in wheat streak mosaic virus: sequence space explored by a clade of closely related viral genotypes rivals that between the most divergent strains. Virology. 2002;302(1):58–70. 10. Stenger DC, French R. Wheat streak mosaic virus genotypes introduced to Argentina are closely re- lated to isolates from the American Pacific North- west and Australia. Arch Virol. 2009;154(2):331–6. 11. Gadiou S, Kúdela O, Ripl J, Rabenstein F, Kun- du JK, Glasa M. An amino acid deletion in Wheat streak mosaic virus capsid protein distinguishes a homogeneous group of European isolates and fa- cilitates their specific detection. Plant Disease. 2009; 93(11): 1209–13. 12. Choi IR, Horken KM, Stenger DC, French R. Map- ping of the P1 proteinase cleavage site in the poly- protein of Wheat streak mosaic virus (genus Triti- movirus). J Gen Virol. 2002;83(Pt 2):443–50. 13. Dwyer GI, Gibbs MJ, Gibbs AJ, Jones RAC. Wheat streak mosaic virus in Australia: relationship to isolates from the Pacific Northwest of the USA and its dispersion via seed transmission. Plant Disease. 2007; 91(2): 164–70. 14. Robinson MD, Murray TD. Genetic variation of wheat streak mosaic virus in the United States Pa- cific Northwest. Phytopathology. 2013;103(1):98– 104. 15. *French R, Stenger DC. Wheat streak mosaic virus. CMI/AAB Descriptions of Plant Viruses. 393, Wellesbourne, UK: Assoc. Appl. Biol., 2002. 16. Singh K, Wegulo SN, Skoracka A, Kundu JK. Wheat streak mosaic virus: a century old virus with rising importance worldwide. Mol Plant Pathol. 2018;19(9):2193–2206. 17. Rabenstein F, Seifers DL, Schubert J, French R, Stenger DC. Phylogenetic relationships, strain di- versity and biogeography of tritimoviruses. J Gen Virol. 2002;83(Pt 4):895–906. 18. *Oliynyk AN. Wheat streak mosaic in Ukraine. Kyiv, Ukraine, Danylo Zabolotny Institute of Microbio- logy and Virology, PhD Thesis, 1968. 19. *Reshetnyk GV, Mishchenko LT, Boyko AL, Kole- snyk LV. [Detection of Wheat streak mosaic virus in some regions of Ukraine]. Mikrobiol Zh. 1996; 58(2): 39–45. 20. *Mishchenko LT, Dunich AA, Mishchenko IA, Pet- renkova VP, Mukha TI. Monitoring of economi- cally important wheat viruses under weather condi- tions change in Ukraine and investigation of seed transmission of Wheat streak mosaic virus. Bulg J Agricult Sci. 2018; 24(4): 660–9. 21. *Crowther JR. ELISA. Theory and Practice. NY, USA, Hamana Press, 1995. 223 p. 22. Kúdela O, Kúdelová M, Nováková S, Glasa M. First report of Wheat streak mosaic virus in Slovakia. Disease Notes. 2008; 92(9): 1365. 23. Saitou N, Nei M. The neighbor-joining method: A new method for reconstructing phylogenetic trees. Mol Biol Evol. 1987; 4(4): 406–25. 24. Tatineni S, French R. The C-terminus of Wheat streak mosaic virus coat protein is involved in dif- ferential infection of wheat and maize through host- specific long-distance transport. Mol Plant Microbe Interact. 2014;27(2):150–62. 25. Prendeville HR, Tenhumberg B, Pilson D. Effects of virus on plant fecundity and population dynamics. New Phytol. 2014;202(4):1346–56. 26. Tatineni S, Van Winkle DH, French R. The N-termi- nal region of wheat streak mosaic virus coat protein is a host- and strain-specific long-distance transport factor. J Virol. 2011;85(4):1718–31. Філогенетичний аналіз двох українських ізолятів вірусу смугастої мозаїки пшениці Л. Т. Міщенко, А. А. Дуніч, І. Я. Скрипкіна, Н. О. Козуб Дослідження молекулярних характеристик, зокрема, нуклеотидних (нт) та амінокислотних (аа) послідов- ностей вірусних геномів, є необхідним для з’ясування змін у географічному ареалі, філогенетичних зв’язків, еволюції вірусів та їх появи у вигляді епідемій. Мета. Філогенетичний аналіз гену капсидного білка (СР) 77 Phylogenetic analysis of two Ukrainian isolates of Wheat streak mosaic virus двох нових українських ізолятів вірусу смугастої мо- заїки пшениці (ВСМП) Ukraine-Mal-18 та Ukraine- Ep-18. Методи: імуноферментий аналіз, виділення тотальної РНК із рослинного матеріалу, полімеразна ланцюгова реакція зі зворотною транскрипцією, сик- венування, філогенетичний аналіз. Результати. Послідовності гену СР розміром 676 нт двох україн- ських ізолятів ВСМП порівнювали із послідовностями 72 ВСМП ізолятів/штамів із бази даних GenBank. Філогенетичний аналіз показав, що українські ізоляти входять до клади В або WSMV-ΔE (походять із Європи та Азії) та мають типову для цієї клади делецію три- плету у позиціях 8412-8414 нт у гені СР. Ukraine- Mal-18 має найвищий відсоток ідентичності за нукле- отидною послідовністю 93,5 %-95,9 %, за амінокис- лотною – 93,6-95,0 % із ізолятами клади В. Ізолят Ukraine-Ep-18 із ізолятами клади В має ідентичність 89,2-91,4 % (нт) та 88,6 %- 87,1 % (аа). Крім того, у двох українських ізолятів відмічено низку унікальних аа заміщень в центральній ділянці гену СР. Висновки. Українські ВСМП ізоляти входять до клади В. Але Ukraine-Mal-18 та Ukraine-Ep-18 мають деякі відмін- ності від них: і) вищу дивергенцію, ніж інші ізоляти групи В (Ukraine-Mal-18 має 12 аа заміщень, Ukraine- Ep-18 має 25 аа заміщень, а інші ізоляти клади В мають 0-2 аа заміщення); іі) мають аа заміщення, ідентичні із непшеничними ізолятами групи В1 цього вірусу, багато аа заміщень знаходяться в тих самих ділянках гену СР, що і заміщення трав’яних В1 ізолятів ВСМП. К л юч ов і с л ов а: вірус смугастої мозаїки пшениці, Triticum aestivum, філогенетичний аналіз, сиквенуван- ня, капсидний білок. Филогенетический анализ двух украинских изолятов вируса полосатой мозаики пшеницы Л. Т. Мищенко, А. А. Дунич, И. Я. Скрипкина, Н. А. Козуб Исследование молекулярных характеристик, в частно- сти, нуклеотидных (нт) и аминокислотных (аа) после- довательностей вирусных геномов, необходимо для выяснения изменений географического ареала, фило- генетических связей, эволюции вирусов и их появле- ния в виде эпидемий. Цель. Филогенетический анализ гена капсидного белка (СР) двух новых украинских изолятов вируса полосатой мозаики пшеницы (ВПМП) Ukraine-Mal-18 и Ukraine-Ep-18. Методы. Иммуно- фер ментный анализ, выделение тотальной РНК из растительного материала, полимеразная цепная реак- ция с обратной транскрипцией, сиквенирование, фи- логенетический анализ. Результаты. Последова тель- нос ти гена СР размером 676 нт двух украинских изо- лятов ВПМП сравнивали с последовательностями 72 ВПМП изолятов / штаммов из базы данных GenBank. Филогенетический анализ показал, что укра- инские изоляты входят в кладу В или WSMV-ΔE (про- исходят из Европы и Азии) и имеют типичную для этой клады делецию триплета в позициях 8412-8414 нт в гене СР. Ukraine-Mal-18 имеет наиболее высокий процент идентичности по нуклеотидной последова- тельности 93,5 %-95,9 % и аминокислотной – 93,6- 95,0 % с изолятами клады В. Изолят Ukraine-Ep-18 с изолятами клады B имеет идентичность 89,2-91,4 % (нт) и 88,6 % - 87,1 % (аа). Кроме того, у двух украин- ских изолятов отмечен ряд уникальных аа замен в центральном участке гена СР. Выводы. Украинские ВПМП изоляты входят в кладу В. Но Ukraine-Mal-18 и Ukraine-Ep-18 имеют некоторые отличия от них: i) выше дивергенцию, чем другие изоляты В группы (Ukraine-Mal-18 имеет 12 аа замен, Ukraine-Ep-18 имеет 25 аа замен, а другие изоляты клады В имеют от 0 до 2 аа замен); ii) имеют аа замены, идентичны непшеничным изолятам группы В1 этого вируса, мно- го аа замен расположены в тех же участках гена СР, что и замены травяных В1 изолятов ВПМП. К л юч е в ы е с л ов а: вирус полосатой мозаики пше- ницы, Triticum aestivum, филогенетический анализ, сиквенирование, капсидный белок. Received 03.04.2018
id nasplib_isofts_kiev_ua-123456789-154385
institution Digital Library of Periodicals of National Academy of Sciences of Ukraine
issn 0233-7657
language English
last_indexed 2025-12-07T15:41:39Z
publishDate 2019
publisher Інститут молекулярної біології і генетики НАН України
record_format dspace
spelling Mishchenko, L.T.
Dunich, A.A.
Skrypkina, I.Ya.
Kozub, N.O.
2019-06-15T14:56:47Z
2019-06-15T14:56:47Z
2019
Phylogenetic analysis of two Ukrainian isolates of Wheat streak mosaic virus / L.T. Mishchenko, A.A. Dunich, I.Ya. Skrypkina, N.O. Kozub // Вiopolymers and Cell. — 2019. — Т. 35, № 1. — С. 64-77. — Бібліогр.: 26 назв. — англ.
0233-7657
DOI: http://dx.doi.org/10.7124/bc.000997
https://nasplib.isofts.kiev.ua/handle/123456789/154385
578/633.11
The study of molecular characteristics and, in particular, the nucleotide (nt) and amino acid (aa) sequences of the viral genomes, is necessary to know the changes in their geographical range, phylogenetic relationships, viruses’ evolution, and their emergence as new epidemics. Aim. Phylogenetic analysis of the coat protein (CP) gene sequences of two new Ukrainian isolates of Wheat streak mosaic virus: Ukraine-Mal-18 and Ukraine-Ep-18. Results. The nucleotide sequences of 676 nt region of the CP gene of two Ukrainian WSMV isolates were compared with the sequences of 72 WSMV isolates/strains from GenBank. The phylogenetic analysis showed that the Ukrainian WSMV isolates cluster with the clade B or WSMV-ΔE isolates (originating from Europe and Asia) and have a typical for this clade triplet deletion at the position 8412-8414 nt in the CP gene. The isolate Ukraine-Mal-18 has the highest level of the sequence identity (93.5%-95.9% nt and 93.6-95.0% aa) with the clade B isolates. The Ukraine-Ep-18 isolate shares 89.2%-91.4% (nt) and 88.6-87.1% (aa) identity with the clade B isolates. Additionally, both Ukrainian WSMV isolates have a number of unique aa substitutions in the central CP gene domain. Conclusions. Ukrainian WSMV isolates belong to the clade B. But Ukraine-Mal-18 and Ukraine-Ep-18 have some differences from other members of the clade: i) a higher divergence compared to other B isolates (the Ukraine-Mal-18 has 12 aa substitutions, the Ukraine-Ep-18 has 25 aa substitutions, whereas the other clade B isolates have no more than 2 aa substitutions); ii) have aa substitution identical with the B1 non-crop isolates of this virus, many aa substitutions are in the same motifs as the substitutions of B1 grass WSMV isolates.
Дослідження молекулярних характеристик, зокрема, нуклеотидних (нт) та амінокислотних (аа) послідовностей вірусних геномів, є необхідним для з’ясування змін у географічному ареалі, філогенетичних зв’язків, еволюції вірусів та їх появи у вигляді епідемій. Мета. Філогенетичний аналіз гену капсидного білка (СР) двох нових українських ізолятів вірусу смугастої мозаїки пшениці (ВСМП) Ukraine-Mal-18 та Ukraine-Ep-18. Методи: імуноферментий аналіз, виділення тотальної РНК із рослинного матеріалу, полімеразна ланцюгова реакція зі зворотною транскрипцією, сиквенування, філогенетичний аналіз. Результати. Послідовності гену СР розміром 676 нт двох українських ізолятів ВСМП порівнювали із послідовностями 72 ВСМП ізолятів/штамів із бази даних GenBank. Філогенетичний аналіз показав, що українські ізоляти входять до клади В або WSMV-ΔE (походять із Європи та Азії) та мають типову для цієї клади делецію триплету у позиціях 8412-8414 нт у гені СР. Ukraine-Mal-18 має найвищий відсоток ідентичності за нуклеотидною послідовністю 93,5%-95,9%, за амінокислотною – 93,6-95,0% із ізолятами клади В. Ізолят Ukraine-Ep-18 із ізолятами клади В має ідентичність 89,2-91,4% (нт) та 88,6%- 87,1% (аа). Крім того, у двох українських ізолятів відмічено низку унікальних аа заміщень в центральній ділянці гену СР. Висновки. Українські ВСМП ізоляти входять до клади В. Але Ukraine-Mal-18 та Ukraine-Ep-18 мають деякі відмінності від них: і) вищу дивергенцію, ніж інші ізоляти групи В (Ukraine-Mal-18 має 12 аа заміщень, Ukraine-Ep-18 має 25 аа заміщень, а інші ізоляти клади В мають 0-2 аа заміщення); іі) мають аа заміщення, ідентичні із непшеничними ізолятами групи В1 цього вірусу, багато аа заміщень знаходяться в тих самих ділянках гену СР, що і заміщення трав’яних В1 ізолятів ВСМП.
Исследование молекулярных характеристик, в частности, нуклеотидных (нт) и аминокислотных (аа) последовательностей вирусных геномов, необходимо для выяснения изменений географическогоареала, филогенетических связей, эволюции вирусов и их появления в виде эпидемий. Цель. Филогенетический анализ гена капсидного белка (СР) двух новых украинских изолятов вируса полосатой мозаики пшеницы (ВПМП) Ukraine-Mal-18 и Ukraine-Ep-18. Методы. Иммуноферментный анализ, выделение тотальной РНК из растительного материала, полимеразная цепная реакция с обратной транскрипцией, сиквенирование, филогенетический анализ. Результаты. Последовательности гена СР размером 676 нт двух украинских изолятов ВПМП сравнивали с последовательностями 72 ВПМП изолятов / штаммов из базы данных GenBank. Филогенетический анализ показал, что украинские изоляты входят в кладу В или WSMV-ΔE (происходят из Европы и Азии) и имеют типичную для этой клады делецию триплета в позициях 8412-8414 нт в гене СР. Ukraine-Mal-18 имеет наиболее высокий процент идентичности по нуклеотидной последовательности 93,5%-95,9% и аминокислотной – 93,6-95,0% с изолятами клады В. Изолят Ukraine-Ep-18 с изолятами клады B имеет идентичность 89,2-91,4 % (нт) и 88,6% - 87,1% (аа). Кроме того, у двух украинских изолятов отмечен ряд уникальных аа замен в центральном участке гена СР. Выводы. Украинские ВПМП изоляты входят в кладу В. Но Ukraine-Mal-18 и Ukraine-Ep-18 имеют некоторые отличия от них: i) выше дивергенцию, чем другие изоляты В группы (Ukraine-Mal-18 имеет 12 аа замен, Ukraine-Ep-18 имеет 25 аа замен, а другие изоляты клады В имеют от 0 до 2 аа замен); ii) имеют аа замены, идентичны непшеничным изолятам группы В1 этого вируса, много аа замен расположены в тех же участках гена СР, что и замены травяных В1 изолятов ВПМП.
en
Інститут молекулярної біології і генетики НАН України
Вiopolymers and Cell
Viruses and Cell
Phylogenetic analysis of two Ukrainian isolates of Wheat streak mosaic virus
Філогенетичний аналіз двох українських ізолятів вірусу смугастої мозаїки пшениці
Филогенетический анализ двух украинских изолятов вируса полосатой мозаики пшеницы
Article
published earlier
spellingShingle Phylogenetic analysis of two Ukrainian isolates of Wheat streak mosaic virus
Mishchenko, L.T.
Dunich, A.A.
Skrypkina, I.Ya.
Kozub, N.O.
Viruses and Cell
title Phylogenetic analysis of two Ukrainian isolates of Wheat streak mosaic virus
title_alt Філогенетичний аналіз двох українських ізолятів вірусу смугастої мозаїки пшениці
Филогенетический анализ двух украинских изолятов вируса полосатой мозаики пшеницы
title_full Phylogenetic analysis of two Ukrainian isolates of Wheat streak mosaic virus
title_fullStr Phylogenetic analysis of two Ukrainian isolates of Wheat streak mosaic virus
title_full_unstemmed Phylogenetic analysis of two Ukrainian isolates of Wheat streak mosaic virus
title_short Phylogenetic analysis of two Ukrainian isolates of Wheat streak mosaic virus
title_sort phylogenetic analysis of two ukrainian isolates of wheat streak mosaic virus
topic Viruses and Cell
topic_facet Viruses and Cell
url https://nasplib.isofts.kiev.ua/handle/123456789/154385
work_keys_str_mv AT mishchenkolt phylogeneticanalysisoftwoukrainianisolatesofwheatstreakmosaicvirus
AT dunichaa phylogeneticanalysisoftwoukrainianisolatesofwheatstreakmosaicvirus
AT skrypkinaiya phylogeneticanalysisoftwoukrainianisolatesofwheatstreakmosaicvirus
AT kozubno phylogeneticanalysisoftwoukrainianisolatesofwheatstreakmosaicvirus
AT mishchenkolt fílogenetičniianalízdvohukraínsʹkihízolâtívvírususmugastoímozaíkipšenicí
AT dunichaa fílogenetičniianalízdvohukraínsʹkihízolâtívvírususmugastoímozaíkipšenicí
AT skrypkinaiya fílogenetičniianalízdvohukraínsʹkihízolâtívvírususmugastoímozaíkipšenicí
AT kozubno fílogenetičniianalízdvohukraínsʹkihízolâtívvírususmugastoímozaíkipšenicí
AT mishchenkolt filogenetičeskiianalizdvuhukrainskihizolâtovvirusapolosatoimozaikipšenicy
AT dunichaa filogenetičeskiianalizdvuhukrainskihizolâtovvirusapolosatoimozaikipšenicy
AT skrypkinaiya filogenetičeskiianalizdvuhukrainskihizolâtovvirusapolosatoimozaikipšenicy
AT kozubno filogenetičeskiianalizdvuhukrainskihizolâtovvirusapolosatoimozaikipšenicy