Phylogenetic analysis of two Ukrainian isolates of Wheat streak mosaic virus
The study of molecular characteristics and, in particular, the nucleotide (nt) and amino acid (aa) sequences of the viral genomes, is necessary to know the changes in their geographical range, phylogenetic relationships, viruses’ evolution, and their emergence as new epidemics. Aim. Phylogenetic ana...
Gespeichert in:
| Veröffentlicht in: | Вiopolymers and Cell |
|---|---|
| Datum: | 2019 |
| Hauptverfasser: | , , , |
| Format: | Artikel |
| Sprache: | Englisch |
| Veröffentlicht: |
Інститут молекулярної біології і генетики НАН України
2019
|
| Schlagworte: | |
| Online Zugang: | https://nasplib.isofts.kiev.ua/handle/123456789/154385 |
| Tags: |
Tag hinzufügen
Keine Tags, Fügen Sie den ersten Tag hinzu!
|
| Назва журналу: | Digital Library of Periodicals of National Academy of Sciences of Ukraine |
| Zitieren: | Phylogenetic analysis of two Ukrainian isolates of Wheat streak mosaic virus / L.T. Mishchenko, A.A. Dunich, I.Ya. Skrypkina, N.O. Kozub // Вiopolymers and Cell. — 2019. — Т. 35, № 1. — С. 64-77. — Бібліогр.: 26 назв. — англ. |
Institution
Digital Library of Periodicals of National Academy of Sciences of Ukraine| _version_ | 1859851609291358208 |
|---|---|
| author | Mishchenko, L.T. Dunich, A.A. Skrypkina, I.Ya. Kozub, N.O. |
| author_facet | Mishchenko, L.T. Dunich, A.A. Skrypkina, I.Ya. Kozub, N.O. |
| citation_txt | Phylogenetic analysis of two Ukrainian isolates of Wheat streak mosaic virus / L.T. Mishchenko, A.A. Dunich, I.Ya. Skrypkina, N.O. Kozub // Вiopolymers and Cell. — 2019. — Т. 35, № 1. — С. 64-77. — Бібліогр.: 26 назв. — англ. |
| collection | DSpace DC |
| container_title | Вiopolymers and Cell |
| description | The study of molecular characteristics and, in particular, the nucleotide (nt) and amino acid (aa) sequences of the viral genomes, is necessary to know the changes in their geographical range, phylogenetic relationships, viruses’ evolution, and their emergence as new epidemics. Aim. Phylogenetic analysis of the coat protein (CP) gene sequences of two new Ukrainian isolates of Wheat streak mosaic virus: Ukraine-Mal-18 and Ukraine-Ep-18. Results. The nucleotide sequences of 676 nt region of the CP gene of two Ukrainian WSMV isolates were compared with the sequences of 72 WSMV isolates/strains from GenBank. The phylogenetic analysis showed that the Ukrainian WSMV isolates cluster with the clade B or WSMV-ΔE isolates (originating from Europe and Asia) and have a typical for this clade triplet deletion at the position 8412-8414 nt in the CP gene. The isolate Ukraine-Mal-18 has the highest level of the sequence identity (93.5%-95.9% nt and 93.6-95.0% aa) with the clade B isolates. The Ukraine-Ep-18 isolate shares 89.2%-91.4% (nt) and 88.6-87.1% (aa) identity with the clade B isolates. Additionally, both Ukrainian WSMV isolates have a number of unique aa substitutions in the central CP gene domain. Conclusions. Ukrainian WSMV isolates belong to the clade B. But Ukraine-Mal-18 and Ukraine-Ep-18 have some differences from other members of the clade: i) a higher divergence compared to other B isolates (the Ukraine-Mal-18 has 12 aa substitutions, the Ukraine-Ep-18 has 25 aa substitutions, whereas the other clade B isolates have no more than 2 aa substitutions); ii) have aa substitution identical with the B1 non-crop isolates of this virus, many aa substitutions are in the same motifs as the substitutions of B1 grass WSMV isolates.
Дослідження молекулярних характеристик, зокрема, нуклеотидних (нт) та амінокислотних (аа) послідовностей вірусних геномів, є необхідним для з’ясування змін у географічному ареалі, філогенетичних зв’язків, еволюції вірусів та їх появи у вигляді епідемій. Мета. Філогенетичний аналіз гену капсидного білка (СР) двох нових українських ізолятів вірусу смугастої мозаїки пшениці (ВСМП) Ukraine-Mal-18 та Ukraine-Ep-18. Методи: імуноферментий аналіз, виділення тотальної РНК із рослинного матеріалу, полімеразна ланцюгова реакція зі зворотною транскрипцією, сиквенування, філогенетичний аналіз. Результати. Послідовності гену СР розміром 676 нт двох українських ізолятів ВСМП порівнювали із послідовностями 72 ВСМП ізолятів/штамів із бази даних GenBank. Філогенетичний аналіз показав, що українські ізоляти входять до клади В або WSMV-ΔE (походять із Європи та Азії) та мають типову для цієї клади делецію триплету у позиціях 8412-8414 нт у гені СР. Ukraine-Mal-18 має найвищий відсоток ідентичності за нуклеотидною послідовністю 93,5%-95,9%, за амінокислотною – 93,6-95,0% із ізолятами клади В. Ізолят Ukraine-Ep-18 із ізолятами клади В має ідентичність 89,2-91,4% (нт) та 88,6%- 87,1% (аа). Крім того, у двох українських ізолятів відмічено низку унікальних аа заміщень в центральній ділянці гену СР. Висновки. Українські ВСМП ізоляти входять до клади В. Але Ukraine-Mal-18 та Ukraine-Ep-18 мають деякі відмінності від них: і) вищу дивергенцію, ніж інші ізоляти групи В (Ukraine-Mal-18 має 12 аа заміщень, Ukraine-Ep-18 має 25 аа заміщень, а інші ізоляти клади В мають 0-2 аа заміщення); іі) мають аа заміщення, ідентичні із непшеничними ізолятами групи В1 цього вірусу, багато аа заміщень знаходяться в тих самих ділянках гену СР, що і заміщення трав’яних В1 ізолятів ВСМП.
Исследование молекулярных характеристик, в частности, нуклеотидных (нт) и аминокислотных (аа) последовательностей вирусных геномов, необходимо для выяснения изменений географическогоареала, филогенетических связей, эволюции вирусов и их появления в виде эпидемий. Цель. Филогенетический анализ гена капсидного белка (СР) двух новых украинских изолятов вируса полосатой мозаики пшеницы (ВПМП) Ukraine-Mal-18 и Ukraine-Ep-18. Методы. Иммуноферментный анализ, выделение тотальной РНК из растительного материала, полимеразная цепная реакция с обратной транскрипцией, сиквенирование, филогенетический анализ. Результаты. Последовательности гена СР размером 676 нт двух украинских изолятов ВПМП сравнивали с последовательностями 72 ВПМП изолятов / штаммов из базы данных GenBank. Филогенетический анализ показал, что украинские изоляты входят в кладу В или WSMV-ΔE (происходят из Европы и Азии) и имеют типичную для этой клады делецию триплета в позициях 8412-8414 нт в гене СР. Ukraine-Mal-18 имеет наиболее высокий процент идентичности по нуклеотидной последовательности 93,5%-95,9% и аминокислотной – 93,6-95,0% с изолятами клады В. Изолят Ukraine-Ep-18 с изолятами клады B имеет идентичность 89,2-91,4 % (нт) и 88,6% - 87,1% (аа). Кроме того, у двух украинских изолятов отмечен ряд уникальных аа замен в центральном участке гена СР. Выводы. Украинские ВПМП изоляты входят в кладу В. Но Ukraine-Mal-18 и Ukraine-Ep-18 имеют некоторые отличия от них: i) выше дивергенцию, чем другие изоляты В группы (Ukraine-Mal-18 имеет 12 аа замен, Ukraine-Ep-18 имеет 25 аа замен, а другие изоляты клады В имеют от 0 до 2 аа замен); ii) имеют аа замены, идентичны непшеничным изолятам группы В1 этого вируса, много аа замен расположены в тех же участках гена СР, что и замены травяных В1 изолятов ВПМП.
|
| first_indexed | 2025-12-07T15:41:39Z |
| format | Article |
| fulltext |
64
L. T. Mishchenko, A. A. Dunich, I. Ya. Skrypkina
© 2019 L. T. Mishchenko et al.; Published by the Institute of Molecular Biology and Genetics, NAS of Ukraine on behalf
of Biopolymers and Cell. This is an Open Access article distributed under the terms of the Creative Commons Attribution
License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted reuse, distribution, and reproduction in any
medium, provided the original work is properly cited
Viruses and Cell ISSN 0233-7657
Biopolymers and Cell. 2019. Vol. 35. N 1. P 64–77
doi: http://dx.doi.org/10.7124/bc.000997
UDC 578/633.11
Phylogenetic analysis of two Ukrainian isolates
of Wheat streak mosaic virus
L. T. Mishchenko1, A. A. Dunich1, I. Ya. Skrypkina2, N. O. Kozub3
1 ESC "Institute of Biology and Medicine", Taras Shevchenko National University of Kyiv
64/13, Volodymyrska Str., Kyiv, Ukraine, 01601
2 Institute of Molecular Biology and Genetics, NAS of Ukraine
150, Akademika Zabolotnoho Str., Kyiv, Ukraine, 03143
3 Institute of Food Biotechnology and Genomics, NAS of Ukraine
2A, Osipovskogo Str., Kyiv, Ukraine, 04123
lmishchenko@ukr.net, korenevochka1983@ukr.net
The study of molecular characteristics and, in particular, the nucleotide (nt) and amino acid
(aa) sequences of the viral genomes, is necessary to know the changes in their geographical
range, phylogenetic relationships, viruses’ evolution, and their emergence as new epidemics.
Aim. Phylogenetic analysis of the coat protein (CP) gene sequences of two new Ukrainian
isolates of Wheat streak mosaic virus: Ukraine-Mal-18 and Ukraine-Ep-18. Results. The
nucleotide sequences of 676 nt region of the CP gene of two Ukrainian WSMV isolates were
compared with the sequences of 72 WSMV isolates/strains from GenBank. The phylogenetic
analysis showed that the Ukrainian WSMV isolates cluster with the clade B or WSMV-ΔE
isolates (originating from Europe and Asia) and have a typical for this clade triplet deletion at
the position 8412-8414 nt in the CP gene. The isolate Ukraine-Mal-18 has the highest level
of the sequence identity (93.5 %-95.9 % nt and 93.6-95.0 % aa) with the clade B isolates. The
Ukraine-Ep-18 isolate shares 89.2 %-91.4 % (nt) and 88.6-87.1 % (аа) identity with the clade
B isolates. Additionally, both Ukrainian WSMV isolates have a number of unique aa substitu-
tions in the central CP gene domain. Conclusions. Ukrainian WSMV isolates belong to the
clade B. But Ukraine-Mal-18 and Ukraine-Ep-18 have some differences from other members
of the clade: i) a higher divergence compared to other B isolates (the Ukraine-Mal-18 has 12 aa
substitutions, the Ukraine-Ep-18 has 25 aa substitutions, where as the other clade B isolates
have no more than 2 aa substitutions); ii) have aa substitution identical with the B1 non-crop
isolates of this virus, many aa substitutions are in the same motifs as the substitutions of
B1 grass WSMV isolates.
K e y w o r d s: Wheat streak mosaic virus, Triticum aestivum, phylogenetic analysis, sequen-
cing, coat protein
mailto:lmishchenko@ukr.net
mailto:korenevochka1983@ukr.net
65
Phylogenetic analysis of two Ukrainian isolates of Wheat streak mosaic virus
Introduction
In recent years, not only the number and prev-
alence of cereal viruses have increased expres-
sively, but also their economic significance [1,
2]. Wheat streak mosaic virus (WSMV) is the
most harmful and widespread virus of cereals
in all wheat grown areas in the world. WSMV
can cause significant yield losses of wheat – up
to 60 % [3] and in some cases – up to 100 %.
That is why a detail investigation of WSMV
is warranted. WSMV is spread and detected in
USA, Canada, Argentina, Australia, Asia, and
Europe. In Europe, WSMV was found in
Romania, Austria, Czech Republic, France,
Hungary, Turkey, Italy, Poland, Russia,
Slovakia, and Ukraine. In Lithuania and
Germany, this virus was first detected only in
2013 [4, 5]. The WSMV hosts are plant species
of the family Poaceae. The main of them are:
wheat, barley, maize, oat and many other
grasses [6-8]. These species are reservoirs of
the virus and its vector.
The study of molecular characteristics and
in particular, the nucleotide sequences of the
genome, provides an opportunity to follow the
virus phylogenetic relationships with others,
to elucidate its evolutionary history and pros-
pects. Furthermore, based on these data it is
possible to predict the changes and emergence
of new properties in the strains or isolates
circulating in a specific area.
Based on the coat protein (CP) gene se-
quences, WSMV isolates have been divided
into four clades, named A–D [4, 9, 10].
Clade A represents one isolate from Mexico,
known as El-Batán. Clade B or WSMV-ΔE
includes Asian and European isolates [4, 11].
B isolates have a deletion of triplet codon GCA
(Glycine amino acid) in the CP gene sequence
[11]. Except the CP gene, the differences be-
tween isolates from different clades were re-
vealed in the putative protein P1/helper-com-
ponent-proteinase (HC-Pro) protease cleavage
site [4, 12].
Recently, Singh & Kundu [8] proposed a
new clade B1 for the WSMV isolates infecting
grasses. This clade includes Czech isolates:
ar1 detected in Agropyron repens (KY419572),
pp1 from Phleum pratense (KY419573), and
pp2 from Poa pratensis (KY419574). It was
shown that these grass WSMV isolates are
more similar to the B isolates rather than to A
and D isolates. Moreover, the Czech grass
isolates are characterized by the presence of a
triplet deletion at the position 8412-8414 nt in
the CP gene as well as the clade B isolates.
On the other hand, the B1 isolates were slight-
ly different from previously described the
WSMV isolates from Czech Republic and had
several aa substitutions located in the central
domain of the CP gene [8].
Clade C comprises isolate from Iran (Ac.
No AF454458) [13].
Clade D includes isolates from USA,
Canada, Argentina, Australia, Canada, Turkey
(AF454455), and Iran (EU914917) [13, 14].
Interestingly, some USA WSMVs have Gly
deletion in the CP gene as well as B isolates
[14]. The clade D isolates are divided into four
subclades, D1-D4 [15, 16]. This clade also
includes WSMV described as isolate Ger (Ac.
No AJ889242). Isolate Ger actually represents
the strain PV57 from North America which
had been maintained in the virus collection of
the former Institute for Resistance Research
and Pathogen Diagnostics in Aschersleben,
Germany [4].
66
L. T. Mishchenko, A. A. Dunich, I. Ya. Skrypkina et al.
Analysis of the WSMV whole genomes
showed that the clustering of some of them
into different clades is based not only on geo-
graphical origin. Isolate Saadat-Shahr (Ac. No
EU914918) is in the clade B, isolate with Ac.
No AF454458 is in the clade C, and one more
Iranian isolate Naghadeh (Ac. No EU914917)
has high genetic similarity with the clade D
isolates [4]. Similar situation is with Turkish
isolates. Whereas the isolate Turkei (Ac. No
FJ606886) clustered with European isolates
from the clade B, another Turkish isolates
Turkey1 (Ac. No AF454455) and Turkey2 (Ac.
No AF454457) clustered with isolates from the
clade D [17]. Isolate Agdia (FJ695510) from
Czech Republic is also grouped with the clade
D isolates.
Noteworthy, considerable attention is paid
to the study of wheat viruses in Ukraine, in
particular, WMSV. The WSMV` investigation
was started in 1968 [18]. In the 1990s the
disease was marked with different intensity on
winter wheat crops in many regions [19].
Further, study on the WSMV circulation in
Ukraine has shown that the virus is distributed
in the central and eastern regions of the coun-
try. Later, an increase in the impact of climate
change on the manifestation and circulation of
this virus has been marked [3, 20]. Monitoring
of wheat crops in the Poltava, Kyiv and
Kharkiv regions of Ukraine in the last years
has shown minor damage with WSMV. Earlier,
some molecular properties of Poltava isolate
of WSMV were investigated [3]. In 2018, we
noted the streak symptoms in the fields of
winter wheat in the Kharkiv region. So, this
study describes the phylogenetic analysis of
the CP gene sequences of two new Ukrainian
isolates of Wheat streak mosaic virus.
Materials and Methods
Samples collection. Winter wheat leaf samples
with streak symptoms were collected in May
2018 in the fields of Kharkiv region (east part
of Ukraine).
Enzyme-linked immunosorbent assay.
Identification of the viruses in sap of wheat
leaves was performed by double-antibody
sandwich enzyme-linked immunosorbent assay
(DAS-ELISA). Specific antibodies against
Wheat streak mosaic virus (WSMV) and
Barley yellow mosaic virus (BYDV-PAV)
(Loewe, Germany) were used. Antigen sam-
ples were prepared by grinding leaf tissue in
PBS buffer, pH 7.4, at the ratio 1:2 (w/V). Leaf
samples from healthy wheat were also in-
cluded as negative controls. Positive controls
were commercial (Loewe, Germany). The re-
sults were recorded on Termo Labsystems
Opsis MR reader (USA) with Dynex Revelation
Quicklink software at the wavelength of 405
nm. Samples were considered positive when
their absorbance values at 405 nm were at least
three times higher than those of negative con-
trols [21].
RNA extraction, RT-PCR and sequencing.
Total RNA was extracted from fresh leaves
using RNeasy Plant Mini kit (Qiagen, Great
Britain) following the manufacturer’s instruc-
tions. Two-step RT-PCR was performed. The
reverse transcription was performed using
RevertAid Reverse Transcriptase (Thermo
Scientific, USA) according to the manufac-
turer’s instructions. Amplification was per-
formed using thermocycler (Genetic research
instrumentation LTD, Great Britain). WSMV
CP-specific primers were used: WS-8166F 5′
GAGAGCAATACTGCGTGTACG 3′ and WS-
8909R 5′ GCATAATGGCTCGAAGTGATG
67
Phylogenetic analysis of two Ukrainian isolates of Wheat streak mosaic virus
3′ [22]. DNA product of 750 bp was amplified.
Amplification was performed in 12.5 µl of
Dream Taq PCR Master Mix (2x) buffer (con-
taining Dream Taq DNA polymerase, 2x
Dream Taq buffer, 0.4 mmol/l of each dNTP
and 4 mmol/l of MgCl2), 7.5 µl of nuclease-
free water, 1 µl of each primer (10 µmol/l),
and 3 µl of cDNA. The temperature regime for
amplification reactions was as follows: initial
denaturation for 3 min at 95°C, followed by
35 cycles of 95°C for 30 s, 55°C for 30 s, and
72°C for 1 min. The final extension was at
72°C for 10 min. PCR products were sepa-
rated on a 1.5 % agarose gel with DNA mark-
ers MassRuler DNA Ladder Mix ready-to-use
(SM 0311, Thermo Scientific, USA), stained
with ethidium bromide, and visualized under
UV light. The PCR products were purified
from the agarose gel using a QIAquick Gel
Extraction Kit (Qiagen, Great Britain).
Sequencing of the purified amplified DNA
fragments was carried out with the 3130
Genetic Analyzer (Applied Biosystems, USA).
Phylogenetic analysis. Sequences of
Ukrainian WSMV isolates were compared with
WSMV sequences in the NCBI database with
the BLAST program (http:// www.ncbi.nlm.
him.gov). WSMV isolates used in this study
are listed in Table 1. Nucleotide and amino
acid sequences were aligned using Clustal W
in MEGA 7 (http://www.megasoftware.net/).
Phylogenetic tree for the part of coat protein
gene of 2 Ukrainian WSMV isolates and 72
WSMV isolates from different countries was
constructed by the Neighbor-Joining method
[23] using the best-fitting model (Jukes –
Cantor). To check the reliability of the con-
structed tree we used bootstrap test with 1000
bootstrap replications. Multiple alignments of
the coat protein amino acid sequences (225 аа)
of WSMV isolates were performed by BioEdit
program.
A
B
Fig. 1. Winter wheat with symptoms
of WSMV-infection: a – cv. Mal-
ynivka; b – cv. Epokha Odeska
http://www.ncbi.nlm.him.gov
http://www.ncbi.nlm.him.gov
68
L. T. Mishchenko, A. A. Dunich, I. Ya. Skrypkina et al.
Results and Discussion
In 2018, winter wheat plants сv. Malynivka
and Epokha Odeska with WSMV-like mild and
severe streak symptoms were found near
Kharkiv in the east part of Ukraine (Fig.1).
DAS-ELISA and RT-PCR showed that both
wheat samples were infected with WSMV.
BYDV-PAV antigens were not detected. These
two samples were taken for this study. The
WSMV isolate from wheat cv. Malynivka was
Table 1. Nucleotide and amino acid sequence identity of part of the CP gene of the Ukrainian WSMV
isolates with isolates/strains from other countries (%)
No. Isolate / strain
name
Accession No
in GenBank Host Country of origin
Ukraine-Mal-18 Ukraine-Ep-18
Clade
nt aa nt aa
1 El Batan 3 AF285170 wheat Mexico 66.0 76.7 62.6 70.3 A
2 Ukraine-Mal-18 MH523356 wheat Ukraine ----- ----- 95.7 93.6 B
3 Ukraine-Ep-18 MH523357 wheat Ukraine 95.7 93.6 ----- ------ B
4 Russia AF454459 wheat Russia 95.9 95.0 91.4 88.6 B
5 Marmagne HG810953 wheat France 94.9 95.0 91.2 88.6 B
6 Czech AF454454 wheat Czech Republic 94.9 95.0 90.8 88.6 B
7 Austria LN624217 wheat Austria 94.2 94.1 90.3 87.6 B
8 Hoym HG810954 wheat Germany 94.7 94.6 90.6 88.1 B
9 Hungary AF454456 wheat Hungary 94.4 94.6 90.3 88.1 B
10 Saadat-Shahr EU914918 wheat Iran 88.8 94.6 84.8 88.6 B
11 Toskana FJ606885 wheat Italy 95.0 95.0 91.4 88.6 B
12 Burgund FJ606884 wheat France 94.0 95.0 90.6 88.6 B
13 WSMV-1313 KJ720819 wheat Lithuania 94.7 94.6 90.6 88.1 B
14 SK512 FJ613359 wheat Slovakia 95.0 94.6 91.0 88.1 B
15 SK349 EU723085 wheat Slovakia 95.0 95.0 90.8 88.6 B
16 SK350 EU723086 wheat Slovakia 94.7 95.0 90.6 88.6 B
17 WSMV-Sz_ KP261825 wheat Poland 93.5 94.1 90.1 87.6 B
18 Turkei FJ606886 wheat Turkey 95.0 95.0 91.0 88.6 B
19 TR KC900901 wheat Turkey 93.5 94.6 89.2 88.1 B
20 KosHJR_ FJ216409 wheat Czech Republic 95.4 95.0 91.4 88.6 B
21 Policko-CRI FJ216412 wheat Czech Republic 95.2 95.0 91.2 88.6 B
22 Turondot KY419568 wheat Czech Republic 95.0 95.0 91.2 88.6 B
23 Hymack KY419569 wheat Czech Republic 95.0 95.0 91.2 88.6 B
24 PoleR FJ216410 wheat Czech Republic 95.0 95.0 91.0 88.6 B
25 SlastJR FJ216414 wheat Czech Republic 94.5 94.6 90.5 88.1 B
26 WSMVcz1 FJ216408 wheat Czech Republic 94.7 94.6 90.6 88.1 B
27 Bodycek KY419571 wheat Czech Republic 94.2 94.6 90.3 88.1 B
28 Avenue KY419570 wheat Czech Republic 94.0 93.6 90.1 87.1 B
29 ar1 KY419572 Agropyron repens Czech Republic 84.4 82.2 81.0 76.7 B1
30 Strain pp1 KY419573 Phleum pratense Czech Republic 84.2 81.7 80.8 76.2 B1
31 Strain pp2 KY419574 Poa pratensis Czech Republic 84.2 81.7 80.8 76.2 B1
32 Iran AF454458 wheat Iran 85.6 94.1 81.6 87.6 C
33 Turkey 1 AF454455 wheat Turkey 84.8 93.1 81.0 86.6 D
34 Ger AJ889242 wheat Germany 85.2 91.6 81.6 85.1 D
69
Phylogenetic analysis of two Ukrainian isolates of Wheat streak mosaic virus
No. Isolate / strain
name
Accession No
in GenBank Host Country of origin
Ukraine-Mal-18 Ukraine-Ep-18
Clade
nt aa nt aa
35 Agdia FJ695510 wheat Czech Republic 85.4 92.1 81.8 85.6 D
36 Arg1 FJ348356 wheat Argentina 85.8 93.6 82.0 87.1 D
37 Arg2 FJ348359 wheat Argentina 85.8 93.6 82.0 87.1 D
38 Arg3 FJ348357 wheat Argentina 85.8 93.6 82.0 87.1 D
39 PV91H AF511639 wheat Kansas, USA 85.0 92.6 81.2 86.1 D
40 MO00 AF511629 wheat Missouri, USA 85.2 93.6 81.4 87.1 D
41 KM93 AF511621 wheat Kansas, USA 84.6 91.6 80.8 85.1 D
42 Strain Sidney 81 AF057533 wheat Nebraska, USA 85.2 93.1 81.4 86.6 D
43 ID96 AF511618 wheat Idaho, USA 84.8 94.1 81.0 87.6 D
44 MON96 AF511630 wheat Montana, USA 84.6 93.1 80.8 86.6 D
45 OSU AF511634 unknown unknown 84.4 91.1 80.8 84.7 D
46 CO87 AF511602 wheat Colorado, USA 84.6 90.6 81.0 84.2 D
47 GO93 AF511606 wheat Kansas, USA 84.6 90.6 81.0 84.2 D
48 CK93 AF511598 wheat Kansas, USA 85.0 93.1 81.2 86.6 D
49 KY0083SV AF511624 wheat Kentucky 84.4 92.1 80.6 85.6 D
50 H95S AF511614 sorghum Kansas, USA 85.2 93.6 81.6 87.1 D
51 WA99 AF511643 maize Washington, USA 85.6 93.6 81.6 87.1 D
52 WO93 AF511644 maize Ohio, USA 85.2 93.1 81.4 86.6 D
53 PV106JM AF511638 maize Ohio, USA 84.2 92.6 81.0 86.1 D
54 Type strain AF285169 wheat Kansas, USA 85.0 91.6 81.4 85.1 D
55 PV106H AF511637 maize Ohio, USA 84.6 90.6 81.0 84.2 D
56 GY93 AF511607 maize Kansas, USA 85.0 93.1 81.2 86.6 D
57 H94PM AF511610 Pennisetum
glaucum
Kansas, USA 85.0 93.6 81.4 87.1 D
58 WH94S AF511611 sorghum Kansas, USA 86.0 93.1 82.2 86.6 D
59 H94USDA AF511612 sorghum Kansas, USA 85.2 93.1 81.4 86.6 D
60 H95LB AF511613 Hordeum
pusillum
Kansas, USA 84.6 93.6 80.8 87.1 D
61 H95S AF511614 sorghum Kansas, USA 85.2 93.6 81.6 87.1 D
62 H98_Kansas AF511615 Chloris virgata Kansas, USA 85.8 93.6 82.2 87.1 D
63 Naghadeh EU914917 wheat Iran 85.4 94.6 81.4 88.1 D
64 Gibson DQ888803 wheat Australia 85.4 93.6 81.6 87.1 D
65 Mt. Burdett DQ888801 wheat Australia 85.2 93.6 81.4 87.1 D
66 Tamworth 1 AY327866 wheat Australia 85.6 94.1 81.8 87.6 D
67 Bordertown AY327870 wheat Australia 85.6 94.1 81.8 87.6 D
68 Ginninderra DQ462279 wheat Australia 85.6 94.1 81.8 87.6 D
69 SP-1 DQ462278 wheat Australia 85.6 94.1 81.8 87.6 D
70 SP-6 DQ462277 wheat Australia 85.4 93.6 81.6 87.1 D
71 SP-5 DQ462276 wheat Australia 85.6 94.1 81.8 87.6 D
72 Kondonin DQ888805 wheat Australia 85.6 94.1 81.8 87.6 D
73 Galong DQ888804 wheat Australia 85.4 93.6 81.8 87.6 D
74 Yerritup DQ888802 wheat Australia 85.4 93.6 81.8 87.6 D
Continued Table 1
70
L. T. Mishchenko, A. A. Dunich, I. Ya. Skrypkina et al.
71
Phylogenetic analysis of two Ukrainian isolates of Wheat streak mosaic virus
Fi
g.
2
. N
ei
gh
bo
r-J
oi
ni
ng
tr
ee
b
as
ed
o
n
nu
cl
eo
tid
e
se
qu
en
ce
s
of
6
76
b
p
C
P
ge
ne
re
gi
on
o
f U
kr
ai
ni
an
W
SM
V
is
ol
at
es
a
nd
W
SM
V
is
ol
at
es
fr
om
o
th
er
c
ou
nt
rie
s.
Ju
ke
s-
C
an
to
r m
od
el
w
as
p
er
fo
rm
ed
. T
he
sc
al
e
ba
r s
ho
w
s t
he
n
um
be
r o
f s
ub
st
itu
tio
ns
p
er
b
as
e.
O
at
n
ec
ro
tic
m
ot
tle
v
i-
ru
s,
O
N
M
V
(A
c.
N
o
A
F4
54
46
1)
u
se
d
as
a
n
ou
tg
ro
up
se
qu
en
ce
. U
kr
ai
ni
an
is
ol
at
es
a
re
sh
ow
n
in
tr
ia
ng
le
s.
72
L. T. Mishchenko, A. A. Dunich, I. Ya. Skrypkina et al.
73
Phylogenetic analysis of two Ukrainian isolates of Wheat streak mosaic virus
Fig. 3. Comparative
analysis of amino
acid sequences of
Ukrainian WSMV
isolates with thev-
clade B and B1
strains. Identical aa
variations among
sequences are repre-
sented with boxes.
Amino acid varia-
tions in the same re-
gions are represent-
ed with circles.
Numbers on top
represent the de-
duced CP amino
acid position. Only
the differences are
shown. Accession
numbers for isolates
used for the align-
ment are shown in
Table1.
74
L. T. Mishchenko, A. A. Dunich, I. Ya. Skrypkina et al.
named Ukraine-Mal-18. The isolate from
wheat plants cv. Epokha Odeska was named
Ukraine-Ep-18.
Nucleotide (nt) sequences 676 nt region of
the CP gene of the Ukrainian WSMV isolates,
located at the genomic position 8167-8843,
were compared with the sequences of
72WSMV isolates/strains from GenBank.
Analysis showed that the Ukrainian WSMV
isolates have the highest percentage of iden-
tity with all wheat European isolates from the
clade B. Isolate Ukraine-Mal-18 has the high-
est level of the sequence identity
(93.5 %-95.9 % nt and 93.6-95.0 % aa) with
the clade B isolates. The isolate Ukraine-Ep-18
shares identity of 89.2 %-91.4 % (nt) and 88.6-
87.1 % (аа) with the clade B isolates. (Table 1).
Phylogenetic analysis showed that
Ukrainian WSMV isolates with all European
and Asian wheat isolates (except isolate Agdia
from Czech Republic, Ger from Germany,
Turkey 1 from Tukey and Iranian isolate
Naghadeh) are clustered into the clade B
(Fig. 2).
Ukrainian isolates, like all isolates of the B
and B1 clades, have a triplet deletion at the
position 8412-8414 nt in the CP gene in com-
parison to isolates from the clade D.
Ukraine-Mal-18 and Ukraine-Ep-18 share
80.8 to 82.2 % (nt) and 76.2-82.2 % (aa) iden-
tity with isolates from the clade B1, which
includes the Czech non-wheat strain ar1 from
Agropyron repens (KY419572), strain pp1
from Phleum pratense (KY419573), and strain
pp2 from Poa pratensis (KY419574). Clade
C isolate, represented by Iranian isolate Iran
(Ac. No AF454458), showed similarity of
81.6-85.6 % (nt) and 87.6-94.1 % (aa) to the
isolates Ukraine-Ep-18 and Ukraine-Mal-18,
respectively. Pairwise comparisons of the
Ukrainian isolates with sequences of WSMV
isolates from the clade D indicated respective
nucleotide and amino acid sequence identities
ranging from 80.6 to 85.8 % and 84.2 to
94.6 %.
Comparative analysis of aa sequences of
Ukrainian isolates with the isolates from clades
B and B1 revealed significant differences.
Thus, the Ukrainian isolate Ukraine-Mal-18
has 12 aa substitutions in the studied region of
the CP gene and Ukraine-Ep-18 has 25 aa
substitutions, whereas all other isolates of
group B have 0 to 2 aa substitutions (Fig. 3).
It is necessary to mention that the substitu-
tion А→G at position aa 94 is identical among
the Ukrainian and B1 isolates (Fig. 3).
However, all other substitutions revealed in
putative CP amino acid sequences are unique.
Additionally, amino acid substitutions were
observed at positions aa 112-116 (F.LFL motif
in the central region of CP gene). None of
WSMV isolates were characterized by such
mutations in this region of the CP gene.
Noteworthy, many aa substitutions are in the
same motifs or near them like substitutions of
the B1 grass WSMV isolates (Fig. 3). These
are motifs «№1» (TVESC, 100-104 aa), «№4»
(NE.RY.EDPVVFY, 135-147аа) that were pre-
viously found in the non-crop WSMV isolates
of the B1 clade [8]. Also, the aa sequence of
the Ukraine-Ep-18 isolate revealed more aa
substitutions in the N-terminal domain of the
CP gene, compared with other WSMV isolates
(Fig. 3).
Conclusions
In our study we revealed that Ukrainian
WSMV isolates are clustered into the clade B
https://context.reverso.net/%D0%BF%D0%B5%D1%80%D0%B5%D0%B2%D0%BE%D0%B4/%D0%B0%D0%BD%D0%B3%D0%BB%D0%B8%D0%B9%D1%81%D0%BA%D0%B8%D0%B9-%D1%80%D1%83%D1%81%D1%81%D0%BA%D0%B8%D0%B9/It+is+necessary+to+mention+that
https://context.reverso.net/%D0%BF%D0%B5%D1%80%D0%B5%D0%B2%D0%BE%D0%B4/%D0%B0%D0%BD%D0%B3%D0%BB%D0%B8%D0%B9%D1%81%D0%BA%D0%B8%D0%B9-%D1%80%D1%83%D1%81%D1%81%D0%BA%D0%B8%D0%B9/But+all+the+other
75
Phylogenetic analysis of two Ukrainian isolates of Wheat streak mosaic virus
or WSMV-ΔE. The Ukrainian isolates, like
other isolates of the B and B1 clades, have a
triplet deletion at the position 8412-8414 nt in
the CP gene sequence which led to the absence
of Glycine amino acid. Noteworthy, the
Ukraine-Ep-18 and Ukraine-Mal-18 isolates
are the most divergent among the WSMV-ΔE
isolates based on amino acid CP sequence.
Besides, it was shown that the Ukrainian wheat
WSMV isolates have identical aa substitution
(А→G, 94аа) with the B1 non-crop isolates of
this virus. Also, many aa substitutions are in
the same motifs or near them (motif «№1» or
TVESC at positions aa 100-104 and motif
«№4» or NE.RY.EDPVVFY at positions aa
135-147) that were previously found in the
non-crop WSMV isolates of the B1 clade [8].
Also, more aa substitutions in the CP sequence
of the Ukraine-Ep-18 isolate were revealed in
the N-terminal domain of the CP gene, than
all the WSMV isolates taken to our study. It is
known that tritimoviruses N-terminal domain
of the CP gene is less conserved than the cen-
tral and C-terminal regions [24]. Also, it was
found that major aa variations between the
wheat and grasses WSMVs were in the
N-terminal region, namely in the motifs 3 and
4 [8]. However, in the wheat isolate Ukraine-
Ep-18 we revealed aa substitutions in the mo-
tif 4, in comparison to other European wheat
WSMVs. Prendeville et al. [25] suggest that
mutations in BYDV from wild grass popula-
tions can be connected with the virulence fac-
tors and can act as positive fitness elements in
wild plants. Recently, it has been revealed that
the N-terminal region of tritimoviral CP is
involved in the host- and strain-specific long-
distance movement [26]. Perhaps, aa substitu-
tions in this CP region revealed by us for the
isolate Ukraine-Ep-18 led to more severe
symptoms, compared with the Ukraine-Mal-18
isolate but this requires additional research.
Acknowledgements
The authors express their gratitude to the col-
leagues PhD. Nyska I. M and corresponding
member of NAASU Petrenkova V.P. from The
Рlant Production Institute and V. Ya. Yuryev
of NAASU for the help in selecting the winter
wheat samples.
REFERENCES.
1. Spaar D, Ordon F, Rabenstein F, Habekuß A, Schlie-
phake E, Schubert J. Economic significance and
incidence of cereal viruses in Germany and possi-
bilities to avoid virus caused yield losses. Vestnik
zascity rastenij. 2008; 1: 14–26.
2. Byamukama E, Wegulo S, Yabwalo D, Lang-
ham MAC. Impact of Wheat streak mosaic virus on
wheat production in the northern Great Plains region
of the United States: A review. In: Proceedings of
the 13th International Plant Virus Epidemiology
Symposium, 6-10 June 2016. Avignon, France:72.
3. Mishchenko LT. Viral diseases of winter wheat.
Кyiv: Phytosociocenter, 2009. 352 p.
4. Schubert J, Ziegler A, Rabenstein F. First detection
of wheat streak mosaic virus in Germany: molecu-
lar and biological characteristics. Arch Virol.
2015;160(7):1761–6.
5. Urbanavičienė L, Šneideris D, Žižytė M. Wheat
streak mosaic virus detected in winter wheat in
Lithuania. Zemdirbyste-Agriculture. 2015; 102(1):
111−4.
6. Chalupníková J, Kundu JK, Singh K, Bartaková P,
Beoni E. Wheat streak mosaic virus: incidence in
field crops, potential reservoir within grass species
and uptake in winter wheat cultivars. J Integrat
Agricult. 2017; 16(3): 60345–57.
7. DrábT, Svobodová E, Ripl J, Jarošová J, Raben-
stein F, Melcher U, Kundu JK. SYBR Green I based
RT-qPCR assays for the detection of RNA viruses
76
L. T. Mishchenko, A. A. Dunich, I. Ya. Skrypkina et al.
of cereals and grasses. Crop Pasture Sci. 2014;
65(12): 1323–8.
8. Singh K, Kundu JK. Variations in Wheat streak
mosaic virus coat protein sequence among crop and
non-crop hosts. Crop Pasture Sci. 2017; 68(4):
328–336.
9. Stenger DC, Seifers DL, French R. Patterns of poly-
morphism in wheat streak mosaic virus: sequence
space explored by a clade of closely related viral
genotypes rivals that between the most divergent
strains. Virology. 2002;302(1):58–70.
10. Stenger DC, French R. Wheat streak mosaic virus
genotypes introduced to Argentina are closely re-
lated to isolates from the American Pacific North-
west and Australia. Arch Virol. 2009;154(2):331–6.
11. Gadiou S, Kúdela O, Ripl J, Rabenstein F, Kun-
du JK, Glasa M. An amino acid deletion in Wheat
streak mosaic virus capsid protein distinguishes a
homogeneous group of European isolates and fa-
cilitates their specific detection. Plant Disease.
2009; 93(11): 1209–13.
12. Choi IR, Horken KM, Stenger DC, French R. Map-
ping of the P1 proteinase cleavage site in the poly-
protein of Wheat streak mosaic virus (genus Triti-
movirus). J Gen Virol. 2002;83(Pt 2):443–50.
13. Dwyer GI, Gibbs MJ, Gibbs AJ, Jones RAC. Wheat
streak mosaic virus in Australia: relationship to
isolates from the Pacific Northwest of the USA and
its dispersion via seed transmission. Plant Disease.
2007; 91(2): 164–70.
14. Robinson MD, Murray TD. Genetic variation of
wheat streak mosaic virus in the United States Pa-
cific Northwest. Phytopathology. 2013;103(1):98–
104.
15. *French R, Stenger DC. Wheat streak mosaic virus.
CMI/AAB Descriptions of Plant Viruses. 393,
Wellesbourne, UK: Assoc. Appl. Biol., 2002.
16. Singh K, Wegulo SN, Skoracka A, Kundu JK. Wheat
streak mosaic virus: a century old virus with rising
importance worldwide. Mol Plant Pathol.
2018;19(9):2193–2206.
17. Rabenstein F, Seifers DL, Schubert J, French R,
Stenger DC. Phylogenetic relationships, strain di-
versity and biogeography of tritimoviruses. J Gen
Virol. 2002;83(Pt 4):895–906.
18. *Oliynyk AN. Wheat streak mosaic in Ukraine. Kyiv,
Ukraine, Danylo Zabolotny Institute of Microbio-
logy and Virology, PhD Thesis, 1968.
19. *Reshetnyk GV, Mishchenko LT, Boyko AL, Kole-
snyk LV. [Detection of Wheat streak mosaic virus
in some regions of Ukraine]. Mikrobiol Zh. 1996;
58(2): 39–45.
20. *Mishchenko LT, Dunich AA, Mishchenko IA, Pet-
renkova VP, Mukha TI. Monitoring of economi-
cally important wheat viruses under weather condi-
tions change in Ukraine and investigation of seed
transmission of Wheat streak mosaic virus. Bulg J
Agricult Sci. 2018; 24(4): 660–9.
21. *Crowther JR. ELISA. Theory and Practice. NY,
USA, Hamana Press, 1995. 223 p.
22. Kúdela O, Kúdelová M, Nováková S, Glasa M. First
report of Wheat streak mosaic virus in Slovakia.
Disease Notes. 2008; 92(9): 1365.
23. Saitou N, Nei M. The neighbor-joining method:
A new method for reconstructing phylogenetic trees.
Mol Biol Evol. 1987; 4(4): 406–25.
24. Tatineni S, French R. The C-terminus of Wheat
streak mosaic virus coat protein is involved in dif-
ferential infection of wheat and maize through host-
specific long-distance transport. Mol Plant Microbe
Interact. 2014;27(2):150–62.
25. Prendeville HR, Tenhumberg B, Pilson D. Effects
of virus on plant fecundity and population dynamics.
New Phytol. 2014;202(4):1346–56.
26. Tatineni S, Van Winkle DH, French R. The N-termi-
nal region of wheat streak mosaic virus coat protein
is a host- and strain-specific long-distance transport
factor. J Virol. 2011;85(4):1718–31.
Філогенетичний аналіз двох українських
ізолятів вірусу смугастої мозаїки пшениці
Л. Т. Міщенко, А. А. Дуніч, І. Я. Скрипкіна,
Н. О. Козуб
Дослідження молекулярних характеристик, зокрема,
нуклеотидних (нт) та амінокислотних (аа) послідов-
ностей вірусних геномів, є необхідним для з’ясування
змін у географічному ареалі, філогенетичних зв’язків,
еволюції вірусів та їх появи у вигляді епідемій. Мета.
Філогенетичний аналіз гену капсидного білка (СР)
77
Phylogenetic analysis of two Ukrainian isolates of Wheat streak mosaic virus
двох нових українських ізолятів вірусу смугастої мо-
заїки пшениці (ВСМП) Ukraine-Mal-18 та Ukraine-
Ep-18. Методи: імуноферментий аналіз, виділення
тотальної РНК із рослинного матеріалу, полімеразна
ланцюгова реакція зі зворотною транскрипцією, сик-
венування, філогенетичний аналіз. Результати.
Послідовності гену СР розміром 676 нт двох україн-
ських ізолятів ВСМП порівнювали із послідовностями
72 ВСМП ізолятів/штамів із бази даних GenBank.
Філогенетичний аналіз показав, що українські ізоляти
входять до клади В або WSMV-ΔE (походять із Європи
та Азії) та мають типову для цієї клади делецію три-
плету у позиціях 8412-8414 нт у гені СР. Ukraine-
Mal-18 має найвищий відсоток ідентичності за нукле-
отидною послідовністю 93,5 %-95,9 %, за амінокис-
лотною – 93,6-95,0 % із ізолятами клади В. Ізолят
Ukraine-Ep-18 із ізолятами клади В має ідентичність
89,2-91,4 % (нт) та 88,6 %- 87,1 % (аа). Крім того, у
двох українських ізолятів відмічено низку унікальних
аа заміщень в центральній ділянці гену СР. Висновки.
Українські ВСМП ізоляти входять до клади В. Але
Ukraine-Mal-18 та Ukraine-Ep-18 мають деякі відмін-
ності від них: і) вищу дивергенцію, ніж інші ізоляти
групи В (Ukraine-Mal-18 має 12 аа заміщень, Ukraine-
Ep-18 має 25 аа заміщень, а інші ізоляти клади В мають
0-2 аа заміщення); іі) мають аа заміщення, ідентичні
із непшеничними ізолятами групи В1 цього вірусу,
багато аа заміщень знаходяться в тих самих ділянках
гену СР, що і заміщення трав’яних В1 ізолятів ВСМП.
К л юч ов і с л ов а: вірус смугастої мозаїки пшениці,
Triticum aestivum, філогенетичний аналіз, сиквенуван-
ня, капсидний білок.
Филогенетический анализ двух украинских
изолятов вируса полосатой мозаики пшеницы
Л. Т. Мищенко, А. А. Дунич, И. Я. Скрипкина,
Н. А. Козуб
Исследование молекулярных характеристик, в частно-
сти, нуклеотидных (нт) и аминокислотных (аа) после-
довательностей вирусных геномов, необходимо для
выяснения изменений географического ареала, фило-
генетических связей, эволюции вирусов и их появле-
ния в виде эпидемий. Цель. Филогенетический анализ
гена капсидного белка (СР) двух новых украинских
изолятов вируса полосатой мозаики пшеницы (ВПМП)
Ukraine-Mal-18 и Ukraine-Ep-18. Методы. Иммуно-
фер ментный анализ, выделение тотальной РНК из
растительного материала, полимеразная цепная реак-
ция с обратной транскрипцией, сиквенирование, фи-
логенетический анализ. Результаты. Последова тель-
нос ти гена СР размером 676 нт двух украинских изо-
лятов ВПМП сравнивали с последовательностями
72 ВПМП изолятов / штаммов из базы данных
GenBank. Филогенетический анализ показал, что укра-
инские изоляты входят в кладу В или WSMV-ΔE (про-
исходят из Европы и Азии) и имеют типичную для
этой клады делецию триплета в позициях 8412-8414
нт в гене СР. Ukraine-Mal-18 имеет наиболее высокий
процент идентичности по нуклеотидной последова-
тельности 93,5 %-95,9 % и аминокислотной – 93,6-
95,0 % с изолятами клады В. Изолят Ukraine-Ep-18 с
изолятами клады B имеет идентичность 89,2-91,4 %
(нт) и 88,6 % - 87,1 % (аа). Кроме того, у двух украин-
ских изолятов отмечен ряд уникальных аа замен в
центральном участке гена СР. Выводы. Украинские
ВПМП изоляты входят в кладу В. Но Ukraine-Mal-18
и Ukraine-Ep-18 имеют некоторые отличия от них: i)
выше дивергенцию, чем другие изоляты В группы
(Ukraine-Mal-18 имеет 12 аа замен, Ukraine-Ep-18
имеет 25 аа замен, а другие изоляты клады В имеют
от 0 до 2 аа замен); ii) имеют аа замены, идентичны
непшеничным изолятам группы В1 этого вируса, мно-
го аа замен расположены в тех же участках гена СР,
что и замены травяных В1 изолятов ВПМП.
К л юч е в ы е с л ов а: вирус полосатой мозаики пше-
ницы, Triticum aestivum, филогенетический анализ,
сиквенирование, капсидный белок.
Received 03.04.2018
|
| id | nasplib_isofts_kiev_ua-123456789-154385 |
| institution | Digital Library of Periodicals of National Academy of Sciences of Ukraine |
| issn | 0233-7657 |
| language | English |
| last_indexed | 2025-12-07T15:41:39Z |
| publishDate | 2019 |
| publisher | Інститут молекулярної біології і генетики НАН України |
| record_format | dspace |
| spelling | Mishchenko, L.T. Dunich, A.A. Skrypkina, I.Ya. Kozub, N.O. 2019-06-15T14:56:47Z 2019-06-15T14:56:47Z 2019 Phylogenetic analysis of two Ukrainian isolates of Wheat streak mosaic virus / L.T. Mishchenko, A.A. Dunich, I.Ya. Skrypkina, N.O. Kozub // Вiopolymers and Cell. — 2019. — Т. 35, № 1. — С. 64-77. — Бібліогр.: 26 назв. — англ. 0233-7657 DOI: http://dx.doi.org/10.7124/bc.000997 https://nasplib.isofts.kiev.ua/handle/123456789/154385 578/633.11 The study of molecular characteristics and, in particular, the nucleotide (nt) and amino acid (aa) sequences of the viral genomes, is necessary to know the changes in their geographical range, phylogenetic relationships, viruses’ evolution, and their emergence as new epidemics. Aim. Phylogenetic analysis of the coat protein (CP) gene sequences of two new Ukrainian isolates of Wheat streak mosaic virus: Ukraine-Mal-18 and Ukraine-Ep-18. Results. The nucleotide sequences of 676 nt region of the CP gene of two Ukrainian WSMV isolates were compared with the sequences of 72 WSMV isolates/strains from GenBank. The phylogenetic analysis showed that the Ukrainian WSMV isolates cluster with the clade B or WSMV-ΔE isolates (originating from Europe and Asia) and have a typical for this clade triplet deletion at the position 8412-8414 nt in the CP gene. The isolate Ukraine-Mal-18 has the highest level of the sequence identity (93.5%-95.9% nt and 93.6-95.0% aa) with the clade B isolates. The Ukraine-Ep-18 isolate shares 89.2%-91.4% (nt) and 88.6-87.1% (aa) identity with the clade B isolates. Additionally, both Ukrainian WSMV isolates have a number of unique aa substitutions in the central CP gene domain. Conclusions. Ukrainian WSMV isolates belong to the clade B. But Ukraine-Mal-18 and Ukraine-Ep-18 have some differences from other members of the clade: i) a higher divergence compared to other B isolates (the Ukraine-Mal-18 has 12 aa substitutions, the Ukraine-Ep-18 has 25 aa substitutions, whereas the other clade B isolates have no more than 2 aa substitutions); ii) have aa substitution identical with the B1 non-crop isolates of this virus, many aa substitutions are in the same motifs as the substitutions of B1 grass WSMV isolates. Дослідження молекулярних характеристик, зокрема, нуклеотидних (нт) та амінокислотних (аа) послідовностей вірусних геномів, є необхідним для з’ясування змін у географічному ареалі, філогенетичних зв’язків, еволюції вірусів та їх появи у вигляді епідемій. Мета. Філогенетичний аналіз гену капсидного білка (СР) двох нових українських ізолятів вірусу смугастої мозаїки пшениці (ВСМП) Ukraine-Mal-18 та Ukraine-Ep-18. Методи: імуноферментий аналіз, виділення тотальної РНК із рослинного матеріалу, полімеразна ланцюгова реакція зі зворотною транскрипцією, сиквенування, філогенетичний аналіз. Результати. Послідовності гену СР розміром 676 нт двох українських ізолятів ВСМП порівнювали із послідовностями 72 ВСМП ізолятів/штамів із бази даних GenBank. Філогенетичний аналіз показав, що українські ізоляти входять до клади В або WSMV-ΔE (походять із Європи та Азії) та мають типову для цієї клади делецію триплету у позиціях 8412-8414 нт у гені СР. Ukraine-Mal-18 має найвищий відсоток ідентичності за нуклеотидною послідовністю 93,5%-95,9%, за амінокислотною – 93,6-95,0% із ізолятами клади В. Ізолят Ukraine-Ep-18 із ізолятами клади В має ідентичність 89,2-91,4% (нт) та 88,6%- 87,1% (аа). Крім того, у двох українських ізолятів відмічено низку унікальних аа заміщень в центральній ділянці гену СР. Висновки. Українські ВСМП ізоляти входять до клади В. Але Ukraine-Mal-18 та Ukraine-Ep-18 мають деякі відмінності від них: і) вищу дивергенцію, ніж інші ізоляти групи В (Ukraine-Mal-18 має 12 аа заміщень, Ukraine-Ep-18 має 25 аа заміщень, а інші ізоляти клади В мають 0-2 аа заміщення); іі) мають аа заміщення, ідентичні із непшеничними ізолятами групи В1 цього вірусу, багато аа заміщень знаходяться в тих самих ділянках гену СР, що і заміщення трав’яних В1 ізолятів ВСМП. Исследование молекулярных характеристик, в частности, нуклеотидных (нт) и аминокислотных (аа) последовательностей вирусных геномов, необходимо для выяснения изменений географическогоареала, филогенетических связей, эволюции вирусов и их появления в виде эпидемий. Цель. Филогенетический анализ гена капсидного белка (СР) двух новых украинских изолятов вируса полосатой мозаики пшеницы (ВПМП) Ukraine-Mal-18 и Ukraine-Ep-18. Методы. Иммуноферментный анализ, выделение тотальной РНК из растительного материала, полимеразная цепная реакция с обратной транскрипцией, сиквенирование, филогенетический анализ. Результаты. Последовательности гена СР размером 676 нт двух украинских изолятов ВПМП сравнивали с последовательностями 72 ВПМП изолятов / штаммов из базы данных GenBank. Филогенетический анализ показал, что украинские изоляты входят в кладу В или WSMV-ΔE (происходят из Европы и Азии) и имеют типичную для этой клады делецию триплета в позициях 8412-8414 нт в гене СР. Ukraine-Mal-18 имеет наиболее высокий процент идентичности по нуклеотидной последовательности 93,5%-95,9% и аминокислотной – 93,6-95,0% с изолятами клады В. Изолят Ukraine-Ep-18 с изолятами клады B имеет идентичность 89,2-91,4 % (нт) и 88,6% - 87,1% (аа). Кроме того, у двух украинских изолятов отмечен ряд уникальных аа замен в центральном участке гена СР. Выводы. Украинские ВПМП изоляты входят в кладу В. Но Ukraine-Mal-18 и Ukraine-Ep-18 имеют некоторые отличия от них: i) выше дивергенцию, чем другие изоляты В группы (Ukraine-Mal-18 имеет 12 аа замен, Ukraine-Ep-18 имеет 25 аа замен, а другие изоляты клады В имеют от 0 до 2 аа замен); ii) имеют аа замены, идентичны непшеничным изолятам группы В1 этого вируса, много аа замен расположены в тех же участках гена СР, что и замены травяных В1 изолятов ВПМП. en Інститут молекулярної біології і генетики НАН України Вiopolymers and Cell Viruses and Cell Phylogenetic analysis of two Ukrainian isolates of Wheat streak mosaic virus Філогенетичний аналіз двох українських ізолятів вірусу смугастої мозаїки пшениці Филогенетический анализ двух украинских изолятов вируса полосатой мозаики пшеницы Article published earlier |
| spellingShingle | Phylogenetic analysis of two Ukrainian isolates of Wheat streak mosaic virus Mishchenko, L.T. Dunich, A.A. Skrypkina, I.Ya. Kozub, N.O. Viruses and Cell |
| title | Phylogenetic analysis of two Ukrainian isolates of Wheat streak mosaic virus |
| title_alt | Філогенетичний аналіз двох українських ізолятів вірусу смугастої мозаїки пшениці Филогенетический анализ двух украинских изолятов вируса полосатой мозаики пшеницы |
| title_full | Phylogenetic analysis of two Ukrainian isolates of Wheat streak mosaic virus |
| title_fullStr | Phylogenetic analysis of two Ukrainian isolates of Wheat streak mosaic virus |
| title_full_unstemmed | Phylogenetic analysis of two Ukrainian isolates of Wheat streak mosaic virus |
| title_short | Phylogenetic analysis of two Ukrainian isolates of Wheat streak mosaic virus |
| title_sort | phylogenetic analysis of two ukrainian isolates of wheat streak mosaic virus |
| topic | Viruses and Cell |
| topic_facet | Viruses and Cell |
| url | https://nasplib.isofts.kiev.ua/handle/123456789/154385 |
| work_keys_str_mv | AT mishchenkolt phylogeneticanalysisoftwoukrainianisolatesofwheatstreakmosaicvirus AT dunichaa phylogeneticanalysisoftwoukrainianisolatesofwheatstreakmosaicvirus AT skrypkinaiya phylogeneticanalysisoftwoukrainianisolatesofwheatstreakmosaicvirus AT kozubno phylogeneticanalysisoftwoukrainianisolatesofwheatstreakmosaicvirus AT mishchenkolt fílogenetičniianalízdvohukraínsʹkihízolâtívvírususmugastoímozaíkipšenicí AT dunichaa fílogenetičniianalízdvohukraínsʹkihízolâtívvírususmugastoímozaíkipšenicí AT skrypkinaiya fílogenetičniianalízdvohukraínsʹkihízolâtívvírususmugastoímozaíkipšenicí AT kozubno fílogenetičniianalízdvohukraínsʹkihízolâtívvírususmugastoímozaíkipšenicí AT mishchenkolt filogenetičeskiianalizdvuhukrainskihizolâtovvirusapolosatoimozaikipšenicy AT dunichaa filogenetičeskiianalizdvuhukrainskihizolâtovvirusapolosatoimozaikipšenicy AT skrypkinaiya filogenetičeskiianalizdvuhukrainskihizolâtovvirusapolosatoimozaikipšenicy AT kozubno filogenetičeskiianalizdvuhukrainskihizolâtovvirusapolosatoimozaikipšenicy |