Identification of a novel S6K1 splice variant coding for the p60-S6K1 isoform

Aim. To identify a splicing mRNA of S6K1 kinase specific for the p60-S6K1 isoform alone. Methods. RT-PCR, DNA sequencing, Western blotting. Results. RT-PCR analysis of total RNA extracted from MCF-7 cells and subsequent DNA sequencing revealed a novel S6K1 splice variant that possesses additional ex...

Повний опис

Збережено в:
Бібліографічні деталі
Опубліковано в: :Вiopolymers and Cell
Дата:2019
Автори: Zaiets, I.V., Holiar, V.V., Filonenko, V.V.
Формат: Стаття
Мова:Англійська
Опубліковано: Інститут молекулярної біології і генетики НАН України 2019
Теми:
Онлайн доступ:https://nasplib.isofts.kiev.ua/handle/123456789/154396
Теги: Додати тег
Немає тегів, Будьте першим, хто поставить тег для цього запису!
Назва журналу:Digital Library of Periodicals of National Academy of Sciences of Ukraine
Цитувати:Identification of a novel S6K1 splice variant coding for the p60-S6K1 isoform / I.V. Zaiets, V.V. Holiar, V.V. Filonenko // Вiopolymers and Cell. — 2019. — Т. 35, № 2. — С. 99-106. — Бібліогр.: 24 назв. — англ.

Репозитарії

Digital Library of Periodicals of National Academy of Sciences of Ukraine
_version_ 1859879110551011328
author Zaiets, I.V.
Holiar, V.V.
Filonenko, V.V.
author_facet Zaiets, I.V.
Holiar, V.V.
Filonenko, V.V.
citation_txt Identification of a novel S6K1 splice variant coding for the p60-S6K1 isoform / I.V. Zaiets, V.V. Holiar, V.V. Filonenko // Вiopolymers and Cell. — 2019. — Т. 35, № 2. — С. 99-106. — Бібліогр.: 24 назв. — англ.
collection DSpace DC
container_title Вiopolymers and Cell
description Aim. To identify a splicing mRNA of S6K1 kinase specific for the p60-S6K1 isoform alone. Methods. RT-PCR, DNA sequencing, Western blotting. Results. RT-PCR analysis of total RNA extracted from MCF-7 cells and subsequent DNA sequencing revealed a novel S6K1 splice variant that possesses additional exon 1a and encodes the p60 isoform of S6K1 only. Moreover, RT-PCR and western blotting were applied to estimate the expression levels of the p60-S6K1 mRNA and protein. A heterogeneous expression of the p60-S6K1 transcript was observed; it did not correlate with the total S6K1 mRNA expression and with the protein content of p60-S6K1 in the studied cell lines. Conclusions. We provide the evidence for the existence of a novel S6K1 splice variant coding for the p60-S6K1 isoform. The cell can employ two distinct pathways of the p60-S6K1 expression based on alternative translation of mRNA common for the main S6K1 isoforms mRNA and/or translation of the novel p60-S6K1 specific mRNA. Since the levels of the p60-S6K1 transcript expression do not correlate with the expression of total S6K1 mRNA, it is plausible that the p60-S6K1 isoform plays a role distinct from that of other isoforms in cellular physiology, as well as in the development of S6K1-related pathologies. Мета. З'ясувати можливість існування сплайсової мРНК кінази S6К1 специфічної виключно для р60-S6К1 ізоформи. Методи. ЗТ-ПЛР, ДНК секвенування, Вестерн-блоттинг. Результати. ЗТ-ПЛР аналіз тотальної РНК, виділеної із клітин лінії MCF-7, з наступним секвенуванням ДНК виявив новий сплайсовий варіант мРНК S6K1, що містить додатковий екзон 1а і кодує лише p60 ізоформу S6K1. Для оцінки рівня експресії p60-S6K1 мРНК та білку було застосовано ЗТ-ПЛР та вестерн-блот. Результати. вказують на гетерогенну експресію транскрипту p60-S6K1, що не корелює ні з експресією загальної S6K1 мРНК, ні з білковим вмістом p60-S6K1 у досліджуваних клітинних лініях. Висновки. Надано докази існування нової сплайсової мРНК S6K1, яка кодує ізоформу p60-S6K1, що свідчить про існування в клітині двох незалежних шляхів експресії p60-S6K1, а саме альтернативну трансляцію спільної для головних S6K1 ізоформ мРНК та/чи трансляцію нової специфічної лише для р60-S6K1 сплайсової мРНК. Оскільки рівень експресії p60-S6K1 транскрипту в різних клітинних лініях не корелює із експресією загальної мРНК S6K1, цілком можливо, що p60-S6K1 ізоформа може відігравати відмінну від інших S6K1 ізоформ роль у клітинній фізіології, а також при розвитку патологій, які пов’язані із S6K1. Цель. Выяснить возможность существования сплайсинговой мРНК киназы S6К1 специфической исключительно для р60-S6К1 изоформы. Методы. ОТ-ПЦР, ДНК секвенирование, Вестерн-блоттинг. Результаты. ОТ-ПЦР анализ тотальной РНК, выделенной из клеток линии MCF-7, с последующим секвенированием ДНК выявил новый сплайсовый вариант S6K1, содержит дополнительный экзон 1а и кодирует только изоформу p60-S6K1. Далее были использованы ОТ-ПЦР и вестерн-блоттинг для оценки уровней p60-S6K1 мРНК и белка. Результаты показали гетерогенную экспрессию транскрипта p60-S6K1, экспрессия которого не коррелировала ни с тотальной S6K1 мРНК, ни с белковым содержанием p60-S6K1 в исследуемых клеточных линиях. Выводы. Предоставлены доказательства существования нового сплайсового варианта S6K1, который кодирует изоформу p60-S6K1, что указывает на существование в клетке двух независимых путей экспрессии p60-S6K1 изоформы, а именно альтернативную трансляцию общей для основных изоформ мРНК и/или трансляцию новой специфичной лишь для p60-S6K1 сплайсовой мРНК. Поскольку уровень экспрессии p60-S6K1 транскрипта в различных клеточных линиях не коррелируют с экспрессией тотальной S6K1 мРНК, можно предположить, что p60-S6K1 изоформа может играть отличную то других S6K1 изоформ роль в клеточной физиологии, а также при развитии патологий, которые связаны с S6K1.
first_indexed 2025-12-07T15:52:08Z
format Article
fulltext 99 I. V. Zaiets, V. V. Holiar, V. V. Filonenko © 2019 I. V. Zaiets et al.; Published by the Institute of Molecular Biology and Genetics, NAS of Ukraine on behalf of Bio- polymers and Cell. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted reuse, distribution, and reproduction in any medium, provided the original work is properly cited UDC 577 Identification of a novel S6K1 splice variant coding for the p60-S6K1 isoform I. V. Zaiets, V. V. Holiar, V. V. Filonenko Institute of Molecular Biology and Genetics, NAS of Ukraine, 150, Zabolotnogo str., 03680, Kyiv, Ukraine filonenko@imbg.org.ua Aim. To identify a splicing mRNA of S6K1 kinase specific for the p60-S6K1 isoform alone. Methods. RT-PCR, DNA sequencing, Western blotting. Results. RT-PCR analysis of total RNA extracted from MCF-7 cells and subsequent DNA sequencing revealed a novel S6K1 splice variant that possesses additional exon 1a and encodes the p60 isoform of S6K1 only. Moreover, RT-PCR and western blotting were applied to estimate the expression levels of the p60-S6K1 mRNA and protein. A heterogeneous expression of the p60-S6K1 transcript was observed; it did not correlate with the total S6K1 mRNA expression and with the protein content of p60-S6K1 in the studied cell lines. Conclusions. We provide the evidence for the existence of a novel S6K1 splice variant coding for the p60-S6K1 isoform. The cell can employ two distinct pathways of the p60-S6K1 expression based on alternative translation of mRNA common for the main S6K1 isoforms mRNA and/or translation of the novel p60-S6K1 spe- cific mRNA. Since the levels of the p60-S6K1 transcript expression do not correlate with the expression of total S6K1 mRNA, it is plausible that the p60-S6K1 isoform plays a role distinct from that of other isoforms in cellular physiology, as well as in the development of S6K1- related pathologies. K e y w o r d s: p60-S6K1 transcript, alternative splicing, gene expression Introduction The ribosomal protein S6 kinase 1 (S6K1, RPS6KB1 gene) plays an important role in pro- moting fundamental cellular functions, including cell metabolism, growth and motility, and repre- sents a downstream effector of the mTORC1 signaling pathway [1]. Indeed, the aberrant mTORC1 signaling underlies a number of path- ological conditions [2]. Numerous data indicate the implication of S6K1 in the development of human cancer. A pathological cellular response in cancer is frequently associated with amplifica- tion and overexpression of the S6K1 gene [3–19]. Current data suggest that most effects of S6K1 are mediated by the major p70 and p85 isoforms that are originated from alternative mRNA trans- lation [1]. Little attention, however, has been paid ISSN 1993-6842 (on-line); ISSN 0233-7657 (print) Biopolymers and Cell. 2019. Vol. 35. N 2. P 99–106 doi: http://dx.doi.org/10.7124/bc.00099B mailto:filonenko@imbg.org.ua 100 I. V. Zaiets, V. V. Holiar, V. V. Filonenko to studying the other isoforms. Recent data dem- onstrate the ability of short S6K1 isoforms to initiate tumorigenesis [20, 21], thus underscoring important roles for these isoforms in cancer. Additionally, an evidence exists for the p60- S6K1 protein isoform [22]. It was assumed that this isoform originates from an alternative trans- lation event [22]. Moreover,our recent work has confirmed such an assumption [23]. On the oth- er hand, the analysis of current nucleic acid da- tabases has revealed an additional S6K1 splice variant (NM_001272044.1, RefSeq, NCBI) dis- covered by NEDO human cDNA sequencing project [unpublished data] that presumably could be translated to the p60-S6K1 protein. The main task of the current study was to confirm the existence of mRNA coding for the p60 isoform of S6K1 and to estimate its expres- sion in various cell lines. Initially, we used RT- PCR to identify the p60-S6K1 mRNA in breast cancer cell line MCF-7. After that, DNA sequenc- ing of the PCR product confirmed the identity of the p60-S6K1 transcript which contains an inser- tion (we called exon 1a) arising from intron 1. To evaluate the expression le vels of the p60-S6K1 mRNA in cell lines we also applied RT-PCR. The obtained data revealed heterogeneous expression of the p60-S6K1 mRNA in the studied cell lines, and this expression did not correlate with the expression of total S6K1 mRNA. Addtionally, we compared the levels of p60-S6K1 mRNA and protein expression, demonstrating the absence of correlation between them. Materials and Methods Cell culture. HEK-293, MCF-7 and HeLa, cell cultures were maintained in Dulbecco’s modi- fied Eagle medium (DMEM) (Gibco) supple- mented with 10 % fetal bovine serum (Gibco), 100 units/ml penicillin, 100 µg/ml streptomycin, and 2mM glutamine. Jurkat and U-937, and HepG2, U-373 and U-87 cell lines were cul- tured in RPMI-1640 (HyClone) and Eagle’s minimum essential medium (EMEM) (Gibco), respectively, containing supplements listed above. All the cells used in this study were grown in 6-cm cell culture dishes until they reached 90 % confluency and lysed for subse- quent total RNA isolation. Each cell culture was maintained in a 5 % CO2 incubator at 37°C. Oligonucleotides. For PCR detection of the p60-S6K1 transcript and subsequent sequenc- ing of the detected fragment following primers were used: forward – TTCTGTCGGGAGTAG- CACTG (encompasses the p60-S6K1 tran- script specific insertion), reverse – GTGCTGT- GGATTGGTGGAGT (against the exon 9 of the primary S6K1 transcript) with the resulted PCR product size of 787 bp. For the evaluation of p60-S6K1, total S6K1 and β-actin mRNA expression in a subset of cell lines by RT-PCR following primers were used: 1) p60-S6K1: forward – TTCTGTCGGGAGTAGCACTG (the same oligonucleotide as for sequencing), reverse – GTGCTGTGGATTGGTGGAGT (against the exon 3 of the primary S6K1 tran- script) with the resulted PCR product size of 257 bp. 2) Total S6K1 (exon 2-4): forward – GACCATATGAACTTGGCATGG (against the exon 2 of the primary S6K1 transcript), re- verse – TCCCAGTATTTGCTCCTGTTAC (against the exon 4 of the primary S6K1 tran- script) with the resulted PCR product size of 174 bp. 3) Total S6K1 (exon 14-15): forward – CACCTCGAAGATTTATTGGCA (against the exon 14 of the primary S6K1 transcript), re- verse – GTGCTCTGGCCGTTTGG (against the exon 15 of the primary S6K1 transcript) 101 Identification of a novel S6K1 splice variant coding for the p60-S6K1 isoform with the resulted PCR product size of 260 bp. 4) Total S6K1 (full-length): forward – AGACAGGGAAGCTGAGGACA (against the exon 1 of the primary S6K1 transcript), reverse – GTGCTCTGGCCGTTTGG (against the exon 15 of the primary S6K1 transcript) with the resulted PCR product size of 1510 bp. 5) β-actin: forward – GGACTTCGAGCAAG- AGAT, reverse – AGCACTGTGTTGGCGTAC with the resulted PCR product size of 234 bp. RT-PCR. Total RNA was extracted and pu- rified from cell lines using GeneJET RNA Purification Kit (#K0503, Thermo Scientific). After extraction 1 µg of total RNA was treated with DNase I (#EN0525, Thermo Scientific) and further used to synthesize the first cDNA strand with High-Capacity cDNA Reverse Transcription Kit (#4374966, Applied Biosystems). All procedures were performed according to manufacturer’s instructions. PCR was performed on 1/15 (1.5 µl) of cDNA in 25 µl of total reaction volume containing 0.2 mM dNTP mix, 10X DreamTaq Buffer (#EP0701, Thermo Scientific), 0.5 µM of each primer and 0.65 units of DreamTaq DNA Polymerase (#EP0701, Thermo Scientific). For PCR amplification of the full-length p70/p85- S6K1 transcript following PCR mixtures were prepared in total volume of 25 µl: 0.2 mM dNTP mix, 5X Phusion HF Buffer (#F-530S, Thermo Scientific), 3 % DMSO, 0.5 µM of each primer and Phusion High-Fidelity DNA Polymerase (#F-530S, Thermo Scientific). PCR conditions were (i) 95°C for 2 min as initial denaturation followed by 35 cycles of denaturing at 95°C for 25 sec, annealing at either 55°C (for β-actin) or 57°C (for S6K1 (exon 2-4, exon 14-15) and p60-S6K1) for 25 sec, extension at 72°C for 1 min and a final extension at 72°C for 5 min for PCR amplifi- cation with DreamTaq DNA polymerase; (ii) 98°C for 1 min, then 35 cycles of 98°C for 10 sec, 62°C for 25 sec (for full-length p70/ p85-S6K1) and 72°C for 1 min, followed by 5 min at 72°C for PCR amplification with Phusion DNA polymerase. Resulting PCR products were resolved on 1-2 % agarose gel. Immunoblotting. Whole-cell lysates were prepared by suspending cells in lysis buffer (25 mM Tris-HCl, pH 7.5, 150 mM NaCl, 1 mM EDTA, 0.5 % Triton X-100, 5 % glyc- erol, 1 mM Na3VO4, 2.5 mM Na pyrophos- phate, 1 mM β-glycerophosphate supplemented with a cOmplete EDTA-free protease inhibitor cocktail tablet (Roche) and phosphatase in- hibitors (Sigma-Aldrich)) with subsequent cen- trifugation at 12,000 g for 10 min to obtain lysates cleared of insoluble material. The pro- tein content of cleared lysates was measured with the Coomassie Protein Assay Reagent (#1856209, Thermo Scientific). Samples were resolved by 10 % SDS-PAGE and transferred to a polyvinylidene difluoride (PVDF) mem- brane (Immobilon®-P, Millipore). The mem- brane was further incubated with primary anti- bodies of appropriate dilutions. The antibody against the S6K1 C-terminus was diluted 1:2500 [24] and dilution for the β-actin antibody was 1:10000 (clone 13E5, Sigma-Aldrich). Bound antibodies were detected using horseradish peroxidase-conjugated anti-rabbit or anti-mouse antibodies followed by the enhanced chemilu- minescence reagent (GE Healthcare). All the secondary antibodies were diluted 1:10000. Results and Discussion Our recent study demonstrated that the p60 isoform of S6K1 can be alternatively trans- 102 I. V. Zaiets, V. V. Holiar, V. V. Filonenko lated presumably from the common with p85/ p70 S6K1 transcript via usage of the third in-frame start codon (Fig.1) [23]. Despite the described source of p60-S6K1 translation, the given isoform can be supposedly generated from the alternative S6K1 mRNA splice vari- ant termed as the S6K1 transcript variant 4 (further p60-S6K1 transcript) according to the data of the NCBI Reference Sequence Database (NM_001272044.1, RefSeq, NCBI). A nucleotide sequence for this transcript was derived from the data of NEDO human cDNA sequencing project focused on splicing vari- ants (AK297147.1, GenBank, NCBI) [unpub- lished data]. This S6K1 transcript contains an insertion between exons 1 and 2 (we called it exon 1a) that bears an in-frame stop codon (Fig. 1). The latter does not allow p70-S6K1 and p85-S6K1 to be translated causing pre- mature termination of translation. However, the full-length p60-S6K1 isoform can be translated from this transcript (Fig. 1) by utilizing the third in-frame translation start codon located in exon 2. Nevertheless, iden- tity of this transcript, termed p60-S6K1, has not been elucidated, as well as its expression in cells. To identify the p60-S6K1 mRNA we em- ployed a method of RT-PCR using total RNA from MCF-7 cells as a source of the p60-S6K1 mRNA. For PCR detection one of the primers targeted the p60-S6K1 mRNA-specific exon 1a, whereas another primer was complemen- tary to a region of the exon 9. RT-PCR analy- sis of MCF-7 total RNA revealed expression of the p60-S6K1 transcript (Fig. 2A). The re- sulted PCR product was extracted from a gel and subjected to DNA sequencing. The results of sequencing showed that the DNA fragment amplified during PCR corresponded to a nu- cleotide sequence of the S6K1 transcript vari- ant 4 found in the NCBI Reference Sequence Database (Fig. 2B). After the identity of p60-S6K1 mRNA was established, we investigated expression of this transcript by RT-PCR in a number of cell lines Fig. 1. Schematic demonstration of the p60-S6K1 splice variant relative to the pre- dominant p60/p70/p85-S6K1 transcript. The transcript variant encoding the only p60- S6K1 isoform contains an additional exon (designated as 1a) compared to the p60/p70/ p85-S6K1 transcript encoding all three isoforms that are translated from corresponding alternative start codons. The 1a exon includes an in-frame stop codon that terminates translation of p70/p85-S6K1 isoforms, thus forcing p60-S6K1 transcript to initiate translation only the p60-S6K1 isoform from the third, nearest in-frame start codon. 103 Identification of a novel S6K1 splice variant coding for the p60-S6K1 isoform of different origin. Additionally, we analyzed expression of the p60-S6K1 isoform in these cells in comparison with the protein and mRNA expression levels. The data demon- strated heterogeneous expression of the p60- S6K1 mRNA in different types of cells (Fig. 3A). Moreover, no correlation between the expression levels of the p60-S6K1 mRNA and total S6K1 mRNA was observed. This implies that the p60-S6K1 isoform could play a different role compared to the full-length Fig. 3. Expression profile of the p60-S6K1 isoform in a panel of cell lines. A) RT-PCR analysis of p60-S6K1 mRNA expression in different cell lines (MCF-7, HEK- 293, HeLa, HepG2, U-87, U-373, U-937, Jurkat). A sub- set of the cell lines was subjected to a total mRNA isola- tion and subsequent cDNA synthesis. Total cDNA for each cell line was analyzed by PCR using primers spe- cific to p60-S6K1 (top panel), total S6K1 (medium pan- els) and β-actin (bottom panel). The resulted PCR prod- ucts were separated by 2 % agarose gel electrophoresis. B) Western blot analysis of p60-S6K1 protein expression in the indicated cell lines. Whole-cell lysates were pre- pared from the cell lines and loaded onto 10 % SDS- PAGE (20 µg of each lysate except for 2 µg of MCF-7 lysate). Separated S6K1 was blotted against polyclonal C-terminal S6K1 antibodies. β-actin was used to confirm equal loading of protein in each lane. A B A B Fig. 2. The RPS6KB1 gene gives rise to the transcript variant (p60-S6K1 mRNA) supposedly encoding the p60-S6K1 isoform. A) PCR detection of p60-S6K1 mRNA from MCF-7 cells. For PCR analysis a forward primer was designed to be specific to a region of the in- serted exon 1a, whereas a reverse one was complemen- tary to a region of the exon 9. B) A sequenced PCR frag- ment extracted from the gel represented in A) displays inclusion of the exon 1a (sequence in blue). Primers used for DNA sequencing (sequences in green) were the same as for PCR analysis giving the PCR product of 787 bp in length. 104 I. V. Zaiets, V. V. Holiar, V. V. Filonenko p70/p85-S6K1 isoforms. To our surprise, how- ever, usage of different primer pairs for detec- tion of total S6K1 mRNA gave different ex- pression profiles. Only a pair of primers pro- ducing full-length p60/p70/p85-S6K1 mRNA detected the expression levels which roughly conformed to the protein expression levels shown by immunoblotting, although the effi- ciency of PCR employing these primers was quite low. However, a question why the use of different S6K1 primers provides varied the results of S6K1 expression remains to be re- solved in future studies since it is very impor- tant for further quantitative analysis of p60- S6K1 expression in cells and tissues. The results also showed that p60-S6K1 mRNA expression levels do not correlate with those of the p60-S6K1 protein (Fig. 3). The absence of correlation between p60-S6K1 mRNA and protein expression may be account- ed for a mechanism of p60-S6K1 generation, since this isoform can also be initiated from the common p60/p70/p85-S6K1 transcript. Therefore, the ability of a cell to produce the p60-S6K1 isoform using alternative pathways might be responsible for such a difference be- tween the p60-S6K1 mRNA and protein levels. Unfortunately, we could not estimate the con- tribution of the p60-S6K1 transcript expression in the protein level of the p60-S6K1 isoform applying the siRNA technology, since the p60- S6K1-specific insertion represented a poor tar- get sequence for RNAi. In conclusion, we provided a new evidence for the existence of the novel S6K1 transcript, referred to as the p60-S6K1 transcript suggest- ing existence of at least two alternative modes in the p60S6K1 expression. The identified transcript displays a differential pattern of expression in different cell types. Yet, the ex- pression of the p60-S6K1 mRNA does not correlate with the total S6K1 mRNA indicating that the former could play a distinct and inde- pendent role in cellular physiology and S6K1- related diseases. This work was funded by the State Budget Program «Support for the Development of Priority Areas of Scientific Research» (Code: 6541230). REFERENCES 1. Fenton TR, Gout IT. Functions and regulation of the 70kDa ribosomal S6 kinases. Int J Biochem Cell Biol. 2011;43(1):47–59. 2. Zoncu R, Efeyan A, Sabatini DM. mTOR: from growth signal integration to cancer, diabetes and ageing. Nat Rev Mol Cell Biol. 2011;12(1):21–35. 3. Couch FJ, Wang XY, Wu GJ, Qian J, Jenkins RB, James CD. Localization of PS6K to chromosomal region 17q23 and determination of its amplification in breast cancer. Cancer Res. 1999;59(7):1408–11. 4. Bärlund M, Monni O, Kononen J, Cornelison R, Torhorst J, Sauter G, Kallioniemi OLLI-P, Kal- lioniemi A. Multiple genes at 17q23 undergo ampli- fication and overexpression in breast cancer. Cancer Res. 2000;60(19):5340–4. 5. Bärlund M, Forozan F, Kononen J, Bubendorf L, Chen Y, Bittner ML, Torhorst J, Haas P, Bucher C, Sauter G, Kallioniemi OP, Kallioniemi A. Detecting activation of ribosomal protein S6 kinase by com- plementary DNA and tissue microarray analysis. J Natl Cancer Inst. 2000;92(15):1252–9. 6. Miyakawa M, Tsushima T, Murakami H, Wakai K, Isozaki O, Takano K. Increased expression of phos- phorylated p70S6 kinase and Akt in papillary thy- roid cancer tissues. Endocr J. 2003;50(1):77–83. 7. Lytvyn DI, Dudchenko TM, Lyzogubov VV, Usen- ko VS, Nespryadko SV, Vinnitskaya AB, Vorobyo- va LI, Pal’chevskiy SS, Filonenko VV, Pogreb- noy PV. Expression of α- and β-isoforms of p70S6 105 Identification of a novel S6K1 splice variant coding for the p60-S6K1 isoform kinase in human endometrial tumors. Exp Oncol. 2003;25(4):274–8. 8. Lyzogubov VV, Usenko VS, Khojaenko YS, Lytvyn DI, Soldatkina MA, Rodnin NV, Filonenko VV, Pogrib- niy PV. Immunohistochemical analysis of p70S6 kinase α in human thyroid tissue upon pathology. Exp Oncol. 2003;25(4):304–6. 9. Lyzogubov VV, Lytvyn DI, Dudchenko TM, Lub- chenko NV, Pogrybniy PV, Nespryadko SV, Vin- nitska AB, Usenko VS, Gout IT, Filonenko VV. Im- munohistochemical analysis of S6K1 and S6K2 expression in endometrial adenocarcinomas. Exp Oncol. 2004;26(4):287–93. 10. van der Hage JA, van den Broek LJ, Legrand C, Clahsen PC, Bosch CJ, Robanus-Maandag EC, van de Velde CJ, van de Vijver MJ. Overexpression of P70 S6 kinase protein is associated with increased risk of locoregional recurrence in node-negative premenopausal early breast cancer patients. Br J Cancer. 2004;90(8):1543–50. 11. Lyzogubov V, Khozhaenko Y, Usenko V, Antonjuk S, Ovcharenko G, Tikhonkova I, Filonenko V. Immu- nohistochemical analysis of Ki-67, PCNA and S6K1/2 expression in human breast cancer. Exp Oncol. 2005;27(2):141–4. 12. Pantuck AJ, Seligson DB, Klatte T, Yu H, Leppert JT, Moore L, O’Toole T, Gibbons J, Belldegrun AS, Figlin RA. Prognostic relevance of the mTOR path- way in renal cell carcinoma: implications for mo- lecular patient selection for targeted therapy. Cancer. 2007;109(11):2257–67. 13. Noh WC, Kim YH, Kim MS, Koh JS, Kim HA, Moon NM, Paik NS. Activation of the mTOR signal- ing pathway in breast cancer and its correlation with the clinicopathologic variables. Breast Cancer Res Treat. 2008;110(3):477–83. 14. Zhou L, Huang Y, Li J, Wang Z. The mTOR pathway is associated with the poor prognosis of human hepa- tocellular carcinoma. Med Oncol. 2010;27(2):255–61. 15. Hiramatsu M, Ninomiya H, Inamura K, Nomura K, Takeuchi K, Satoh Y, Okumura S, Nakagawa K, Yamori T, Matsuura M, Morikawa T, Ishikawa Y. Activation status of receptor tyrosine kinase down- stream pathways in primary lung adenocarcinoma with reference of KRAS and EGFR mutations. Lung Cancer. 2010;70(1):94–102. 16. Pérez-Tenorio G, Karlsson E, Waltersson MA, Ols- son B, Holmlund B, Nordenskjöld B, Fornander T, Skoog L, Stål O. Clinical potential of the mTOR targets S6K1 and S6K2 in breast cancer. Breast Cancer Res Treat. 2011;128(3):713–23. 17. Li PD, Zhang WJ, Zhang MY, Yuan LJ, Cha YL, Ying XF, Wu G, Wang HY. Overexpression of RP- S6KB1 predicts worse prognosis in primary HCC patients. Med Oncol. 2012;29(5):3070–6. 18. Karlsson E, Magić I, Bostner J, Dyrager C, Lysholm F, Hallbeck AL, Stål O, Lundström P. Re- vealing Different Roles of the mTOR-Targets S6K1 and S6K2 in Breast Cancer by Expression Profiling and Structural Analysis. PLoS One. 2015;10(12): e0145013. 19. Pópulo H, Soares P, Faustino A, Rocha AS, Silva P, Azevedo F, Lopes JM. mTOR pathway activation in cutaneous melanoma is associated with poorer prog- nosis characteristics. Pigment Cell Melanoma Res. 2011;24(1):254–7. 20. Ben-Hur V, Denichenko P, Siegfried Z, Maimon A, Krainer A, Davidson B, Karni R. S6K1 alternative splicing modulates its oncogenic activity and regu- lates mTORC1. Cell Rep. 2013;3(1):103–15. 21. Karni R, de Stanchina E, Lowe SW, Sinha R, Mu D, Krainer AR. The gene encoding the splicing factor SF2/ASF is a proto-oncogene. Nat Struct Mol Biol. 2007;14(3):185–93. 22. Kim D, Akcakanat A, Singh G, Sharma C, Meric- Bernstam F. Regulation and localization of ribo- somal protein S6 kinase 1 isoforms. Growth Factors. 2009;27(1):12–21. 23. Zaiets IV, Sivchenko AS, Khoruzhenko AI, Savins- ka LO, Filonenko VV. The p60-S6K1 isoform of ribosomal protein S6 kinase 1 is a product of alter- native mRNA translation. Ukr Biochem J. 2018;90(4):25–35. 24. Savinska LO, Kijamova RG, Pogrebnoy PV, Ovcha- renko GV, Gout IT, Filonenko VV. Comparative characterization of S6 kinase α and β isoforms ex- pression in mammalian tissues. Biopolym Cell. 2001;17(5):374-9. 106 I. V. Zaiets, V. V. Holiar, V. V. Filonenko Ідентифікація нового сплайсового варіанту S6K1, який кодує ізоформу p60-S6K1. І. В. Заєць, В. В. Голяр, В. В. Філоненко Мета. З’ясувати можливість існування сплайсової мРНК кінази S6К1 специфічної виключно для р60- S6К1 ізоформи. Методи. ЗТ-ПЛР, ДНК секвенування, Вестерн-блоттинг. Результати. ЗТ-ПЛР аналіз тоталь- ної РНК, виділеної із клітин лінії MCF-7, з наступним секвенуванням ДНК виявив новий сплайсовий варі- ант мРНК S6K1, що містить додатковий екзон 1а і кодує лише p60 ізоформу S6K1. Для оцінки рівня експресії p60-S6K1 мРНК та білку було застосовано ЗТ-ПЛР та вестерн-блот. Результати вказують на гетерогенну експресію транскрипту p60-S6K1, що не корелює ні з експресією загальної S6K1 мРНК, ні з білковим вмістом p60-S6K1 у досліджуваних клітин- них лініях. Висновки. Надано докази існування нової сплайсової мРНК S6K1, яка кодує ізоформу p60-S6K1, що свідчить про існування в клітині двох незалежних шляхів експресії p60-S6K1, а саме альтернативну трансляцію спільної для головних S6K1 ізоформ мРНК та/чи трансляцію нової специфічної лише для р60-S6K1 сплайсової мРНК. Оскільки рівень екс- пресії p60-S6K1 транскрипту в різних клітинних лі- ніях не корелює із експресією загальної мРНК S6K1, цілком можливо, що p60-S6K1 ізоформа може віді- гравати відмінну від інших S6K1 ізоформ роль у клітинній фізіології, а також при розвитку патологій, які пов’язані із S6K1. К л юч ов і с л ов а: p60-S6K1 транскрипт, альтерна- тивний сплайсинг, експресія генів. Идентификация нового сплайсового варианта S6K1, который кодирует изоформу p60-S6K1. И. В. Заец, В. В. Голяр, В. В. Филоненко Цель. Выяснить возможность существования сплайсин- говой мРНК киназы S6К1 специфической исключитель- но для р60-S6К1 изоформы. Методы. ОТ-ПЦР, ДНК секвенирование, Вестерн-блоттинг. Результаты. ОТ-ПЦР анализ тотальной РНК, выделенной из клеток линии MCF-7, с последующим секвенированием ДНК выявил новый сплайсовый вариант S6K1, содержит дополни- тельній екзон 1а и кодирует только изоформу p60-S6K1. Далее были использованы ОТ-ПЦР и вестерн-блоттинг для оценки уровней p60-S6K1 мРНК и белка. Результаты показали гетерогенную экспрессию транскрипта p60- S6K1, экспрессия которого не коррелировала ни с тоталь- ной S6K1 мРНК, ни с белковым содержанием p60-S6K1 в исследуемых клеточных линиях. Выводы. Пре достав- лены доказательства существования нового сплайсового варианта S6K1, который кодирует изоформу p60-S6K1, что указывает на существование в клетке двух независи- мых путей експрессии p60-S6K1 изоформы, а именно альтернативную трансляцию общей для основных изо- форм мРНК и/или трансляцию новой специфичной лишь для p60-S6K1 сплайсовой мРНК. Поскольку уровень экспрессии p60-S6K1 транскрипта в различных клеточ- ных линиях не коррелируют с экспрессией тотальной S6K1 мРНК, можна предположить, что p60-S6K1 изо- форма может играть отличную то других S6K1 изоформ роль в клеточной физиологии, а также при развитии патологий, которые связаны с S6K1. К л юч е в ы е с л ов а: p60-S6K1 транскрипт, альтер- нативный сплайсинг, экспрессия генов. Received 25.11.2018
id nasplib_isofts_kiev_ua-123456789-154396
institution Digital Library of Periodicals of National Academy of Sciences of Ukraine
issn 0233-7657
language English
last_indexed 2025-12-07T15:52:08Z
publishDate 2019
publisher Інститут молекулярної біології і генетики НАН України
record_format dspace
spelling Zaiets, I.V.
Holiar, V.V.
Filonenko, V.V.
2019-06-15T15:06:01Z
2019-06-15T15:06:01Z
2019
Identification of a novel S6K1 splice variant coding for the p60-S6K1 isoform / I.V. Zaiets, V.V. Holiar, V.V. Filonenko // Вiopolymers and Cell. — 2019. — Т. 35, № 2. — С. 99-106. — Бібліогр.: 24 назв. — англ.
0233-7657
DOI: http://dx.doi.org/10.7124/bc.00099B
https://nasplib.isofts.kiev.ua/handle/123456789/154396
577
Aim. To identify a splicing mRNA of S6K1 kinase specific for the p60-S6K1 isoform alone. Methods. RT-PCR, DNA sequencing, Western blotting. Results. RT-PCR analysis of total RNA extracted from MCF-7 cells and subsequent DNA sequencing revealed a novel S6K1 splice variant that possesses additional exon 1a and encodes the p60 isoform of S6K1 only. Moreover, RT-PCR and western blotting were applied to estimate the expression levels of the p60-S6K1 mRNA and protein. A heterogeneous expression of the p60-S6K1 transcript was observed; it did not correlate with the total S6K1 mRNA expression and with the protein content of p60-S6K1 in the studied cell lines. Conclusions. We provide the evidence for the existence of a novel S6K1 splice variant coding for the p60-S6K1 isoform. The cell can employ two distinct pathways of the p60-S6K1 expression based on alternative translation of mRNA common for the main S6K1 isoforms mRNA and/or translation of the novel p60-S6K1 specific mRNA. Since the levels of the p60-S6K1 transcript expression do not correlate with the expression of total S6K1 mRNA, it is plausible that the p60-S6K1 isoform plays a role distinct from that of other isoforms in cellular physiology, as well as in the development of S6K1-related pathologies.
Мета. З'ясувати можливість існування сплайсової мРНК кінази S6К1 специфічної виключно для р60-S6К1 ізоформи. Методи. ЗТ-ПЛР, ДНК секвенування, Вестерн-блоттинг. Результати. ЗТ-ПЛР аналіз тотальної РНК, виділеної із клітин лінії MCF-7, з наступним секвенуванням ДНК виявив новий сплайсовий варіант мРНК S6K1, що містить додатковий екзон 1а і кодує лише p60 ізоформу S6K1. Для оцінки рівня експресії p60-S6K1 мРНК та білку було застосовано ЗТ-ПЛР та вестерн-блот. Результати. вказують на гетерогенну експресію транскрипту p60-S6K1, що не корелює ні з експресією загальної S6K1 мРНК, ні з білковим вмістом p60-S6K1 у досліджуваних клітинних лініях. Висновки. Надано докази існування нової сплайсової мРНК S6K1, яка кодує ізоформу p60-S6K1, що свідчить про існування в клітині двох незалежних шляхів експресії p60-S6K1, а саме альтернативну трансляцію спільної для головних S6K1 ізоформ мРНК та/чи трансляцію нової специфічної лише для р60-S6K1 сплайсової мРНК. Оскільки рівень експресії p60-S6K1 транскрипту в різних клітинних лініях не корелює із експресією загальної мРНК S6K1, цілком можливо, що p60-S6K1 ізоформа може відігравати відмінну від інших S6K1 ізоформ роль у клітинній фізіології, а також при розвитку патологій, які пов’язані із S6K1.
Цель. Выяснить возможность существования сплайсинговой мРНК киназы S6К1 специфической исключительно для р60-S6К1 изоформы. Методы. ОТ-ПЦР, ДНК секвенирование, Вестерн-блоттинг. Результаты. ОТ-ПЦР анализ тотальной РНК, выделенной из клеток линии MCF-7, с последующим секвенированием ДНК выявил новый сплайсовый вариант S6K1, содержит дополнительный экзон 1а и кодирует только изоформу p60-S6K1. Далее были использованы ОТ-ПЦР и вестерн-блоттинг для оценки уровней p60-S6K1 мРНК и белка. Результаты показали гетерогенную экспрессию транскрипта p60-S6K1, экспрессия которого не коррелировала ни с тотальной S6K1 мРНК, ни с белковым содержанием p60-S6K1 в исследуемых клеточных линиях. Выводы. Предоставлены доказательства существования нового сплайсового варианта S6K1, который кодирует изоформу p60-S6K1, что указывает на существование в клетке двух независимых путей экспрессии p60-S6K1 изоформы, а именно альтернативную трансляцию общей для основных изоформ мРНК и/или трансляцию новой специфичной лишь для p60-S6K1 сплайсовой мРНК. Поскольку уровень экспрессии p60-S6K1 транскрипта в различных клеточных линиях не коррелируют с экспрессией тотальной S6K1 мРНК, можно предположить, что p60-S6K1 изоформа может играть отличную то других S6K1 изоформ роль в клеточной физиологии, а также при развитии патологий, которые связаны с S6K1.
en
Інститут молекулярної біології і генетики НАН України
Вiopolymers and Cell
Structure and Function of Biopolymers
Identification of a novel S6K1 splice variant coding for the p60-S6K1 isoform
Ідентифікація нового сплайсового варіанту S6K1, який кодує ізоформу p60-S6K1.
Идентификация нового сплайсового варианта S6K1, который кодирует изоформу p60-S6K1.
Article
published earlier
spellingShingle Identification of a novel S6K1 splice variant coding for the p60-S6K1 isoform
Zaiets, I.V.
Holiar, V.V.
Filonenko, V.V.
Structure and Function of Biopolymers
title Identification of a novel S6K1 splice variant coding for the p60-S6K1 isoform
title_alt Ідентифікація нового сплайсового варіанту S6K1, який кодує ізоформу p60-S6K1.
Идентификация нового сплайсового варианта S6K1, который кодирует изоформу p60-S6K1.
title_full Identification of a novel S6K1 splice variant coding for the p60-S6K1 isoform
title_fullStr Identification of a novel S6K1 splice variant coding for the p60-S6K1 isoform
title_full_unstemmed Identification of a novel S6K1 splice variant coding for the p60-S6K1 isoform
title_short Identification of a novel S6K1 splice variant coding for the p60-S6K1 isoform
title_sort identification of a novel s6k1 splice variant coding for the p60-s6k1 isoform
topic Structure and Function of Biopolymers
topic_facet Structure and Function of Biopolymers
url https://nasplib.isofts.kiev.ua/handle/123456789/154396
work_keys_str_mv AT zaietsiv identificationofanovels6k1splicevariantcodingforthep60s6k1isoform
AT holiarvv identificationofanovels6k1splicevariantcodingforthep60s6k1isoform
AT filonenkovv identificationofanovels6k1splicevariantcodingforthep60s6k1isoform
AT zaietsiv ídentifíkacíânovogosplaisovogovaríantus6k1âkiikoduêízoformup60s6k1
AT holiarvv ídentifíkacíânovogosplaisovogovaríantus6k1âkiikoduêízoformup60s6k1
AT filonenkovv ídentifíkacíânovogosplaisovogovaríantus6k1âkiikoduêízoformup60s6k1
AT zaietsiv identifikaciânovogosplaisovogovariantas6k1kotoryikodiruetizoformup60s6k1
AT holiarvv identifikaciânovogosplaisovogovariantas6k1kotoryikodiruetizoformup60s6k1
AT filonenkovv identifikaciânovogosplaisovogovariantas6k1kotoryikodiruetizoformup60s6k1