Значение однонуклеотидного полиморфизма +276G/Т гена адипонектина (ADIPOQ) в формировании риска cахарного диабета 2 типа

Aim. To examine the association of single nucleotide polymorphism (SNP) +276G/Т ADIPOQ gene with Type 2 diabetes mellitus in slavonic population of Kharkov – Ukrainians and Russians. Methods. SNР ADIPOQ was detected in 544 type 2 diabetic patients and 140 subjects without ischemic heart disease, art...

Повний опис

Збережено в:
Бібліографічні деталі
Опубліковано в: :Фактори експериментальної еволюції організмів
Дата:2013
Автори: Атраментова, Л.А., Горшунская, М.Ю., Караченцев, Ю.И., Кравчун, Н.А., Тыжненко, Т.В., Почерняев, А.К., Опалейко, Ю.А., Полторак, В.В.
Формат: Стаття
Мова:Російська
Опубліковано: Інститут молекулярної біології і генетики НАН України 2013
Теми:
Онлайн доступ:https://nasplib.isofts.kiev.ua/handle/123456789/177821
Теги: Додати тег
Немає тегів, Будьте першим, хто поставить тег для цього запису!
Назва журналу:Digital Library of Periodicals of National Academy of Sciences of Ukraine
Цитувати:Значение однонуклеотидного полиморфизма +276G/Т гена адипонектина (ADIPOQ) в формировании риска cахарного диабета 2 типа / Л.А. Атраментова, М.Ю. Горшунская, Ю.И. Караченцев, Н.А. Кравчун, Т.В. Тыжненко, А.К. Почерняев, Ю.А. Опалейко, В.В. Полторак // Фактори експериментальної еволюції організмів: Зб. наук. пр. — 2013. — Т. 13. — С. 280-283. — Бібліогр.: 19 назв. — рос.

Репозитарії

Digital Library of Periodicals of National Academy of Sciences of Ukraine
_version_ 1859773883570192384
author Атраментова, Л.А.
Горшунская, М.Ю.
Караченцев, Ю.И.
Кравчун, Н.А.
Тыжненко, Т.В.
Почерняев, А.К.
Опалейко, Ю.А.
Полторак, В.В.
author_facet Атраментова, Л.А.
Горшунская, М.Ю.
Караченцев, Ю.И.
Кравчун, Н.А.
Тыжненко, Т.В.
Почерняев, А.К.
Опалейко, Ю.А.
Полторак, В.В.
citation_txt Значение однонуклеотидного полиморфизма +276G/Т гена адипонектина (ADIPOQ) в формировании риска cахарного диабета 2 типа / Л.А. Атраментова, М.Ю. Горшунская, Ю.И. Караченцев, Н.А. Кравчун, Т.В. Тыжненко, А.К. Почерняев, Ю.А. Опалейко, В.В. Полторак // Фактори експериментальної еволюції організмів: Зб. наук. пр. — 2013. — Т. 13. — С. 280-283. — Бібліогр.: 19 назв. — рос.
collection DSpace DC
container_title Фактори експериментальної еволюції організмів
description Aim. To examine the association of single nucleotide polymorphism (SNP) +276G/Т ADIPOQ gene with Type 2 diabetes mellitus in slavonic population of Kharkov – Ukrainians and Russians. Methods. SNР ADIPOQ was detected in 544 type 2 diabetic patients and 140 subjects without ischemic heart disease, arterial hypertension and diabetes. Genotyping of the SNP was performed by using the polymerase chain reaction – restriction fragments length polymorphism method. The statistical analysis was made, genotype and allele frequencies were tested by χ2. The Odds Ratio (OR) was calculated and a 95 % confidence interval (CI) was provide. Results. The genotype frequencies were consistent with Hardy-Weinberg equilibrium in both groups. Frequency of G allele is 0.69 in control group, and 0.60 in patients. The TT genotype was present in 8.6 % of control subjects, and in 16.6 % of patients (p<0.05). The TT genotype was associated with increased risk for type 2 diabetes mellitus (OR=2.00; CI 1.05-3.78; p<0,05). Homozygosity for major allele was associated with decreased risk of disease (OR=0.66;CI0,45-0,96 p<0,05). Conclusion. The TT genotype is a factor of increased risk for type 2 diabetes mellitus in the slavonic population. Key words: SNP 276 G/T adiponectine ADIPOQ, type 2 diabetes mellitus.
first_indexed 2025-12-02T07:48:10Z
format Article
fulltext 280 1. Myres NM, Rootsi S, Lin AA at al. (18 co-authors). A major Y-chromosome haplogroup R1b Holocene era foun- der effect in Central and Western Europe // Eur. J. Hum. Genet. – 2011. – Vol. 19, 1. – P. 95–101. 2. Rootsi S, Myres NM, Lin A.A. (33 co-authors) Distinguishing the co-ancestries of haplogroup G Y-chromosomes in the populations of Europe and the Caucasus // Eur. J. Hum. Genet. – 2012. – Vol. 20, 12. – P. 1275–1282. 3. Semino O, Magri C, Benuzzi G. at al. (16 co-authors) Origin, diffusion, and differentiation of Y-chromosome hap- logroups E and J: inferences on the neolithization of Europe and later migratory events in the Mediterranean area // Am. J. Hum. Genet. – 2004. – 74 (5). – P. 1023–1034. 4. Underhill P.A., Myres N.M., Rootsi S. (34 co-authors). Separating the post-Glacial coancestry of European and Asian Y chromosomes within haplogroup R1a // Eur. J. Hum. Genet. – 2010. – 18 (4). P. 479–484. 5. . . Y , , - - : . . . . . – ., 2011. – 26 . 6. : . . / . . . . , . . . – .: , 2003. – 459 . AGDZHOYAN A.T. 1, UTEVSKA . . 5, SKHALYAKHO R.A. 2, DIBIROVA KH.D. 2, 1, POCHESHKHOVA E.A. 3, 2, YUSUPOV Y.M. 4, MANSUROV R.I. 2, NAUMOVA E.A. 6, ATRAMENTOVA L.A. 5, BALANOVSKA E.V. 2, BALANOVSKY O.P. 1, 2 1 Vavilov Institute for General Genetics, Russian Academy of Sciences Russia, 119991, Moscow, GSP-1, Gubkin 3, e-mail: aagdzhoyan@gmal.com 2 Research Centre of Medical Genetics of the Russian Academy of Medical Science Russia, Moscow 3 Kuban State Medical University, Krasnodar, Russia 4 Institute for Humanities Research of the Republic of Bashkortostan, Ufa, Russia 5 V.N. Karazin Kharkiv National University, Kharkiv, Ukraine 6 Lomonosov Moscow State University Moscow, Russia TRACES OF ANCIENT MIGRATIONS IN THE CRIMEAN AND KAZAN TATARS GENEPOOLS: THE ANALYSIS OF Y-CHROMOSOME POLYMORPHISM Aims. The comparative analysis of gene pools of the Crimean and Kazan Tatars by the Y chromosome markers. Methods. The molecular, statistical and cartographical methods were used. Results. A high heterogeneity and lack of a dominant haplogroup were found for the gene pool of Crimean Tatars. Conclusions. The Crimean Tatars gene pool includes the «Middle Eastern», «Mediterranean» and, to a lesser extent, «Asian» haplogroups, and for Kazan Tatars the «Finno-Ugric» haplogroups are typical. The gene pools of the Crimean and Kazan Tatars are placed on the different «poles» of the genetic space of Eurasian Turkic peoples. Key words: Y-chromosome haplogroup, population, gene pool, Crimean and Kazan Tatars. . . 1, . . 2, . . 1, . . 1, . . 1, . . 1, . . 1, . . 1 1 « . . . » , 61002, , . , 10 2 , 61176, , . , 58, e-mail: atramentova@yandex.ru +276G/ (ADIPOQ) 2 (ADIPOQ) - 2 - [1]. , , 3q27 - [2, 3]. , - – , - 247 [4], - 281 - , , - , - - [5]. - , (+276G/ ). , ADI- POQ 2 - , [6–14], - , , . : - +276G/ ADIPOQ 2 - – . 544 - 2 , - « - . . . ». 140 , , - , . - - . Chelex-100 [15]. +276G/T (rs1501299), - “Biometra” ( - ) . ADIPOQ, +276G/ , (ADIPOQ276F ggcctctttcatcacagacc) (ADIPOQ276R agatgcagcaaagccaaagt) . - pUC19, MspI. - BsmI (Mva1269I) - 2 % [16]. - - 148 48 . ., - GG. - 196 . ., - . - GT 196, 148 48 . . ( .) , . , - +276G/T ADIPOQ ( – pUC19, MspI.; 1-8 – 2 ) GG GT TT GT GG GT GT GG 1 2 3 4 5 6 7 8 196 . . 148 . . 48 . . 282 - . , - OR (Odds Ratio) 95 %- - , - r, , , . - , - - , 2 , 0,05 [17]. , - , - 2 . G. 0,693, 0,601. , (0,399 0,307 ). - , , 2 - 3,7 % [18], p =0,311 (pG=0,689). - , (16,9 8,6 % - ), - (37,1 47,1 %). . 2 , n (%) GG GT TT pG 66 (47,1) 62 (44,3) 12 (8,6) 0,693 2 202 (37,1) 250 (46,0) 92 (16,9) 0,601 : n – , pG – G, 2 – 2 . ( 2 ) , - (r=0,09; 2=5,3; 2(0,05)=3,8; <0,05). - - - r=0,07; 2=7,5; 2(0,01)=6,6; <0,01. - - 2 (OR=2,00; 95 % 1,05-3,78; <0,05), - - (OR=0,66; 95 % 0,45–0,96; <0,05). , , , - 2 , , 17 %, 91 %. - , - - 7,6 %, - G - - - 3,4 %. - - – [19]. , - , - . 1. Lu Qi, Tricia Li, Eric Rim t. al. The +276 polymorphism of the APM1 gene, plasma adiponectin concentration, and cardiovascular risk in diabetic men // Diabetes. – 2005. – Vol.54. – P. 1607–1610. 2. GenBank: http://www.ncbi.nlm.nih.gov. GenBank is the NIH genetic sequence database, an annotated collection of all publicity available DNA sequences. 3. Yang W.S., Tsou P.L., Lee W.J. et.al. Allele-specific differential expression of a common adiponectin gene poly- morphism related to obesity // J Mol Med 2003, 81:428-434). 4. Sun Y, Xun K, Wang C et. al. Adiponectin, an unlocking adipocytokine // Cardiovasc Ther. – 2009. – Vol. 27, 1. – . 59–75. 283 5. Fumeron F., Aubert R., Siddiq A., Betoulle D., Péan F., Hadjadj S., Tichet J., Wilpart E., Chesnier M.-C., Balkau B., Froguel P., Marre M. Adiponectin gene polymorphisms and adiponectin levels are independently associated with the development of hyperglycemia during a 3-year period // Diabetes. – 2004. – Vol. 53. – P. 1150–1157. 6. Hu F.B., Doria A., Meigs J.D. et.al. Genetic variation of the adiponectin locus and risk of type 2 diabetes in women // Diabetes. – 2004. – Vol. 53. – P. 209–231. 7. Ohashi K., Ouchi N., Kihara S., et. al. Adiponectin 1164T mutation is associated with the metabolic syndrome and coronary artery disease // J. Am. Coll Cardiol. – 2004. – P. 1195-2000. 8. Tso A.W.K, Sham P.C., Wat N.M.S., Xu A., Cheung B.M.Y.,.Rong R, Fong C.H.Y., Xu J.Y., Cheng K.K.Y., Janus E.D., Lam K.S.L. Polymorphism of the gene encoding adiponectin and outcome of Chinese subjects with impared glucose tolerance: a 5-year follow-up study // Diabetologia. – 2006. – Vol. 49. – P. 1806–1815. 9. Vasseur F., Helbecque N., Dina C. et al. Single-nucleotide polymorphism haplotypes in both proximal promoter and exon 3 f the APM1 gene modulate adipocyte-secreted adiponectin hormone levels and contribute to the genetic risk for type 2 diabetes in French Caucasians // Hum Mol Genet. – 2002. – Vol.11. – P. 2607–2614. 10. Stumvoll M., Tschritter O., Fritsche A. t. al. Assotiation of the T-G polymorphism in adiponectin (exon 2) with obesity and insulin sensitivity // Diabetes. – 2002. – Vol. 51. – P. 37–41. 11. Menzaghi C., Ercolo T., Paola RD et. al. A haplotype at the adiponectin locus is associated with obesity and other features of the insulin resistance syndrome // Diabetes. – 2002. – Vol. 51. – P. 2306–2312. 12. Hara K., Boutin P., Mori Y. et al. Genetic variation in the gene encoding adiponectin is associated with an in- creased risk of type 2 diabetes in the Japanese population // Diabetes. – 2002. – Vol. 51. – . 536–540. 13. Ukkola O, Ravussin E, Jacobson P, Sjostrom L, Bouchard C. Mutations in the adiponectin gene in lean and obese subjects from the Swedish obese subjects cohort // Metabolism – 2003. – Vol. 52. – P. 881–884. 14. Vozarova de Courten B., Hansoon R.L., Funahashi T. et. al. Common polymorphisms in the adiponectin gene ACDC are not associated with diabetes in Pima Indians // Diabetes. – 2005. – Vol. 54. – P. 284–289. 15. Walsh P.S., Metzger D.A., Higuchi R. Chelex 100 as a medium for extraction of DNA for PCR-based typing from forensic material // BioTechniques. – 1991.– 10. – P. 506–513. 16. Reddy, M.N. association of adiponectin gene functional polymorphisms (+45 /G and +276 G/ ) with obese Breast Cancer / M.N. Reddy, K. Kumar, K. Jamil // J. Mol. Biomark. Diagn. – 2012. – Vol. 3. – P. 1–6. 17. Armitage P., Berry G. Statistical Methods in Medical Research // 3rd ed. Blackwell Scientific Publications. – Lon- don, 1994. – 620 p. 18. 2010 . . – 2011. – 32 . 19. – / . . . . – .: - - , 2009. – 528 . RAMENTOVA L. . 1, GORSHUNSKAYA .Y. 2, KARACHENTSEV Y.I. 1, RAVCHUN N. . 1, YZHNENKO .V. 1, P CHERNIAEV . . 1, P L I J. . 1, POLTORAK V.V. 1 1 V. Danilevsky Institute of Endocrine pathology problems at NAMS of Ukraine Ukraine, 61002, Kharkov , Artema str., 10 2 Kharkiv Postgraduate Medical Academy Ukraine, 61176, Kharkov, Korchagintsev str., 58, e-mail: atramentova@yandex.ru ROLE OF SINGLE NUCLEOTIDE POLYMORPHISM +276G/ OF ADIPONECTIN GENE (ADIPOQ) IN RISK OF TYPE 2 DIABETES MELLITUS DEVELOPMENT Aim. To examine the association of single nucleotide polymorphism (SNP) +276G/ ADIPOQ gene with Type 2 diabetes mellitus in slavonic population of Kharkov – Ukrainians and Russians. Methods. SN ADI- POQ was detected in 544 type 2 diabetic patients and 140 subjects without ischemic heart disease, arterial hypertension and diabetes. Genotyping of the SNP was performed by using the polymerase chain reaction – restriction fragments length polymorphism method. The statistical analysis was made, genotype and allele frequencies were tested by 2. The Odds Ratio (OR) was calculated and a 95 % confidence interval (CI) was provide. Results. The genotype frequencies were consistent with Hardy-Weinberg equilibrium in both groups. Frequency of G allele is 0.69 in control group, and 0.60 in patients. The TT genotype was present in 8.6 % of control subjects, and in 16.6 % of patients (p<0.05). The TT genotype was associated with increased risk for type 2 diabetes mellitus (OR=2.00; CI 1.05-3.78; p<0,05). Homozygosity for major allele was associated with decreased risk of disease (OR=0.66; CI 0,45-0,96 p<0,05). Conclusion. The TT genotype is a factor of increased risk for type 2 diabetes mellitus in the slavonic population. Key words: SNP 276 G/T adiponectine ADIPOQ, type 2 diabetes mellitus.
id nasplib_isofts_kiev_ua-123456789-177821
institution Digital Library of Periodicals of National Academy of Sciences of Ukraine
issn 2219-3782
language Russian
last_indexed 2025-12-02T07:48:10Z
publishDate 2013
publisher Інститут молекулярної біології і генетики НАН України
record_format dspace
spelling Атраментова, Л.А.
Горшунская, М.Ю.
Караченцев, Ю.И.
Кравчун, Н.А.
Тыжненко, Т.В.
Почерняев, А.К.
Опалейко, Ю.А.
Полторак, В.В.
2021-02-16T19:14:24Z
2021-02-16T19:14:24Z
2013
Значение однонуклеотидного полиморфизма +276G/Т гена адипонектина (ADIPOQ) в формировании риска cахарного диабета 2 типа / Л.А. Атраментова, М.Ю. Горшунская, Ю.И. Караченцев, Н.А. Кравчун, Т.В. Тыжненко, А.К. Почерняев, Ю.А. Опалейко, В.В. Полторак // Фактори експериментальної еволюції організмів: Зб. наук. пр. — 2013. — Т. 13. — С. 280-283. — Бібліогр.: 19 назв. — рос.
2219-3782
https://nasplib.isofts.kiev.ua/handle/123456789/177821
Aim. To examine the association of single nucleotide polymorphism (SNP) +276G/Т ADIPOQ gene with Type 2 diabetes mellitus in slavonic population of Kharkov – Ukrainians and Russians. Methods. SNР ADIPOQ was detected in 544 type 2 diabetic patients and 140 subjects without ischemic heart disease, arterial hypertension and diabetes. Genotyping of the SNP was performed by using the polymerase chain reaction – restriction fragments length polymorphism method. The statistical analysis was made, genotype and allele frequencies were tested by χ2. The Odds Ratio (OR) was calculated and a 95 % confidence interval (CI) was provide. Results. The genotype frequencies were consistent with Hardy-Weinberg equilibrium in both groups. Frequency of G allele is 0.69 in control group, and 0.60 in patients. The TT genotype was present in 8.6 % of control subjects, and in 16.6 % of patients (p<0.05). The TT genotype was associated with increased risk for type 2 diabetes mellitus (OR=2.00; CI 1.05-3.78; p<0,05). Homozygosity for major allele was associated with decreased risk of disease (OR=0.66;CI0,45-0,96 p<0,05). Conclusion. The TT genotype is a factor of increased risk for type 2 diabetes mellitus in the slavonic population. Key words: SNP 276 G/T adiponectine ADIPOQ, type 2 diabetes mellitus.
ru
Інститут молекулярної біології і генетики НАН України
Фактори експериментальної еволюції організмів
Генетика людини та медична генетика
Значение однонуклеотидного полиморфизма +276G/Т гена адипонектина (ADIPOQ) в формировании риска cахарного диабета 2 типа
Role of single nucleotide polymorphism +276G/Т of adiponectin gene (ADIPOQ) in risk of type 2 diabetes mellitus development
Article
published earlier
spellingShingle Значение однонуклеотидного полиморфизма +276G/Т гена адипонектина (ADIPOQ) в формировании риска cахарного диабета 2 типа
Атраментова, Л.А.
Горшунская, М.Ю.
Караченцев, Ю.И.
Кравчун, Н.А.
Тыжненко, Т.В.
Почерняев, А.К.
Опалейко, Ю.А.
Полторак, В.В.
Генетика людини та медична генетика
title Значение однонуклеотидного полиморфизма +276G/Т гена адипонектина (ADIPOQ) в формировании риска cахарного диабета 2 типа
title_alt Role of single nucleotide polymorphism +276G/Т of adiponectin gene (ADIPOQ) in risk of type 2 diabetes mellitus development
title_full Значение однонуклеотидного полиморфизма +276G/Т гена адипонектина (ADIPOQ) в формировании риска cахарного диабета 2 типа
title_fullStr Значение однонуклеотидного полиморфизма +276G/Т гена адипонектина (ADIPOQ) в формировании риска cахарного диабета 2 типа
title_full_unstemmed Значение однонуклеотидного полиморфизма +276G/Т гена адипонектина (ADIPOQ) в формировании риска cахарного диабета 2 типа
title_short Значение однонуклеотидного полиморфизма +276G/Т гена адипонектина (ADIPOQ) в формировании риска cахарного диабета 2 типа
title_sort значение однонуклеотидного полиморфизма +276g/т гена адипонектина (adipoq) в формировании риска cахарного диабета 2 типа
topic Генетика людини та медична генетика
topic_facet Генетика людини та медична генетика
url https://nasplib.isofts.kiev.ua/handle/123456789/177821
work_keys_str_mv AT atramentovala značenieodnonukleotidnogopolimorfizma276gtgenaadiponektinaadipoqvformirovaniiriskacaharnogodiabeta2tipa
AT goršunskaâmû značenieodnonukleotidnogopolimorfizma276gtgenaadiponektinaadipoqvformirovaniiriskacaharnogodiabeta2tipa
AT karačencevûi značenieodnonukleotidnogopolimorfizma276gtgenaadiponektinaadipoqvformirovaniiriskacaharnogodiabeta2tipa
AT kravčunna značenieodnonukleotidnogopolimorfizma276gtgenaadiponektinaadipoqvformirovaniiriskacaharnogodiabeta2tipa
AT tyžnenkotv značenieodnonukleotidnogopolimorfizma276gtgenaadiponektinaadipoqvformirovaniiriskacaharnogodiabeta2tipa
AT počernâevak značenieodnonukleotidnogopolimorfizma276gtgenaadiponektinaadipoqvformirovaniiriskacaharnogodiabeta2tipa
AT opaleikoûa značenieodnonukleotidnogopolimorfizma276gtgenaadiponektinaadipoqvformirovaniiriskacaharnogodiabeta2tipa
AT poltorakvv značenieodnonukleotidnogopolimorfizma276gtgenaadiponektinaadipoqvformirovaniiriskacaharnogodiabeta2tipa
AT atramentovala roleofsinglenucleotidepolymorphism276gtofadiponectingeneadipoqinriskoftype2diabetesmellitusdevelopment
AT goršunskaâmû roleofsinglenucleotidepolymorphism276gtofadiponectingeneadipoqinriskoftype2diabetesmellitusdevelopment
AT karačencevûi roleofsinglenucleotidepolymorphism276gtofadiponectingeneadipoqinriskoftype2diabetesmellitusdevelopment
AT kravčunna roleofsinglenucleotidepolymorphism276gtofadiponectingeneadipoqinriskoftype2diabetesmellitusdevelopment
AT tyžnenkotv roleofsinglenucleotidepolymorphism276gtofadiponectingeneadipoqinriskoftype2diabetesmellitusdevelopment
AT počernâevak roleofsinglenucleotidepolymorphism276gtofadiponectingeneadipoqinriskoftype2diabetesmellitusdevelopment
AT opaleikoûa roleofsinglenucleotidepolymorphism276gtofadiponectingeneadipoqinriskoftype2diabetesmellitusdevelopment
AT poltorakvv roleofsinglenucleotidepolymorphism276gtofadiponectingeneadipoqinriskoftype2diabetesmellitusdevelopment