Molecular-biological diagnostic as strategy for quality control and genetic purity of beneficial insects Trichogramma spp.

The study focuses on the development of molecular diagnostic methods for verifying the genetic purity of Trichogramma spp. entomophagous insect cultures used in biological pest control. Analysis of the internal transcribed spacer ITS2 of ribosomal DNA revealed interspecific differences and identifie...

Ausführliche Beschreibung

Gespeichert in:
Bibliographische Detailangaben
Veröffentlicht in:Доповіді НАН України
Datum:2025
Hauptverfasser: Melnychuk, M.D., Spyrydonov, V.G., Yu, W., Dall’Agata, M., Boychinov, B.
Format: Artikel
Sprache:Englisch
Veröffentlicht: Видавничий дім "Академперіодика" НАН України 2025
Schlagworte:
Online Zugang:https://nasplib.isofts.kiev.ua/handle/123456789/206608
Tags: Tag hinzufügen
Keine Tags, Fügen Sie den ersten Tag hinzu!
Назва журналу:Digital Library of Periodicals of National Academy of Sciences of Ukraine
Zitieren:Molecular-biological diagnostic as strategy for quality control and genetic purity of beneficial insects Trichogramma spp. / M.D. Melnychuk, V.G. Spyrydonov, W. Yu, M. Dall’Agata, B. Boychinov // Доповіді Національної академії наук України. — 2025. — № 4. — С. 27-32. — Бібліогр.: 6 назв. — англ.

Institution

Digital Library of Periodicals of National Academy of Sciences of Ukraine
_version_ 1859666353190862848
author Melnychuk, M.D.
Spyrydonov, V.G.
Yu, W.
Dall’Agata, M.
Boychinov, B.
author_facet Melnychuk, M.D.
Spyrydonov, V.G.
Yu, W.
Dall’Agata, M.
Boychinov, B.
citation_txt Molecular-biological diagnostic as strategy for quality control and genetic purity of beneficial insects Trichogramma spp. / M.D. Melnychuk, V.G. Spyrydonov, W. Yu, M. Dall’Agata, B. Boychinov // Доповіді Національної академії наук України. — 2025. — № 4. — С. 27-32. — Бібліогр.: 6 назв. — англ.
collection DSpace DC
container_title Доповіді НАН України
description The study focuses on the development of molecular diagnostic methods for verifying the genetic purity of Trichogramma spp. entomophagous insect cultures used in biological pest control. Analysis of the internal transcribed spacer ITS2 of ribosomal DNA revealed interspecific differences and identified mixed populations. Polymerase chain reaction, sequencing, and nucleotide sequence comparison ensured accurate determination of genetic consistency. The results demonstrated impurities in Trichogramma pintoi and T. evanescens samples, whereas T. brassicae and T. ahea confirmed purity. To maintain the effectiveness of biological control, regular monitoring of genetic purity is recommended every three months after two generations. Implementing these methods reduces chemical pesticide reliance, promoting ecosystem stability and organic product quality. Дослідження спрямовано на розроблення методів молекулярної діагностики для підтвердження генетичної чистоти культур ентомофагів роду Trichogramma, які використовуються у біологічному контролі та біозахисті рослин від комах-шкідників. За результатами аналізу внутрішнього транскрибованого спейсера ITS2 рибосомної ДНК виявлено міжвидові відмінності та ідентифіковано змішані популяції трихограми. Порівняння нуклеотидних послідовностей секвенованих фрагментів ITS2 уможливило точність визначення генетичної однорідності культур ентомофагів. Встановлено наявність домішок у зразках Trichogramma pintoi та T. evanescens, тоді як у T. brassicae та T. ahea підтверджено однорідність та генетичну чистоту. Для підтримки ефективності біологічного контролю рекомендовано регулярний моніторинг генетичної чистоти кожні три місяці після двох генерацій. Впровадження і валідація таких методів в Україні сприятиме ефективності біозахисту і забезпечить зменшення використання пестицидів заради збалансованості функціонування екосистем та підвищення якості й безпечності органічної рослинної продукції.
first_indexed 2025-11-30T11:52:53Z
format Article
fulltext 27 БІОЛОГІЯ BIOLOGY ISSN 1025-6415. Допов. Нац. акад. наук Укр. 2025. № 4: 27—32 C i t a t i o n: Melnychuk M.D., Spyrydonov V.G., Yu W., Dall’Agata M., Boychinov B. Molecular-biological diagnostic as strategy for quality control and genetic purity of benefi cial insects Trichogramma spp. Dopov. Nac. akad. nauk Ukr. 2025. No. 4. P. 27—32. https://doi.org/10.15407/dopovidi2025.04.027 © Publisher PH «Akademperiodyka» of the NAS of Ukraine, 2025. Th is is an open access article under the CC BY-NC-ND license (https://creativecommons.org/licenses/by-nc-nd/4.0/) https://doi.org/10.15407/dopovidi2025.04.027 UDC 632.937.1 M.D. Melnychuk1,2,3, https://orcid.org/0000-0002-7977-0344 V.G. Spyrydonov4, https://orcid.org/0000-0003-1197-0507 W. Yu5 M. Dall’Agata5, https://orcid.org/0000-0001-6932-751X B. Boychinov2 1 Vinnytsia National Agrarian University, Vinnytsia, Ukraine 2 Institute of Precision Agriculture, “Organic Invest Bio Protection”, Ltd., Doyrentsi, Bulgaria 3 “Quinta Essentia: Fabula Prima”, Ltd., Lublin, Poland 4 “Elbis”, Ltd., Vilnius, Lithuania 5 Shanghai Gene Era Bio-Science, Co, Ltd., Shanghai, China E-mail: melnychuk.maks@gmail.com Molecular-biological diagnostic as strategy for quality control and genetic purity of benefi cial insects Trichogramma spp. Represented by Academician of the NAS of Ukraine S.V. Dzyadevych Th e study focuses on the development of molecular diagnostic methods for verifying the genetic purity of Trichogramma spp. entomophagous insect cultures used in biological pest control. Analysis of the internal transcribed spacer ITS2 of ribosomal DNA revealed interspecifi c diff erences and identifi ed mixed populations. Polymerase chain reaction, sequencing, and nucleotide sequence comparison ensured accurate determination of genetic consistency. Th e results demonstrated impurities in Trichogramma pintoi and T. evanescens samples, whereas T. brassicae and T. ahea confi rmed purity. To maintain the eff ectiveness of biological control, regular monitoring of genetic purity is recommended every three months aft er two generations. Implementing these methods reduces chemical pesticide reliance, promoting ecosystem stability and organic product quality. Keywords: genetic purity, molecular diagnostics, Trichogramma spp., biological control, ITS2, sequencing, polymerase chain reaction. Introduction. In recent years, biotechnological processes for the production of biological plant protection products have become increasingly important. Th e populations of Europe, America, and a number of other countries are giving preference to environmentally friendly plant prod- ucts, despite the fact that the latter are more expensive in retail chains in many countries of the 28 ISSN 1025-6415. Dopov. Nac. akad. nauk Ukr. 2025. No. 4 M.D. Melnychuk, V.G. Spyrydonov, W. Yu, M. Dall’Agata, B. Boychinov world. Th us, the Research Institute of Organic Agriculture of Switzerland (FiBL) showed that Switzerland is the leader among the countries of the world with the highest level of consumption of organic products per capital, followed by Denmark, Luxembourg, Austria and Sweden. At the same time, Germany is the leader in the organic food market with an fi nancial indicator of 15,9 billion euro, followed by France (12,7 billion), Italy (3,9 billion) and Switzerland (3,7 billion). Th e world map of organic products looks quite predictable – Europe leads (with an “organic” budget of 54,5 billion euros), followed by North America (53,9 billion) and Asia (13,7 billion) (http:// organic.world.net.statistics.org/) [1]. In Ukraine, for example, back in 2021, the government approved a National Economic Strat- egy program until 2030, which outlined plans to transfer 3 % of Ukraine’s total agricultural land (about 1,3 million hectares) to organic production [2]. Egg parasitoids of the genus Trichogramma (Hymenoptera: Trichogrammatidae) are exten- sively used against agricultural pests of both annual and perennial crops [3]. Pure cultures ensure that benefi cial insects used in biological control programs are con- sistent in their behavior and eff ectiveness. Maintaining pure cultures preserves the genetic in- tegrity of insect entomophagous lines. Hybridization or contamination with other species or strains can dilute the desired features such as high fertility, specifi c host preferences, and envi- ronmental tolerance. In 2007, investigations of the genetic structure of the internal noncoding transcribed spacer 2 (ITS2) of ribosomal DNA of Trichogramma pintoi Voeg were conducted. Th e performed PCR-analysis with the following nucleotide sequence determination of ITS2 re- gion allowed us to reveal essential interspecifi c distinctions. Th e data obtained can be used to identify the species of T. pintoi [4]. Table 1. Primer sequences for ITS2 region amplification Name Sequence (5' → 3') Trich ITS2-F TGTGAACTGCAGGACACATG Trich ITS2-R GTCTTGCCTGCTCTGAG 18S rRNA 5.8S rRNA 28S rRNAITS1 ITS2 ITS regions Fig. 1. The ITS region structure in four different species of commercially used insects 1000 750 250 500 ITS2 COI NTC1 2 3 4 1 2 3 4 NTC Fig. 2. Agarose gel electrophoresis of PCR-amplified ITS2 region from Trichogramma spp. DNA bands were visualized on a 1.0  % agarose gel stained with SYBR Green I: 1  — T. pintoi; 2  — T. evanescens; 3 — T. brassicae; 4 — T. ahea; NTC — Non template control ▶ 29ISSN 1025-6415. Допов. Нац. акад. наук Укр. 2025. № 4 Molecular-biological diagnostic as strategy for quality control and genetic purity of benefi cial insects Trichogramma spp. On the basis of special practical importance, we are considering the possibility of creating ef- fective test-systems and subsequent molecular biological control of various Trichogramma lines, which provide both purity and genetic consistency through molecular diagnostic methods. In particular, we use amplifi cation and sequence analysis of the area of internal transcribed sequence 2 (ITS2) (Fig. 1) stocks, belonging to the genus Trichogramma: T. pintoi, T. evanescens, from Ukraine, and T. brassicae and T. ahea from Bulgaria were examined. Methods. DNA Extraction. DNA was extracted from four Trichogramma spp. samples (pro- vided by customers), using the GEB multisource DNA extraction kit in accordance with the manufacturer’s protocol. Briefl y, frozen insect samples (approximately 100 μg) were homogenized in 200 μL of lysis buff er supplemented with Proteinase K (20 mg/mL) and incubated at 60 °C. Nucleic acids were bound to a silica spin column by centrifugation at maxi- mum speed for 1 minute. Aft er binding, the columns were washed twice with 75 % ethanol-containing wash buff er, air-dried, and eluted in TE buff er (10 mM Tris-HCl, 1,0 mM EDTA, pH 8,0). Th e purifi ed DNA was immediately used for downstream PCR amplifi cation. Table 2. PCR cycling conditions Step Temperature, °C Time Repeats 1 95 5 min 1 2 95 30 sec 30 3 55 30 sec 30 4 72 1 min 30 Sample 1. (T. pintoi, not confirmed) Sample 2. (T. evanesces, not confirmed) Sample 3. (T. brassicae, confirmed) Sample 4. (T. ahea, confirmed) Fig. 3. Sequencing chromatograms of PCR-amplified ITS2 products from Trichogram- ma spp. Samples 1 (T. pintoi) and 2 (T. evanescens) exhibit mixed sequence peaks, in- dicating contamination or hybrid populations. Samples 3 (T. brassicae) and 4 (T. ahea) show pure chromatograms of single-species, confirming genetic purity 30 ISSN 1025-6415. Dopov. Nac. akad. nauk Ukr. 2025. No. 4 M.D. Melnychuk, V.G. Spyrydonov, W. Yu, M. Dall’Agata, B. Boychinov PCR Amplifi cation. Amplifi cation of the internal transcribed spacer 2 (ITS2) region was per- formed using GEB PCR Master Mix composed of 50 mM Tris-HCl (pH 8,8), 50 mM KCl, 0,25 mM dNTPs, 3 mM MgCl2, and 2,5 U Taq DNA polymerase per reaction. Each 25 μL reaction contained 5 pmol of forward (Trich ITS2-F) and reverse (Trich ITS2-R) primers [4] (Table 1) and 100 ng of extracted DNA. PCR conditions are given in Table 2. PCR products were separated by electrophoresis on a 1,0 % agarose gel at 100 mA for 20 min and visualized with SYBR Green I DNA stain using a gel documentation system. Sequencing and Sequence Analysis. Amplicons were purifi ed and subjected to Sanger se- quencing using the BigDye Terminator Kit (“Applied Biosystems”, USA). Sequencing was per- formed on a Genetic Analyzer System 3500 (“Applied Biosystems”). Th e obtained sequences were analyzed using the BLAST tool (Basic Local Alignment Search Tool) to compare them with refer- ence sequences and confi rm species affi liation based on the similarity of ITS2 regions. Results. PCR amplifi cation successfully generated products from all four Trichogramma sam- ples. Th e agarose gel electrophoresis confi rmed the presence of distinct bands corresponding to the expected ITS2 fragment size across all samples (Fig. 2). Sequencing results further revealed that samples 1 and 2 from the Ukrainian stock contained mixed populations, indicating contamination or hybridization between species. Meanwhile, sam- ples 3 and 4 from the Bulgarian insect stock corresponded to pure cultures, with sequences match- ing reference species with high fi delity (Fig. 3). Discussion. Molecular diagnostic methods for verifying the genetic purity of Trichogramma spp. entomophagous insect cultures used in biological pest control have become a widely used approach [4—6]. In particular, the combination of morphological trait analysis and molecular techniques (such as analysis of the mitochondrial cytochrome oxidase I (COI) gene) enabled the identifi cation of eight Trichogramma species from sixteen geographic populations [5]. Ad- ditionally, Ivezić et al., 2021 [6] developed primers based on the ITS2 region of the rRNA gene for a multiplex PCR assay aimed to identify two common Trichogramma species: T. brassicae Bezdenko, 1968 and T. evanescens Westwood, 1833, associated with Ostrinia nubilalis (Hübner, 1796) (Lepidoptera: Crambidae) in Serbia. Our study highlights the usefulness of molecular methods, particularly amplifi cation and se- quencing of the ITS2 region, for the genetic validation of benefi cial insect cultures in biological control programs. While electrophoresis confi rmed the amplifi cation success, sequencing pro- vided the defi nitive method for species identifi cation and the detection of genetic impurities. Th e identifi cation of mixed species within some of the tested samples emphasizes the critical need for routine genetic monitoring in the mass production of Trichogramma spp. Contamination with closely related species could result in reduced biocontrol effi ciency due to variability in host preference, environmental tolerance, and reproductive traits. Th e presence of pure lines in two samples (T. brassicae and T. ahea) confi rms that stringent colony management methods allow genetic stability to be maintained. Th ese pure lines are essen- tial to ensure predictable fi eld performance, regulatory compliance, and customer trust. Given the fi ndings we recommend implementing molecular quality control measures at regular intervals (every three months or aft er two breeding generations) to identify and elimi- nate genetic inconsistencies. In addition, promoting the use of the “genetically controlled” label on commercial biological control Trichogramma agents could serve as a powerful marketing 31ISSN 1025-6415. Допов. Нац. акад. наук Укр. 2025. № 4 Molecular-biological diagnostic as strategy for quality control and genetic purity of benefi cial insects Trichogramma spp. tool, signaling reliability and superior quality to users increasingly focused on sustainable agri- cultural practices. Conclusion. Maintaining pure cultures of entomophagous insect lines is fundamental to the success of biological control programs. Th is ensures consistency, preserves genetic integrity, pre- vents disease, supports research and development, ensures regulatory compliance, and underpins the commercial production of high-quality biological control agents. All these factors collectively contribute to sustainable management of pest populations and the reduction of chemical pesticide use, promoting healthier ecosystems and agricultural practices. Our research has revealed that some insect cultures of the entomophagous species Tricho- gramma spp. are not entirely pure. Th ey consist of a mixture of diff erent species. As a result, we have identifi ed an opportunity to test Trichogramma cultures for genetic consistency. To maintain quality control we recommend retesting the cultures for genetic purity confi rmation every three months following two generations. Th ese results can also serve as a valuable marketing tool, assur- ing customers high-quality products labeled as “Genetically controlled insect”. REFERENCES 1. Willer, H., Schlatter, B. & Trávníček, J. (Eds.) (2023). The world of organic agriculture. Statistics and emerging trends 2023. Research Institute of Organic Agriculture FiBL, Frick, 2023. https://doi.org/10.5281/zenodo.7572890 2. Cabinet of Ministers of Ukraine. (2021). On approval of the National Economic Strategy for the period until 2030. Resolution No. 179. Kyiv. Retrieved from https://www.kmu.gov.ua/npas/pro-zatverdzhennya-nacional- noyi-eko-a179 3. Sampaio, F., Marchioro, C. A., Takahashi, T. A. & Foerster, L. A. (2024). A new biocontrol agent against old enemies: The potential of Trichogramma foersteri for the control of Spodoptera frugiperda and Spodoptera eridania. Biol. Control, 192, 105504. https://doi.org/10.1016/j.biocontrol.2024.105504 4. Mel’nichuk, M. D., Spiridonov, V. G., Yasinskaya, N. P. & Oblap, R. V. (2007). The genetic analysis of entomophage of the species Trichogramma pintoi Voeg. Dopov. Nac. akad. nauk Ukr., No. 6, pp. 159-162 (in Russian). 5. Hua, H.-Q., Zhao, Z.-Y., Zhang, Y., Hu, J., Zhang, F. & Li, Y.-X. (2018). Inter- and intra-specific differentiation of Trichogramma (Hymenoptera: Trichogrammatidae) species using PCR–RFLP targeting COI. J. Econ. Entomol., 111, No. 4, pp. 1860-1867. https://doi.org/10.1093/jee/toy119 6. Ivezić, A., Rugman-Jones, P. F. & Trudić, B. (2021). Rapid molecular identification of Trichogramma (Hymenoptera: Trichogrammatidae) parasitizing the eggs of the European corn borer, Ostrinia nubilalis (Lepidoptera: Crambidae) in Serbia. Egypt. J. Biol. Pest Control, 31, 74. https://doi.org/10.1186/s41938-021-00414-5 Received 21.05.2025 32 ISSN 1025-6415. Dopov. Nac. akad. nauk Ukr. 2025. No. 4 M.D. Melnychuk, V.G. Spyrydonov, W. Yu, M. Dall’Agata, B. Boychinov М.Д. Мельничук1, 2, 3, https://orcid.org/0000-0002-7977-0344 В.Г. Спиридонов4, https://orcid.org/0000-0003-1197-0507 В. Ю5 М. Далл’Агата5, https://orcid.org/0000-0001-6932-751X Б. Бойчинов2 1 Вінницький національний аграрний університет, Вінниця, Україна 2 Інститут точного землеробства, ТОВ “Organic Invest Bio Protection”, Дойренці, Болгарія 3 “Quinta Essentia: Fabula Prima”, Ltd., Люблін, Польща 4 “Elbis”, Ltd., Вільнюс, Литва 5 “Shanghai Gene Era Bio-Science Co.”, Ltd., Шанхай, Китай E-mail: melnychuk.maks@gmail.com МОЛЕКУЛЯРНО-БІОЛОГІЧНА ДІАГНОСТИКА ЯК СТРАТЕГІЯ КОНТРОЛЮ ЯКОСТІ І ГЕНЕТИЧНОЇ ЧИСТОТИ КОРИСНИХ КОМАХ TRICHOGRAMMA spp. Дослідження спрямовано на розроблення методів молекулярної діагностики для підтвердження генетич- ної чистоти культур ентомофагів роду Trichogramma, які використовуються у біологічному контролі та біо- захисті рослин від комах-шкідників. За результатами аналізу внутрішнього транскрибованого спейсера ITS2 рибосомної ДНК виявлено міжвидові відмінності та ідентифіковано змішані популяції трихограми. Порівняння нуклеотидних послідовностей секвенованих фрагментів ITS2 уможливило точність визначен- ня генетичної однорідності культур ентомофагів. Встановлено наявність домішок у зразках Trichogramma pintoi та T. evanescens, тоді як у T. brassicae та T. ahea підтверджено однорідність та генетичну чистоту. Для підтримки ефективності біологічного контролю рекомендовано регулярний моніторинг генетичної чисто- ти кожні три місяці після двох генерацій. Впровадження і валідація таких методів в Україні сприятиме ефективності біозахисту і забезпечить зменшення використання пестицидів заради збалансованості функціонування екосистем та підвищення якості й безпечності органічної рослинної продукції. Ключові слова: генетична чистота, молекулярна діагностика, Trichogramma spp., біологічний контроль, ITS2, секвенування, полімеразна ланцюгова реакція.
id nasplib_isofts_kiev_ua-123456789-206608
institution Digital Library of Periodicals of National Academy of Sciences of Ukraine
issn 1025-6415
language English
last_indexed 2025-11-30T11:52:53Z
publishDate 2025
publisher Видавничий дім "Академперіодика" НАН України
record_format dspace
spelling Melnychuk, M.D.
Spyrydonov, V.G.
Yu, W.
Dall’Agata, M.
Boychinov, B.
2025-09-16T15:32:57Z
2025
Molecular-biological diagnostic as strategy for quality control and genetic purity of beneficial insects Trichogramma spp. / M.D. Melnychuk, V.G. Spyrydonov, W. Yu, M. Dall’Agata, B. Boychinov // Доповіді Національної академії наук України. — 2025. — № 4. — С. 27-32. — Бібліогр.: 6 назв. — англ.
1025-6415
https://nasplib.isofts.kiev.ua/handle/123456789/206608
632.937.1
https://doi.org/10.15407/dopovidi2025.04.027
The study focuses on the development of molecular diagnostic methods for verifying the genetic purity of Trichogramma spp. entomophagous insect cultures used in biological pest control. Analysis of the internal transcribed spacer ITS2 of ribosomal DNA revealed interspecific differences and identified mixed populations. Polymerase chain reaction, sequencing, and nucleotide sequence comparison ensured accurate determination of genetic consistency. The results demonstrated impurities in Trichogramma pintoi and T. evanescens samples, whereas T. brassicae and T. ahea confirmed purity. To maintain the effectiveness of biological control, regular monitoring of genetic purity is recommended every three months after two generations. Implementing these methods reduces chemical pesticide reliance, promoting ecosystem stability and organic product quality.
Дослідження спрямовано на розроблення методів молекулярної діагностики для підтвердження генетичної чистоти культур ентомофагів роду Trichogramma, які використовуються у біологічному контролі та біозахисті рослин від комах-шкідників. За результатами аналізу внутрішнього транскрибованого спейсера ITS2 рибосомної ДНК виявлено міжвидові відмінності та ідентифіковано змішані популяції трихограми. Порівняння нуклеотидних послідовностей секвенованих фрагментів ITS2 уможливило точність визначення генетичної однорідності культур ентомофагів. Встановлено наявність домішок у зразках Trichogramma pintoi та T. evanescens, тоді як у T. brassicae та T. ahea підтверджено однорідність та генетичну чистоту. Для підтримки ефективності біологічного контролю рекомендовано регулярний моніторинг генетичної чистоти кожні три місяці після двох генерацій. Впровадження і валідація таких методів в Україні сприятиме ефективності біозахисту і забезпечить зменшення використання пестицидів заради збалансованості функціонування екосистем та підвищення якості й безпечності органічної рослинної продукції.
en
Видавничий дім "Академперіодика" НАН України
Доповіді НАН України
Біологія
Molecular-biological diagnostic as strategy for quality control and genetic purity of beneficial insects Trichogramma spp.
Молекулярно-біологічна діагностика як стратегія контролю якості і генетичної чистоти корисних комах Trichogramma spp.
Article
published earlier
spellingShingle Molecular-biological diagnostic as strategy for quality control and genetic purity of beneficial insects Trichogramma spp.
Melnychuk, M.D.
Spyrydonov, V.G.
Yu, W.
Dall’Agata, M.
Boychinov, B.
Біологія
title Molecular-biological diagnostic as strategy for quality control and genetic purity of beneficial insects Trichogramma spp.
title_alt Молекулярно-біологічна діагностика як стратегія контролю якості і генетичної чистоти корисних комах Trichogramma spp.
title_full Molecular-biological diagnostic as strategy for quality control and genetic purity of beneficial insects Trichogramma spp.
title_fullStr Molecular-biological diagnostic as strategy for quality control and genetic purity of beneficial insects Trichogramma spp.
title_full_unstemmed Molecular-biological diagnostic as strategy for quality control and genetic purity of beneficial insects Trichogramma spp.
title_short Molecular-biological diagnostic as strategy for quality control and genetic purity of beneficial insects Trichogramma spp.
title_sort molecular-biological diagnostic as strategy for quality control and genetic purity of beneficial insects trichogramma spp.
topic Біологія
topic_facet Біологія
url https://nasplib.isofts.kiev.ua/handle/123456789/206608
work_keys_str_mv AT melnychukmd molecularbiologicaldiagnosticasstrategyforqualitycontrolandgeneticpurityofbeneficialinsectstrichogrammaspp
AT spyrydonovvg molecularbiologicaldiagnosticasstrategyforqualitycontrolandgeneticpurityofbeneficialinsectstrichogrammaspp
AT yuw molecularbiologicaldiagnosticasstrategyforqualitycontrolandgeneticpurityofbeneficialinsectstrichogrammaspp
AT dallagatam molecularbiologicaldiagnosticasstrategyforqualitycontrolandgeneticpurityofbeneficialinsectstrichogrammaspp
AT boychinovb molecularbiologicaldiagnosticasstrategyforqualitycontrolandgeneticpurityofbeneficialinsectstrichogrammaspp
AT melnychukmd molekulârnobíologíčnadíagnostikaâkstrategíâkontrolûâkostíígenetičnoíčistotikorisnihkomahtrichogrammaspp
AT spyrydonovvg molekulârnobíologíčnadíagnostikaâkstrategíâkontrolûâkostíígenetičnoíčistotikorisnihkomahtrichogrammaspp
AT yuw molekulârnobíologíčnadíagnostikaâkstrategíâkontrolûâkostíígenetičnoíčistotikorisnihkomahtrichogrammaspp
AT dallagatam molekulârnobíologíčnadíagnostikaâkstrategíâkontrolûâkostíígenetičnoíčistotikorisnihkomahtrichogrammaspp
AT boychinovb molekulârnobíologíčnadíagnostikaâkstrategíâkontrolûâkostíígenetičnoíčistotikorisnihkomahtrichogrammaspp