Molecular-biological diagnostic as strategy for quality control and genetic purity of beneficial insects Trichogramma spp.
The study focuses on the development of molecular diagnostic methods for verifying the genetic purity of Trichogramma spp. entomophagous insect cultures used in biological pest control. Analysis of the internal transcribed spacer ITS2 of ribosomal DNA revealed interspecific differences and identifie...
Збережено в:
| Опубліковано в: : | Доповіді НАН України |
|---|---|
| Дата: | 2025 |
| Автори: | , , , , |
| Формат: | Стаття |
| Мова: | Англійська |
| Опубліковано: |
Видавничий дім "Академперіодика" НАН України
2025
|
| Теми: | |
| Онлайн доступ: | https://nasplib.isofts.kiev.ua/handle/123456789/206608 |
| Теги: |
Додати тег
Немає тегів, Будьте першим, хто поставить тег для цього запису!
|
| Назва журналу: | Digital Library of Periodicals of National Academy of Sciences of Ukraine |
| Цитувати: | Molecular-biological diagnostic as strategy for quality control and genetic purity of beneficial insects Trichogramma spp. / M.D. Melnychuk, V.G. Spyrydonov, W. Yu, M. Dall’Agata, B. Boychinov // Доповіді Національної академії наук України. — 2025. — № 4. — С. 27-32. — Бібліогр.: 6 назв. — англ. |
Репозитарії
Digital Library of Periodicals of National Academy of Sciences of Ukraine| _version_ | 1859666353190862848 |
|---|---|
| author | Melnychuk, M.D. Spyrydonov, V.G. Yu, W. Dall’Agata, M. Boychinov, B. |
| author_facet | Melnychuk, M.D. Spyrydonov, V.G. Yu, W. Dall’Agata, M. Boychinov, B. |
| citation_txt | Molecular-biological diagnostic as strategy for quality control and genetic purity of beneficial insects Trichogramma spp. / M.D. Melnychuk, V.G. Spyrydonov, W. Yu, M. Dall’Agata, B. Boychinov // Доповіді Національної академії наук України. — 2025. — № 4. — С. 27-32. — Бібліогр.: 6 назв. — англ. |
| collection | DSpace DC |
| container_title | Доповіді НАН України |
| description | The study focuses on the development of molecular diagnostic methods for verifying the genetic purity of Trichogramma spp. entomophagous insect cultures used in biological pest control. Analysis of the internal transcribed spacer ITS2 of ribosomal DNA revealed interspecific differences and identified mixed populations. Polymerase chain reaction, sequencing, and nucleotide sequence comparison ensured accurate determination of genetic consistency. The results demonstrated impurities in Trichogramma pintoi and T. evanescens samples, whereas T. brassicae and T. ahea confirmed purity. To maintain the effectiveness of biological control, regular monitoring of genetic purity is recommended every three months after two generations. Implementing these methods reduces chemical pesticide reliance, promoting ecosystem stability and organic product quality.
Дослідження спрямовано на розроблення методів молекулярної діагностики для підтвердження генетичної чистоти культур ентомофагів роду Trichogramma, які використовуються у біологічному контролі та біозахисті рослин від комах-шкідників. За результатами аналізу внутрішнього транскрибованого спейсера ITS2 рибосомної ДНК виявлено міжвидові відмінності та ідентифіковано змішані популяції трихограми. Порівняння нуклеотидних послідовностей секвенованих фрагментів ITS2 уможливило точність визначення генетичної однорідності культур ентомофагів. Встановлено наявність домішок у зразках Trichogramma pintoi та T. evanescens, тоді як у T. brassicae та T. ahea підтверджено однорідність та генетичну чистоту. Для підтримки ефективності біологічного контролю рекомендовано регулярний моніторинг генетичної чистоти кожні три місяці після двох генерацій. Впровадження і валідація таких методів в Україні сприятиме ефективності біозахисту і забезпечить зменшення використання пестицидів заради збалансованості функціонування екосистем та підвищення якості й безпечності органічної рослинної продукції.
|
| first_indexed | 2025-11-30T11:52:53Z |
| format | Article |
| fulltext |
27
БІОЛОГІЯ
BIOLOGY
ISSN 1025-6415. Допов. Нац. акад. наук Укр. 2025. № 4: 27—32
C i t a t i o n: Melnychuk M.D., Spyrydonov V.G., Yu W., Dall’Agata M., Boychinov B. Molecular-biological diagnostic as
strategy for quality control and genetic purity of benefi cial insects Trichogramma spp. Dopov. Nac. akad. nauk Ukr. 2025.
No. 4. P. 27—32. https://doi.org/10.15407/dopovidi2025.04.027
© Publisher PH «Akademperiodyka» of the NAS of Ukraine, 2025. Th is is an open access article under the CC BY-NC-ND
license (https://creativecommons.org/licenses/by-nc-nd/4.0/)
https://doi.org/10.15407/dopovidi2025.04.027
UDC 632.937.1
M.D. Melnychuk1,2,3, https://orcid.org/0000-0002-7977-0344
V.G. Spyrydonov4, https://orcid.org/0000-0003-1197-0507
W. Yu5
M. Dall’Agata5, https://orcid.org/0000-0001-6932-751X
B. Boychinov2
1 Vinnytsia National Agrarian University, Vinnytsia, Ukraine
2 Institute of Precision Agriculture, “Organic Invest Bio Protection”, Ltd., Doyrentsi, Bulgaria
3 “Quinta Essentia: Fabula Prima”, Ltd., Lublin, Poland
4 “Elbis”, Ltd., Vilnius, Lithuania
5 Shanghai Gene Era Bio-Science, Co, Ltd., Shanghai, China
E-mail: melnychuk.maks@gmail.com
Molecular-biological diagnostic
as strategy for quality control and genetic purity
of benefi cial insects Trichogramma spp.
Represented by Academician of the NAS of Ukraine S.V. Dzyadevych
Th e study focuses on the development of molecular diagnostic methods for verifying the genetic purity of Trichogramma
spp. entomophagous insect cultures used in biological pest control. Analysis of the internal transcribed spacer ITS2
of ribosomal DNA revealed interspecifi c diff erences and identifi ed mixed populations. Polymerase chain reaction,
sequencing, and nucleotide sequence comparison ensured accurate determination of genetic consistency. Th e results
demonstrated impurities in Trichogramma pintoi and T. evanescens samples, whereas T. brassicae and T. ahea confi rmed
purity. To maintain the eff ectiveness of biological control, regular monitoring of genetic purity is recommended every
three months aft er two generations. Implementing these methods reduces chemical pesticide reliance, promoting
ecosystem stability and organic product quality.
Keywords: genetic purity, molecular diagnostics, Trichogramma spp., biological control, ITS2, sequencing, polymerase
chain reaction.
Introduction. In recent years, biotechnological processes for the production of biological plant
protection products have become increasingly important. Th e populations of Europe, America,
and a number of other countries are giving preference to environmentally friendly plant prod-
ucts, despite the fact that the latter are more expensive in retail chains in many countries of the
28 ISSN 1025-6415. Dopov. Nac. akad. nauk Ukr. 2025. No. 4
M.D. Melnychuk, V.G. Spyrydonov, W. Yu, M. Dall’Agata, B. Boychinov
world. Th us, the Research Institute of Organic Agriculture of Switzerland (FiBL) showed that
Switzerland is the leader among the countries of the world with the highest level of consumption
of organic products per capital, followed by Denmark, Luxembourg, Austria and Sweden. At the
same time, Germany is the leader in the organic food market with an fi nancial indicator of 15,9
billion euro, followed by France (12,7 billion), Italy (3,9 billion) and Switzerland (3,7 billion). Th e
world map of organic products looks quite predictable – Europe leads (with an “organic” budget
of 54,5 billion euros), followed by North America (53,9 billion) and Asia (13,7 billion) (http://
organic.world.net.statistics.org/) [1].
In Ukraine, for example, back in 2021, the government approved a National Economic Strat-
egy program until 2030, which outlined plans to transfer 3 % of Ukraine’s total agricultural land
(about 1,3 million hectares) to organic production [2].
Egg parasitoids of the genus Trichogramma (Hymenoptera: Trichogrammatidae) are exten-
sively used against agricultural pests of both annual and perennial crops [3].
Pure cultures ensure that benefi cial insects used in biological control programs are con-
sistent in their behavior and eff ectiveness. Maintaining pure cultures preserves the genetic in-
tegrity of insect entomophagous lines. Hybridization or contamination with other species or
strains can dilute the desired features such as high fertility, specifi c host preferences, and envi-
ronmental tolerance. In 2007, investigations of the genetic structure of the internal noncoding
transcribed spacer 2 (ITS2) of ribosomal DNA
of Trichogramma pintoi Voeg were conducted.
Th e performed PCR-analysis with the following
nucleotide sequence determination of ITS2 re-
gion allowed us to reveal essential interspecifi c
distinctions. Th e data obtained can be used to
identify the species of T. pintoi [4].
Table 1. Primer sequences
for ITS2 region amplification
Name Sequence (5' → 3')
Trich ITS2-F TGTGAACTGCAGGACACATG
Trich ITS2-R GTCTTGCCTGCTCTGAG
18S rRNA 5.8S rRNA 28S rRNAITS1 ITS2
ITS regions
Fig. 1. The ITS region structure in four different species
of commercially used insects
1000
750
250
500
ITS2 COI
NTC1 2 3 4 1 2 3 4 NTC
Fig. 2. Agarose gel electrophoresis of PCR-amplified ITS2 region
from Trichogramma spp. DNA bands were visualized on a 1.0 %
agarose gel stained with SYBR Green I: 1 — T. pintoi; 2 —
T. evanescens; 3 — T. brassicae; 4 — T. ahea; NTC — Non template
control
▶
29ISSN 1025-6415. Допов. Нац. акад. наук Укр. 2025. № 4
Molecular-biological diagnostic as strategy for quality control and genetic purity of benefi cial insects Trichogramma spp.
On the basis of special practical importance, we are considering the possibility of creating ef-
fective test-systems and subsequent molecular biological control of various Trichogramma lines,
which provide both purity and genetic consistency through molecular diagnostic methods. In
particular, we use amplifi cation and sequence analysis of the area of internal transcribed sequence
2 (ITS2) (Fig. 1) stocks, belonging to the genus Trichogramma: T. pintoi, T. evanescens, from
Ukraine, and T. brassicae and T. ahea from Bulgaria were examined.
Methods. DNA Extraction. DNA was extracted from four Trichogramma spp. samples (pro-
vided by customers), using the GEB multisource DNA extraction kit in accordance with the
manufacturer’s protocol. Briefl y, frozen insect samples (approximately 100 μg) were homogenized
in 200 μL of lysis buff er supplemented with Proteinase K
(20 mg/mL) and incubated at 60 °C. Nucleic acids were
bound to a silica spin column by centrifugation at maxi-
mum speed for 1 minute. Aft er binding, the columns were
washed twice with 75 % ethanol-containing wash buff er,
air-dried, and eluted in TE buff er (10 mM Tris-HCl, 1,0
mM EDTA, pH 8,0). Th e purifi ed DNA was immediately
used for downstream PCR amplifi cation.
Table 2. PCR cycling conditions
Step Temperature, °C Time Repeats
1 95 5 min 1
2 95 30 sec 30
3 55 30 sec 30
4 72 1 min 30
Sample 1. (T. pintoi, not confirmed)
Sample 2. (T. evanesces, not confirmed)
Sample 3. (T. brassicae, confirmed)
Sample 4. (T. ahea, confirmed)
Fig. 3. Sequencing chromatograms of PCR-amplified ITS2 products from Trichogram-
ma spp. Samples 1 (T. pintoi) and 2 (T. evanescens) exhibit mixed sequence peaks, in-
dicating contamination or hybrid populations. Samples 3 (T. brassicae) and 4 (T. ahea)
show pure chromatograms of single-species, confirming genetic purity
30 ISSN 1025-6415. Dopov. Nac. akad. nauk Ukr. 2025. No. 4
M.D. Melnychuk, V.G. Spyrydonov, W. Yu, M. Dall’Agata, B. Boychinov
PCR Amplifi cation. Amplifi cation of the internal transcribed spacer 2 (ITS2) region was per-
formed using GEB PCR Master Mix composed of 50 mM Tris-HCl (pH 8,8), 50 mM KCl, 0,25
mM dNTPs, 3 mM MgCl2, and 2,5 U Taq DNA polymerase per reaction. Each 25 μL reaction
contained 5 pmol of forward (Trich ITS2-F) and reverse (Trich ITS2-R) primers [4] (Table 1) and
100 ng of extracted DNA.
PCR conditions are given in Table 2.
PCR products were separated by electrophoresis on a 1,0 % agarose gel at 100 mA for 20 min
and visualized with SYBR Green I DNA stain using a gel documentation system.
Sequencing and Sequence Analysis. Amplicons were purifi ed and subjected to Sanger se-
quencing using the BigDye Terminator Kit (“Applied Biosystems”, USA). Sequencing was per-
formed on a Genetic Analyzer System 3500 (“Applied Biosystems”). Th e obtained sequences were
analyzed using the BLAST tool (Basic Local Alignment Search Tool) to compare them with refer-
ence sequences and confi rm species affi liation based on the similarity of ITS2 regions.
Results. PCR amplifi cation successfully generated products from all four Trichogramma sam-
ples. Th e agarose gel electrophoresis confi rmed the presence of distinct bands corresponding to
the expected ITS2 fragment size across all samples (Fig. 2).
Sequencing results further revealed that samples 1 and 2 from the Ukrainian stock contained
mixed populations, indicating contamination or hybridization between species. Meanwhile, sam-
ples 3 and 4 from the Bulgarian insect stock corresponded to pure cultures, with sequences match-
ing reference species with high fi delity (Fig. 3).
Discussion. Molecular diagnostic methods for verifying the genetic purity of Trichogramma
spp. entomophagous insect cultures used in biological pest control have become a widely used
approach [4—6]. In particular, the combination of morphological trait analysis and molecular
techniques (such as analysis of the mitochondrial cytochrome oxidase I (COI) gene) enabled
the identifi cation of eight Trichogramma species from sixteen geographic populations [5]. Ad-
ditionally, Ivezić et al., 2021 [6] developed primers based on the ITS2 region of the rRNA gene
for a multiplex PCR assay aimed to identify two common Trichogramma species: T. brassicae
Bezdenko, 1968 and T. evanescens Westwood, 1833, associated with Ostrinia nubilalis (Hübner,
1796) (Lepidoptera: Crambidae) in Serbia.
Our study highlights the usefulness of molecular methods, particularly amplifi cation and se-
quencing of the ITS2 region, for the genetic validation of benefi cial insect cultures in biological
control programs. While electrophoresis confi rmed the amplifi cation success, sequencing pro-
vided the defi nitive method for species identifi cation and the detection of genetic impurities.
Th e identifi cation of mixed species within some of the tested samples emphasizes the critical
need for routine genetic monitoring in the mass production of Trichogramma spp. Contamination
with closely related species could result in reduced biocontrol effi ciency due to variability in host
preference, environmental tolerance, and reproductive traits.
Th e presence of pure lines in two samples (T. brassicae and T. ahea) confi rms that stringent
colony management methods allow genetic stability to be maintained. Th ese pure lines are essen-
tial to ensure predictable fi eld performance, regulatory compliance, and customer trust.
Given the fi ndings we recommend implementing molecular quality control measures at
regular intervals (every three months or aft er two breeding generations) to identify and elimi-
nate genetic inconsistencies. In addition, promoting the use of the “genetically controlled” label
on commercial biological control Trichogramma agents could serve as a powerful marketing
31ISSN 1025-6415. Допов. Нац. акад. наук Укр. 2025. № 4
Molecular-biological diagnostic as strategy for quality control and genetic purity of benefi cial insects Trichogramma spp.
tool, signaling reliability and superior quality to users increasingly focused on sustainable agri-
cultural practices.
Conclusion. Maintaining pure cultures of entomophagous insect lines is fundamental to the
success of biological control programs. Th is ensures consistency, preserves genetic integrity, pre-
vents disease, supports research and development, ensures regulatory compliance, and underpins
the commercial production of high-quality biological control agents. All these factors collectively
contribute to sustainable management of pest populations and the reduction of chemical pesticide
use, promoting healthier ecosystems and agricultural practices.
Our research has revealed that some insect cultures of the entomophagous species Tricho-
gramma spp. are not entirely pure. Th ey consist of a mixture of diff erent species. As a result, we
have identifi ed an opportunity to test Trichogramma cultures for genetic consistency. To maintain
quality control we recommend retesting the cultures for genetic purity confi rmation every three
months following two generations. Th ese results can also serve as a valuable marketing tool, assur-
ing customers high-quality products labeled as “Genetically controlled insect”.
REFERENCES
1. Willer, H., Schlatter, B. & Trávníček, J. (Eds.) (2023). The world of organic agriculture. Statistics and emerging
trends 2023. Research Institute of Organic Agriculture FiBL, Frick, 2023. https://doi.org/10.5281/zenodo.7572890
2. Cabinet of Ministers of Ukraine. (2021). On approval of the National Economic Strategy for the period until
2030. Resolution No. 179. Kyiv. Retrieved from https://www.kmu.gov.ua/npas/pro-zatverdzhennya-nacional-
noyi-eko-a179
3. Sampaio, F., Marchioro, C. A., Takahashi, T. A. & Foerster, L. A. (2024). A new biocontrol agent against old
enemies: The potential of Trichogramma foersteri for the control of Spodoptera frugiperda and Spodoptera
eridania. Biol. Control, 192, 105504. https://doi.org/10.1016/j.biocontrol.2024.105504
4. Mel’nichuk, M. D., Spiridonov, V. G., Yasinskaya, N. P. & Oblap, R. V. (2007). The genetic analysis of entomophage
of the species Trichogramma pintoi Voeg. Dopov. Nac. akad. nauk Ukr., No. 6, pp. 159-162 (in Russian).
5. Hua, H.-Q., Zhao, Z.-Y., Zhang, Y., Hu, J., Zhang, F. & Li, Y.-X. (2018). Inter- and intra-specific differentiation of
Trichogramma (Hymenoptera: Trichogrammatidae) species using PCR–RFLP targeting COI. J. Econ. Entomol.,
111, No. 4, pp. 1860-1867. https://doi.org/10.1093/jee/toy119
6. Ivezić, A., Rugman-Jones, P. F. & Trudić, B. (2021). Rapid molecular identification of Trichogramma (Hymenoptera:
Trichogrammatidae) parasitizing the eggs of the European corn borer, Ostrinia nubilalis (Lepidoptera:
Crambidae) in Serbia. Egypt. J. Biol. Pest Control, 31, 74. https://doi.org/10.1186/s41938-021-00414-5
Received 21.05.2025
32 ISSN 1025-6415. Dopov. Nac. akad. nauk Ukr. 2025. No. 4
M.D. Melnychuk, V.G. Spyrydonov, W. Yu, M. Dall’Agata, B. Boychinov
М.Д. Мельничук1, 2, 3, https://orcid.org/0000-0002-7977-0344
В.Г. Спиридонов4, https://orcid.org/0000-0003-1197-0507
В. Ю5
М. Далл’Агата5, https://orcid.org/0000-0001-6932-751X
Б. Бойчинов2
1 Вінницький національний аграрний університет, Вінниця, Україна
2 Інститут точного землеробства, ТОВ “Organic Invest Bio Protection”, Дойренці, Болгарія
3 “Quinta Essentia: Fabula Prima”, Ltd., Люблін, Польща
4 “Elbis”, Ltd., Вільнюс, Литва
5 “Shanghai Gene Era Bio-Science Co.”, Ltd., Шанхай, Китай
E-mail: melnychuk.maks@gmail.com
МОЛЕКУЛЯРНО-БІОЛОГІЧНА ДІАГНОСТИКА ЯК СТРАТЕГІЯ КОНТРОЛЮ ЯКОСТІ
І ГЕНЕТИЧНОЇ ЧИСТОТИ КОРИСНИХ КОМАХ TRICHOGRAMMA spp.
Дослідження спрямовано на розроблення методів молекулярної діагностики для підтвердження генетич-
ної чистоти культур ентомофагів роду Trichogramma, які використовуються у біологічному контролі та біо-
захисті рослин від комах-шкідників. За результатами аналізу внутрішнього транскрибованого спейсера
ITS2 рибосомної ДНК виявлено міжвидові відмінності та ідентифіковано змішані популяції трихограми.
Порівняння нуклеотидних послідовностей секвенованих фрагментів ITS2 уможливило точність визначен-
ня генетичної однорідності культур ентомофагів. Встановлено наявність домішок у зразках Trichogramma
pintoi та T. evanescens, тоді як у T. brassicae та T. ahea підтверджено однорідність та генетичну чистоту. Для
підтримки ефективності біологічного контролю рекомендовано регулярний моніторинг генетичної чисто-
ти кожні три місяці після двох генерацій. Впровадження і валідація таких методів в Україні сприятиме
ефективності біозахисту і забезпечить зменшення використання пестицидів заради збалансованості
функціонування екосистем та підвищення якості й безпечності органічної рослинної продукції.
Ключові слова: генетична чистота, молекулярна діагностика, Trichogramma spp., біологічний контроль,
ITS2, секвенування, полімеразна ланцюгова реакція.
|
| id | nasplib_isofts_kiev_ua-123456789-206608 |
| institution | Digital Library of Periodicals of National Academy of Sciences of Ukraine |
| issn | 1025-6415 |
| language | English |
| last_indexed | 2025-11-30T11:52:53Z |
| publishDate | 2025 |
| publisher | Видавничий дім "Академперіодика" НАН України |
| record_format | dspace |
| spelling | Melnychuk, M.D. Spyrydonov, V.G. Yu, W. Dall’Agata, M. Boychinov, B. 2025-09-16T15:32:57Z 2025 Molecular-biological diagnostic as strategy for quality control and genetic purity of beneficial insects Trichogramma spp. / M.D. Melnychuk, V.G. Spyrydonov, W. Yu, M. Dall’Agata, B. Boychinov // Доповіді Національної академії наук України. — 2025. — № 4. — С. 27-32. — Бібліогр.: 6 назв. — англ. 1025-6415 https://nasplib.isofts.kiev.ua/handle/123456789/206608 632.937.1 https://doi.org/10.15407/dopovidi2025.04.027 The study focuses on the development of molecular diagnostic methods for verifying the genetic purity of Trichogramma spp. entomophagous insect cultures used in biological pest control. Analysis of the internal transcribed spacer ITS2 of ribosomal DNA revealed interspecific differences and identified mixed populations. Polymerase chain reaction, sequencing, and nucleotide sequence comparison ensured accurate determination of genetic consistency. The results demonstrated impurities in Trichogramma pintoi and T. evanescens samples, whereas T. brassicae and T. ahea confirmed purity. To maintain the effectiveness of biological control, regular monitoring of genetic purity is recommended every three months after two generations. Implementing these methods reduces chemical pesticide reliance, promoting ecosystem stability and organic product quality. Дослідження спрямовано на розроблення методів молекулярної діагностики для підтвердження генетичної чистоти культур ентомофагів роду Trichogramma, які використовуються у біологічному контролі та біозахисті рослин від комах-шкідників. За результатами аналізу внутрішнього транскрибованого спейсера ITS2 рибосомної ДНК виявлено міжвидові відмінності та ідентифіковано змішані популяції трихограми. Порівняння нуклеотидних послідовностей секвенованих фрагментів ITS2 уможливило точність визначення генетичної однорідності культур ентомофагів. Встановлено наявність домішок у зразках Trichogramma pintoi та T. evanescens, тоді як у T. brassicae та T. ahea підтверджено однорідність та генетичну чистоту. Для підтримки ефективності біологічного контролю рекомендовано регулярний моніторинг генетичної чистоти кожні три місяці після двох генерацій. Впровадження і валідація таких методів в Україні сприятиме ефективності біозахисту і забезпечить зменшення використання пестицидів заради збалансованості функціонування екосистем та підвищення якості й безпечності органічної рослинної продукції. en Видавничий дім "Академперіодика" НАН України Доповіді НАН України Біологія Molecular-biological diagnostic as strategy for quality control and genetic purity of beneficial insects Trichogramma spp. Молекулярно-біологічна діагностика як стратегія контролю якості і генетичної чистоти корисних комах Trichogramma spp. Article published earlier |
| spellingShingle | Molecular-biological diagnostic as strategy for quality control and genetic purity of beneficial insects Trichogramma spp. Melnychuk, M.D. Spyrydonov, V.G. Yu, W. Dall’Agata, M. Boychinov, B. Біологія |
| title | Molecular-biological diagnostic as strategy for quality control and genetic purity of beneficial insects Trichogramma spp. |
| title_alt | Молекулярно-біологічна діагностика як стратегія контролю якості і генетичної чистоти корисних комах Trichogramma spp. |
| title_full | Molecular-biological diagnostic as strategy for quality control and genetic purity of beneficial insects Trichogramma spp. |
| title_fullStr | Molecular-biological diagnostic as strategy for quality control and genetic purity of beneficial insects Trichogramma spp. |
| title_full_unstemmed | Molecular-biological diagnostic as strategy for quality control and genetic purity of beneficial insects Trichogramma spp. |
| title_short | Molecular-biological diagnostic as strategy for quality control and genetic purity of beneficial insects Trichogramma spp. |
| title_sort | molecular-biological diagnostic as strategy for quality control and genetic purity of beneficial insects trichogramma spp. |
| topic | Біологія |
| topic_facet | Біологія |
| url | https://nasplib.isofts.kiev.ua/handle/123456789/206608 |
| work_keys_str_mv | AT melnychukmd molecularbiologicaldiagnosticasstrategyforqualitycontrolandgeneticpurityofbeneficialinsectstrichogrammaspp AT spyrydonovvg molecularbiologicaldiagnosticasstrategyforqualitycontrolandgeneticpurityofbeneficialinsectstrichogrammaspp AT yuw molecularbiologicaldiagnosticasstrategyforqualitycontrolandgeneticpurityofbeneficialinsectstrichogrammaspp AT dallagatam molecularbiologicaldiagnosticasstrategyforqualitycontrolandgeneticpurityofbeneficialinsectstrichogrammaspp AT boychinovb molecularbiologicaldiagnosticasstrategyforqualitycontrolandgeneticpurityofbeneficialinsectstrichogrammaspp AT melnychukmd molekulârnobíologíčnadíagnostikaâkstrategíâkontrolûâkostíígenetičnoíčistotikorisnihkomahtrichogrammaspp AT spyrydonovvg molekulârnobíologíčnadíagnostikaâkstrategíâkontrolûâkostíígenetičnoíčistotikorisnihkomahtrichogrammaspp AT yuw molekulârnobíologíčnadíagnostikaâkstrategíâkontrolûâkostíígenetičnoíčistotikorisnihkomahtrichogrammaspp AT dallagatam molekulârnobíologíčnadíagnostikaâkstrategíâkontrolûâkostíígenetičnoíčistotikorisnihkomahtrichogrammaspp AT boychinovb molekulârnobíologíčnadíagnostikaâkstrategíâkontrolûâkostíígenetičnoíčistotikorisnihkomahtrichogrammaspp |