Dominant-negative constructs of human 6-phosphofructo-2-kinase/fructose-2,6-bisphosphatase-3 and -4: effect on the expression of endogenous 6-phosphofructo-2-kinase/fructose-2,6-bisphosphatase mRNA
Expression of 6-phosphofructo-2-kinase/fructose-2,6-bisphosphatase (PFKFB), a key regulatory enzyme of glycolysis, is significantly increased in different malignant tumors provides a potential mechanism of enhanced glycolysis and cancer cell proliferation. We created dominant-negative constructs of...
Збережено в:
| Опубліковано в: : | Біотехнологія |
|---|---|
| Дата: | 2008 |
| Автори: | , , , , , , , , |
| Формат: | Стаття |
| Мова: | Англійська |
| Опубліковано: |
Інститут біохімії ім. О.В. Палладіна НАН України
2008
|
| Теми: | |
| Онлайн доступ: | https://nasplib.isofts.kiev.ua/handle/123456789/28152 |
| Теги: |
Додати тег
Немає тегів, Будьте першим, хто поставить тег для цього запису!
|
| Назва журналу: | Digital Library of Periodicals of National Academy of Sciences of Ukraine |
| Цитувати: | Dominant-negative constructs of human 6-phosphofructo-2-kinase/fructose-2,6-bisphosphatase-3 and -4: effect on the expression of endogenous 6-phosphofructo-2-kinase/fructose-2,6-bisphosphatase mRNA / D.O. Minchenko, A.Y. Bobarykina, O.O. Ratushna, R.Y. Marunych, K. Tsuchihara, M. Moenner, J. Caro, H. Esumi, O.H. Minchenko // Біотехнологія. — 2008. — Т. 1, № 4. — С. 49-56. — Бібліогр.: 47 назв. — англ. |
Репозитарії
Digital Library of Periodicals of National Academy of Sciences of Ukraine| _version_ | 1860097725026009088 |
|---|---|
| author | Minchenko, D.O. Bobarykina, A.Y. Ratushna, O.O. Marunych, R.Y. Tsuchihara, K. Moenner, M. Caro, J. Esumi, H. Minchenko, O.H. |
| author_facet | Minchenko, D.O. Bobarykina, A.Y. Ratushna, O.O. Marunych, R.Y. Tsuchihara, K. Moenner, M. Caro, J. Esumi, H. Minchenko, O.H. |
| citation_txt | Dominant-negative constructs of human 6-phosphofructo-2-kinase/fructose-2,6-bisphosphatase-3 and -4: effect on the expression of endogenous 6-phosphofructo-2-kinase/fructose-2,6-bisphosphatase mRNA / D.O. Minchenko, A.Y. Bobarykina, O.O. Ratushna, R.Y. Marunych, K. Tsuchihara, M. Moenner, J. Caro, H. Esumi, O.H. Minchenko // Біотехнологія. — 2008. — Т. 1, № 4. — С. 49-56. — Бібліогр.: 47 назв. — англ. |
| collection | DSpace DC |
| container_title | Біотехнологія |
| description | Expression of 6-phosphofructo-2-kinase/fructose-2,6-bisphosphatase (PFKFB), a key regulatory enzyme of glycolysis, is significantly increased in different malignant tumors provides a potential mechanism of enhanced glycolysis and cancer cell proliferation. We created dominant-negative constructs of 6-phosphofructo-2-kinase/fructose-2,6-bisphosphatase-3 and -4 (dnPFKFB-3 and dnPFKFB-4) cDNA for suppression of strongly enhanced expression endogenous PFKFB-3 and PFKFB-4. We introduce point mutation in ATP-binding domain of 6-phosphofructo-2-kinase part of PFKFB-3 as well as PFKFB-4 cDNA for suppression of 6-phosphofructo-2-kinase activity in the products of dnPFKFB-3 and dnPFKFB-4 expression. Cancer cells were stable transfected with these dominant-negative constructs for suppression of endogenous PFKFB-3 and PFKFB-4 expression and cell proliferation. We have shown that PFKFB-3 expression in pancreatic cancer cell line Panc1, stable transfected by dnPFKFB-3, was significantly reduced in normal as well as in hypoxic conditions. Pancreatic cancer cells proliferation, stable transfected by dnPFKFB-3 or dnPFKFB-4, was also reduced. Results of this investigation demonstrate possibility to apply the dominant-negative constructs of PFKFB-3 and PFKFB-4 for suppression of glycolysis and tumor cells proliferation via reduction of endogenous PFKFB expression.
Експресія 6-фосфофрукто-2-кінази/фруктозо-2,6-бісфосфатази (PFKFB), ключового регуляторного ензиму гліколізу, різко зростає в різних злоякісних пухлинах, що розкриває можливий механізм посиленого гліколізу в ракових клітинах та їх проліферації. Ми створили домінантнегативні конструкції кДНК 6-фосфофрукто-2-кінази/фруктозо-2,6-бісфосфатази-3 та -4 (dnPFKFB-3 та dnPFKFB-4) для пригнічення посиленої експресії ендогенних PFKFB-3 та PFKFB-4. Для цього вводили точкові мутації в АТР-зв’язувальний домен 6-фосфофрукто-2-кінази як PFKFB-3, так і PFKFB-4 кДНК для пригнічення 6-фосфо-фрукто-2-кіназної активності у продуктах експресії цих конструкцій. Проводили трансфекцію ракових клітин цими домінантнегативними конструкціями для пригнічення експресії ендогенних PFKFB-3 і PFKFB-4 та проліферації клітин. Встановлено, що експресія PFKFB-3 в клітинах карциноми підшлункової залози лінії Panc1, стабільно трансфекованих dnPFKFB-3, знижується як у нормальних умовах, так і за гіпоксії. У клітинах з посиленою експресією dnPFKFB-4 спостерігали пригнічення ендогенних як PFKFB-4, так і PFKFB-3. Проліферація клітин карциноми підшлункової залози, стабільно трансфекованих як dnPFKFB-3, так і dnPFKFB-4, знижується. Результати цих досліджень показують можливість використання домінантнегативних конструкцій PFKFB-3 та PFKFB-4 для зменшення інтенсивності гліколізу та проліферації ракових клітин шляхом зниження експресії ендогенних PFKFB.
Экспрессия 6-фосфофрукто-2-киназы/фруктозо-2,6-бисфосфатазы (PFKFB), ключевого регуляторного энзима гликолиза, резко возрастает в различных злокачественных опухолях, что раскрывает возможный механизм усиленного гликолиза в раковых клетках и их пролиферации. Мы создали доминантнегативные конструкции кДНК 6-фосфофрукто-2-киназы/фруктозо-2,6-бисфосфатазы-3 и -4 (dnPFKFB-3 и dnPFKFB-4) для угнетения усиленной экспрессии эндогенных PFKFB-3 и PFKFB-4. Для этого вводили точечные мутации в АТР-связывающий домен 6-фосфофрукто-2-киназы как PFKFB-3, так и PFKFB-4 для угнетения 6-фосфофрукто-2-киназной активности в продуктах экспрессии этих конструкций. Проводили трансфекцию раковых клеток этими доминантнегативными конструкциями для угнетения экспрессии эндогенных PFKFB-3, а также пролиферации клеток. Установлено, что экспрессия PFKFB-3 в клетках карциномы поджелудочной железы линии Panc1, стабильно трансфецированных dnPFKFB-3, снижается как в нормальных условиях, так и при гипоксии. В клетках с усиленной экспрессией dnPFKFB-4 наблюдали угнетение эндогенных как PFKFB-4, так и PFKFB-3. Пролиферация клеток карциномы поджелудочной железы, стабильно трансфецированных как dnPFKFB-3, так и dnPFKFB-4, снижается. Результаты этих исследований показывают возможность использования доминантнегативных конструкций PFKFB-3 и PFKFB-4 для уменьшения интенсивности гликолиза и пролиферации раковых клеток путем снижения экспрессии эндогенных PFKFB.
|
| first_indexed | 2025-12-07T17:26:31Z |
| format | Article |
| fulltext |
49
enzyme in the regulation of glycolysis as well
as gluconeogenesis in normal and different
pathological conditions, in particular in
malignant tumors [4–10]. X�ray crystallogra�
phy shown that 6�phosphofructo�2�kinase
domain has the same fold as adenylate kinase
[11]. The fructose�2,6�bisphosphatase domain
of the enzyme subunit bears sequence, mecha�
nistic and structural similarity to the histi�
dine phosphatase family of enzymes, including
The homodimeric bifunctional enzyme 6�
phosphofructo�2�kinase/fructose�2,6�bisphos�
phatase [6�phosphofructo�2�kinase (EC
2.7.1.105); fructose�2,6�bisphosphatase (EC
3.1.3.46)] has both kinase and bisphosphatase
activities and catalyses the synthesis and
degradation of fructose�2,6�bisphosphate,
a signal molecule that control glycolysis [1–4].
Moreover, 6�phosphofructo�2�kinase/fruc�
tose�2,6�bisphosphatase (PFKFB) is a key
ЕКСПЕРИМЕНТАЛЬНІ СТАТТІ
УДК577.112:616
DOMINANT\NEGATIVE CONSTRUCTS OF HUMAN DOMINANT\NEGATIVE CONSTRUCTS OF HUMAN
6\PHOSPHOFRUCTO\2\KINASE/6\PHOSPHOFRUCTO\2\KINASE/
FRUCTOSE\2,6\BISPHOSPHATASE\3 AND \4:FRUCTOSE\2,6\BISPHOSPHATASE\3 AND \4:
EFFECT ON THE EXPRESSION EFFECT ON THE EXPRESSION
OF ENDOGENOUS 6\PHOSPHOFRUCTO\2\OF ENDOGENOUS 6\PHOSPHOFRUCTO\2\
KINASE/FRUCTOSE\2,6\BISPHOSPHATASE KINASE/FRUCTOSE\2,6\BISPHOSPHATASE mmRNA RNA
Key words: PFKFB�4 mRNA, PFKFB�3 mRNA, dominant�negative constructs, cancer cells.
D. O. Minchenko1 1Palladin Institute of Biochemistry of National Academy of Science of Ukraine, Kyiv
A. Y. Bobarykina1
O. O. Ratushna1 2Research Center for Innovative Oncology of National Cancer Center Hospital East,
R. Y. Marunych1, Kashiwa, Japan
K. Tsuchihara2
M. Moenner3 3INSERM U920 Molecular Mechanisms of Angiogenesis Laboratory, University
J. Caro4 Bordeaux 1, Talence, France
H. Esumi2
O. H. Minchenko1, 2, ∗ 4Department of Medicine, Jefferson Medical College of Thomas Jefferson
University, Philadelphia, PA, USA
∗Foreign Research Fellow of the Foundation for Promotion of Cancer Research, Tokyo
E7mail: ominchenko@yahoo.com
Expression of 6�phosphofructo�2�kinase/fructose�2,6�bisphosphatase (PFKFB), a key regulatory enzyme of gly�
colysis, is significantly increased in different malignant tumors provides a potential mechanism of enhanced glycoly�
sis and cancer cell proliferation. We created dominant�negative constructs of 6�phosphofructo�2�kinase/fructose�
2,6�bisphosphatase�3 and �4 (dnPFKFB�3 and dnPFKFB�4) cDNA for suppression of strongly enhanced expression
endogenous PFKFB�3 and PFKFB�4. We introduce point mutation in ATP�binding domain of 6�phosphofructo�2�
kinase part of PFKFB�3 as well as PFKFB�4 cDNA for suppression of 6�phosphofructo�2�kinase activity in the pro�
ducts of dnPFKFB�3 and dnPFKFB�4 expression. Cancer cells were stable transfected with these dominant�negative
constructs for suppression of endogenous PFKFB�3 and PFKFB�4 expression and cell proliferation. We have shown
that PFKFB�3 expression in pancreatic cancer cell line Panc1, stable transfected by dnPFKFB�3, was significantly
reduced in normal as well as in hypoxic conditions. Pancreatic cancer cells proliferation, stable transfected by
dnPFKFB�3 or dnPFKFB�4, was also reduced. Results of this investigation demonstrate possibility to apply the
dominant�negative constructs of PFKFB�3 and PFKFB�4 for suppression of glycolysis and tumor cells proliferation
via reduction of endogenous PFKFB expression.
БІОТЕХНОЛОГІЯ, Т. 1, №4, 2008
50
therapy. The most PFKFB isozymes are con�
tribute to de novo nucleic acid synthesis in
tumor cells, are uniformly increased in the
malignant tissues and provide a potential
mechanism to explain the apparent coupling
of enhanced glycolysis and cell proliferation
[6, 7, 17–19, 28, 29].
Previously, we have shown that the pfkfb4
gene is overexpressed in several cancer cell
lines and is highly induced by hypoxia via
HIF�1 dependent mechanism [14].
The pfkfb3 gene encoded 6�phosphofructo�
2�kinase/fructose�2,6�bisphosphatase
isozyme ubiquitously expressed in different
organs and tumor cells [8, 13–15, 17–19].
Several alternative splice variants of PFKFB�
3 mRNA with variable C�terminus were iden�
tified in human brain and different rat and
mouse tissues [30–35]. There were isolated
eight isoforms of PFKFB�3 mRNA from brain
and some other tissues. The cDNA sequences
encoding the 5′�untranslated region, the ami�
no�terminal domain, and the catalytic core do�
main were identical among all these isoforms.
However, heterogeneity of the carboxyl�ter�
minus was found by sequence analysis.
Many genes whose expression is regulated
by hypoxia are overexpressed in malignant tis�
sues and cell lines and contain HIF�1 binding
site (hypoxia�responsible element, HRE) [14,
16, 36–38]. HRE was recently identified in
pfkfb3 and pfkfb4 genes [14, 39–41].
Transcription factor HIF is central in coordi�
nating many of the transcriptional adapta�
tions to hypoxia and a necessary mediator of
the hypoxic effect as well as Pasteur effect in
mammalian cells and Warburg effect in
tumors [29, 37, 42, 43]. Thus, targeting
PFKFB enzymes, either directly or through
inhibition of HIF�1, appears as a promising
approach for the treatment of certain tumors.
Despite importance of PFKFB�3 and
PFKFB�4 in the regulation of glycolysis, the
dominant�negative constructs of 6�phospho�
fructo�2�kinase/fructose�2,6�bisphosphatase�
3 and �4 cDNA were not been created and used
yet for suppression of glycolysis. In this work
we have created dnPFKFB�3 and dnPFKFB�4
constructs and studied the expression of
endogenous PFKFB�3 and PFKFB�4 mRNA in
pancreatic cancer cells stable transfected with
these constructs.
Materials and methods
Cell lines. Human pancreatic cancer cell
lines Pank1 and PSN�1 were obtained from the
American Type Culture Collection (ATCC,
the acid phosphatases and phosphoglycerate
mutases [5, 11]. Therefore, fructose�2,6�bis�
phosphate plays a unique role in the control of
glucose homeostasis by allowing the liver to
switch from glycolysis to gluconeogenesis [4,
5, 7]. There are four 6�phosphofructo�2�
kinase/fructose�2,6�bisphosphatase isoen�
zymes (PFKFB�1, PFKFB�2, PFKFB�3 and
PFKFB�4) in mammals, each coded by a differ�
ent gene (pfkfb1, pfkfb2, pfkfb3 and pfkfb4).
Moreover, these genes express several iso�
forms of each isoenzyme with different kinet�
ic and regulatory properties [4, 5, 12, 13]. It
was shown that different tissues as well as
cancer cell lines express more than one iso�
form [13–16]. This multiple expression of
PFKFB isozymes with different properties
suggests that each isoenzyme can play a spe�
cific role in the regulation of glycolysis in
some physiologic and different pathophysio�
logical conditions.
Overexpression of PFKFB isozymes as well
as enhanced glycolysis is observed in most
malignant tumors and in different cancer cell
lines and significantly increases in hypoxic
conditions [13–19]. The metabolism within a
solid tumor is significantly different from
that of the surrounding normal tissue.
Tumors growing under conditions of normal
oxygen tension show elevated glycolytic rates,
produce high levels of lactate and pyruvate
(the Warburg effect) that correlate with the
increased expression of glycolytic enzymes
and glucose transporters via HIF�1 dependent
mechanism [1–4, 20–25]. In tumor over 50%
of the cellular energy is produced by glycolysis
with the remainder being generated at the
mitochondria. The reliance of tumor cells on
glycolysis for energy production causes them
to consume more glucose because of the low
efficiency of glycolysis in generating ATP
[23]. Thus, glycolysis is essential for tumor
survival and spread. Moreover, 6�phospho�
fructo�2�kinase/fructose�2,6�bisphosphatase
has a key role for the neoplastic transforma�
tion and provide rationale for the development
of agents that selectively inhibit the PFKFB�3
enzyme as antineoplastic agents. Moreover,
hypoxia is a common feature of many cancers
and has been linked to malignant transforma�
tion, metastasis, and treatment resistance
[23–27]. Most of tumors are subjected to
hypoxic conditions due to the abnormal vascu�
lature that supply them with oxygen and
nutrients. Transcription complex HIF�1 is
overexpressed in a variety of tumors and its
expression appears to correlate with poor
prognosis and responses to chemo� or radio�
Експериментальні статті
51
(Invitrogen, USA) vector as described previ�
ously [14] and used for creation of dominant�
negative constructs (dnPFKFB�3 and
dnPFKFB�4). These constructs were verified
by sequencing the insert in the plasmid.
Sequence analysis was performed using ABI
Prism (Model 3100, version 3.7). The
dnPFKFB�3 and dnPFKFB�4 cDNA were
recloned into pcDNA3.1 (Invitrogen, USA)
and used for transfection assays.
The expression of PFKFB�3 mRNA in
Panc1 cells was examined by ribonuclease pro�
tection assays as described previously [15,
46], but probes corresponds to 3′�region
(3193–3540; GenBank accession number
NM_004566). The 18S rRNA antisense probe
was used to ensure equal loading of the sample
of total RNA. The expression of PFKFB�3 and
PFKFB�4 mRNA in Pst�1 cells was examined
by real time RCR analysis assays. Quanti�
tative PCR was performed on «Stratagene Mx
3000P cycler», using SYBRGreen Mix as
described previously [47]. Reaction was per�
formed in triplicate. Analysis of quantitative
PCR was performed using special computer
program «Differential expression calculator»
and statistic analysis — in Excel program.
Results and Discussion
We synthesized the human PFKFB�3 and
PFKFB�4 cDNA using total RNA from human
pancreatic cancer cell line Panc1. Both cDNA
were amplified and cloned into pCRII�TOPO
vector. For inactivation of 6�phosphofructo�2�
kinase we changed four nucleotide residues in
domain «A» using special primers. As shown
in Fig. 1 and 2, this nucleotide replacement in
USA) and grown according to the supplier’s
protocols. The cells were incubated at 37 0C
before harvesting under normoxic (21% oxy�
gen and 5% carbon dioxide) or hypoxic condi�
tions, which were modulated by dimethyloxa�
lylglycine (1 mM during 6 hours) [15].
RNA isolation. Total RNA was extracted
using Trizol reagent according to the manu�
facturer’s protocols (Invitrogen, USA). RNA
pellet was washed with 75% ethanol, dis�
solved in nuclease�free water and used for
reverse transcription.
Synthesis and cloning of PFKFB\3 and
PFKFB\4 cDNA. The human PFKFB�3 and
PFKFB�4 cDNA was synthesized by RT�PCR
using total RNA from human pancreatic can�
cer cell lines Pank1 and oligo(dT). For first�
strand cDNA synthesis was used Sensiscript
RT Kit (QIAGEN, Germany). Human PFKFB�
3 PCR amplification was performed with the
following oligonucleotides: 5′�GATGCCGTTG�
GAACTGACGC�3′ (forward primer) and 3′�
CTGAGGCAGACGTGTCGGTT�5′ (reverse
primer) using HotStarTaq Master Mix Kit
(QIAGEN). These oligonucleotides correspond to
nucleotide sequences 329–348 and 1889–1908
of human PFKFB�3 mRNA (GenBank acces�
sion number NM_004566). The amplification
of human PFKFB�4 was performed with the
following oligonucleotides: 5′�GATGGCGTCC�
CCACGGGAATTG �3′ (forward primer) and
3′�GCTCACCAGTGACCATGTTC�5′ (reverse
primer) using HotStarTaq Master Mix Kit
(QIAGEN). These oligonucleotides correspond
to nucleotide sequences 17–38 and 1416–11435
of human PFKFB�3 mRNA (GenBank acces�
sion number NM_004566). The PFKFB�3 and
PFKFB�4 cDNA were cloned into pCRII�TOPO
Fig. 1. Fragment of 6\phosphofructo\2\kinase part of human PFKFB\3 cDNA (GenBank accession number
NM_004566), containing domain «A» (underlined). Four nucleotide residues (GGCA) into domain «A» were
replaced by CTGC. These changes create new restriction site (PstI) and replace two amino acids residues: G and K
Fig. 2. Fragment of 6\phosphofructo\2\kinase part of human PFKFB\4 cDNA (GenBank accession number
NM_004567), containing domain «A» (underlined). Four nucleotide residues (GGCA) into domain «A» were
replaced by CTGC. These changes create new restriction site (PstI) and replace two amino acids residues: G and K
БІОТЕХНОЛОГІЯ, Т. 1, №4, 2008
52
PFKFB�3 and PFKFB�4 mRNA expression
was also measured in other pancreatic carcino�
ma cell line PSN�1 stable transfected by
pcDNA3.1(+) vector, dnPFKFB�3 or
dnPFKFB�4. Results of these experiments are
shown on Fig. 6. PSN�1 cells transfected with
dnPFKFB�3 shown lower level of endogenous
PFKFB�3 mRNA expression. Moreover, the
expression of PFKFB�4 mRNA in these cells
also decreased. It is possible that there is some
interaction between different PFKFB genes in
molecular mechanisms of PFKFB suppression
by dominant�negative constructs. Same effect
has dnPFKFB�4 on the of endogenous PFKFB�
4 and PFKFB�3 mRNA.
PFKFB�3 and PFKFB�4 creates new restric�
tion site (PstI) and changes two amino acids
residues: G to L and K to Q. These changes
should suppress the 6�phosphofructo�2�kinase
activity because K residue is crucial for keep�
ing kinase activity. These modified PFKFB�3
and PFKFB�4 cDNA represent dominant�neg�
ative variants in respect to 6�phosphofructo�
2�kinase activity.
We recloned modified human PFKFB�3
and PFKFB�4 cDNA into eukaryotic expres�
sion vector pcDNA3.1(+) using EcoRI and
XbaI restriction nuclease sites. Structure of
dominant�negative construct of PFKFB�3
(dnPFKFB�3) shown on Fig. 3. Same structure
has dnPFKFB�4. Both dominant�negative con�
structs were used for transfection experi�
ments. We received clone of Panc1 cells stable
transfected by dnPFKFB�3.
The effect of PFKFB�3 dominant�negative
construct on the expression of endogenous
PFKFB�3 mRNA is shown in Fig. 4. For this
analysis was used 3′�terminus of PFKFB�3
mRNA because dnPFKFB�3 construct does not
contains this region of PFKFB�3. Pancreatic
cancer cells, stable transfected by dnPFKFB�
3, have significantly lower expression of
endogenous PFKFB�3 mRNA as in normoxic
and hypoxic conditions, which were modulat�
ed by dimethyloxalylglycine (Fig. 4 and 5).
Fig. 3. Dominant\negative plasmid construction of
human PFKFB\3 cDNA, which contains PFKFB\3
cDNA with modified 6\phosphofructo\2\kinase
domain «A» into pcDNA3.1(+) vector
Fig. 4. Endogenous PFKFB\3 mRNA expression in
pancreatic carcinoma cell line Panc1 stable trans\
fected by pcDNA3.1(+) vector (Panc1 cells) and stable
transfected by dnPFKFB\3 (Panc1 + dnPFKFB\3) in
normoxic (N) and hypoxic conditions (I), which were
modulated by dimethyloxalylglycine (1 mM during
6 hours). The 18S rRNA antisense probe was used to
ensure equal loading of the sample of total RNA
Fig. 5. Quantification of endogenous PFKFB\3
mRNA expression in pancreatic carcinoma cell line
Panc1 stable transfected by pcDNA3.1(+) vector or
dnPFKFB\3 in normoxic (N) and hypoxic (I) condi\
tions; n = 5
Експериментальні статті
53
9. Bando H., Atsumi T., Nishio T. et al.
Phosphorylation of the 6�phosphofructo�2�
kinase/fructose 2,6�bisphosphatase/
PFKFB3 family of glycolytic regulators in
human cancer // Clin. Cancer Res. 2005. —
V. 11, N16 — P. 5784–5792.
10. Calvo M. N., Bartrons R., Castano E. et al.
PFKFB3 gene silencing decreases glycolysis,
induces cell�cycle delay and inhibits anchor�
age�independent growth in HeLa cells //
FEBS Lett. — 2006. — V. 580, N13. —
Р. 3308–3314.
11. Bertrand L., Vertommen D., Depiereux E. et
al. Modelling the 2�kinase domain of 6�phos�
phofructo�2�kinase/fructose�2,6�bisphos�
phatase on adenylate kinase // Biochem. J. —
1997. — V. 321, Pt. 3. — P. 615–621.
12. Sakakibara R., Okudaira T., Fujiwara K. et al.
Tissue distribution of placenta�type 6�phos�
phofructo� 2�kinase/fructose�2,6�bisphos�
phatase // Biochem. Biophys. Res. Commun. —
1999. — V. 257, N1. — P. 177–181.
13. Minchenko O., Opentanova I., Caro J.
Hypoxic regulation of the 6�phosphofructo�
2�kinase/fructose�2,6�bisphosphatase�3 gene
family (PFKFB�1�4) expression in vivo //
FEBS Lett. — 2003. — V. 554, N3. —
P. 264–270.
14. Minchenko O. H., Opentanova I. L., Minchen7
ko D. O. et al. Hypoxia induces transcription
of 6�phosphofructo�2�kinase/fructose�2,6�
bisphosphatase 4 gene via hypoxia�inducible
factor�1alpha activation // Ibid. — 2004. —
V. 576, N1. — P. 14–20.
15. Minchenko A. G., Leshchinsky I., Opentanova I.
et al. Hypoxia�inducible factor�1�mediated
expression of the 6�phosphofructo�2�
kinase/fructose�2,6�bisphosphatase�3
(PFKFB3) gene // J. Biol. Chem. — 2002. —
V. 277, N8. — P. 6183–6187.
16. Mykhalchenko V. G., Kovtun O. O., Bobaryki7
na A. Y., Minchenko O. H. Molecular mecha�
nisms of the regulation of the 6�phospho�
fructo�2�kinase/fructose�2,6�bisphosphatase
genes expression in hypoxia // Bulletin
Taras Shevchenko Kyiv National Univer�
sity. — 2006. — Issue 11. — P. 18–24.
17. Minchenko O. H., Ogura T., Opentanova I. L.
et al. 6�Phosphofructo�2�kinase/fructose�
2,6�bisphosphatase gene family overexpres�
sion in the lung tumor // Укр. біохім.
журн. — 2005. — Т. 77, №6. — С. 46–50.
18. Bobarykina A. Y., Minchenko D. O., Openta7
nova I. L. et al. Hypoxic regulation of
PFKFB�3 and PFKFB�4 gene expression in
gastric and pancreatic cancer cell lines and
expression of PFKFB genes in gastric can�
cers // Acta Biochim. Pol. — 2006. — V. 53,
N4. — Р. 789–799.
19. Minchenko O. H., Ochiai A., Opentanova I. L.
et al. Overexpression of 6�phosphofructo�2�
1. Okar D. A., Lange A. J. Fructose�2,6�bisphos�
phate and control of carbohydrate metabo�
lism in eukaryotes // Biofactors. — 1999. —
V. 10, N1. — P. 1–14.
2. Kawaguchi T., Veech R. L., Uyeda K.
Regulation of energy metabolism in
macrophages during hypoxia. Roles of fruc�
tose 2,6�bisphosphate and ribose 1,5�bispho�
sphate // J. Biol. Chem. — 2001. — V. 276,
N30. — P. 28554 — 28561.
3. Rousseau G. G., Hue L. Mammalian 6�phos�
phofructo�2�kinase/fructose�2,6�bisphos�
phatase: a bifunctional enzyme that control
glycolysis // Prog. Nucleic Acid Res. Mol.
Biol. — 1993. — V. 45. — P. 99 — 127.
4. Okar D. A., Manzano A., Navarro7Sabate A. et
al. PFK�2/FBPase�2: maker and breaker of
the essential biofactor fructose�2,6�bisphos�
phate // Trends Biochem. Sci. — 2001. —
V. 26, N1. — P. 30 — 35.
5. Rider M. H., Bertrand L., Vertommen D. et al.
6�phosphofructo�2�kinase/fructose�2,6�bis�
phosphatase: head�head with a bifunctional
enzyme that controls glycolysis // Biochem.
J. — 2004. — V. 381, Pt. 3. — P. 561–579.
6. Atsumi T., Chesney J., Metz C. et al. High
expression of inducible 6�phosphofructo�2�
kinase/fructose�2,6�bisphosphatase�3
(iPFK�2; PFKFB3) in human cancers // Cancer
Res. — 2002. — V. 62, N20. — P. 5881–5887.
7. Atsumi T., Nishio T., Niwa H. et al. Expression
of inducible 6�phosphofructo�2�kinase/fruc�
tose�2,6�bisphosphatase/PFKFB3 isoforms
in adipocytes and their potential role in gly�
colytic regulation // Diabetes. — 2005. —
V. 54, N12. — P. 3349–3357.
8. Chesney J. 6�phosphofructo�2�kinase/fruc�
tose�2,6�bisphosphatase and tumor cell gly�
colysis // Curr. Opin. Clin. Nutr. Metab.
Care. — 2006. — V. 9, N5. — P. 535–539.
Fig. 6. Endogenous PFKFB\3 and PFKFB\4
mRNA expression in pancreatic carcinoma cell line
PSN\1 stable transfected with pcDNA3.1(+) vector,
dnPFKFB\3 and dnPFKFB\4
LITERATURE
БІОТЕХНОЛОГІЯ, Т. 1, №4, 2008
54
phosphate 2�kinase/fructose 2,6�bisphos�
phatase // FEBS Lett. — 1999. — V. 458,
N1. — P. 304–308.
33. Mykhalchenko V. G., Minchenko D. O.,
Tsuchihara K. et al. Expression of mouse 6�
phosphofructo�2�kinase/fructose�2,6�bis�
phosphatase�3 mRNA alternative splice
variants in hypoxia // Укр. біохім. журн. —
2008. — Т. 80, №1. — С. 19–25.
34. Minchenko D. O., Tsuchihara K., Komisa7
renko S. V. et al. Unique alternative splice
variants of mouse PFKFB�3 mRNA: tissue
specific expression // Scientific Bulletin
National O.O. Bohomoletz Medical
University. — 2008. — №1. — P. 72–78.
35. Minchenko O. H., Opentanova I. L., Ochiai A.
et al. Splice isoform of 6�phosphofructo�2�
kinase/ fructose�2,6�bisphosphatase�4: ex�
pression and hypoxic regulation. Mol. &
Cell. Biochem. — 2005. — V. 280, N1–2. —
P. 227–234.
36. Wykoff C. C., Pugh C. W., Maxwell P. H. et al.
The HIF pathway: implications for patterns
of gene expression in cancer // Novartis Found
Symp. — 2001. — V. 240. — P. 212–225.
37. Wenger R. H. Cellular adaptation to hypoxia:
O2�sensing protein hydroxylases, hypoxia�
inducible transcription factors, and O2�regu�
lated gene expression // FASEB J. — 2002. —
V. 16, N10. — P. 1151–1162.
38. Minchenko A. G., Caro J.: Regulation of
endothelin�1 gene expression in human
microvascular endothelial cells by hypoxia
and cobalt: role of hypoxia responsible ele�
ment // Mol. & Cell. Biochem. — 2000. —
V. 208. — P. 53–62.
39. Minchenko O. H., Opentanova I. L., Ogura T.
et al. Expression and hypoxia�responsiveness
of the 6�phosphofructo�2�kinase/fructose�
2,6�bisphosphatase 4 in the mammary gland
malignant cell lines // Acta Biochim. Pol. —
2005. — V. 52, N4. — P. 881–888.
40. Fukasawa M., Tsuchiya T., Takayama E. et
al. Identification and characterization of the
hypoxia�responsive element of the human
placental 6�phosphofructo�2�kinase/fructose�
2,6�bisphosphatase gene // J. Biochem. —
2004. — V. 136, N3. — P. 273–277.
41. Obach M., Navarro7Sabate A., Caro J. et al. 6�
Phosphofructo�2�kinase (pfkfb3) gene pro�
moter contains hypoxia�inducible factor�1
binding sites necessary for transactivation
in response to hypoxia // J. Biol. Chem. —
2004. — V. 279, N51. — P. 53562–53570.
42. Walenta S., Salameh A., Lyng H. et al.
Correlation of high lactate levels in head and
neck tumors with incidence of metastasis //
Am. J. Pathol. — 1997. — V. 150, N3. —
P. 409–415.
43. Chen J., Zhao S., Nakada K. et al. Dominant�
negative hypoxia�inducible factor�1 alpha
kinase/fructose�2,6�bisphosphatase�4 in the
human breast and colon malignant tumors //
Biochimie. — 2005. — V. 87, N11. —
P. 1005–1010.
20. Warburg O. On respiratory impairment in
cancer cells // Science. — 1956. — V. 123,
N3191. — P. 309–314.
21. Hopfl G., Ogunshola O., Gassmann M. HIFs
and tumors — causes and consequences //
Am. J. Physiol. — 2004. — V. 286, N4. —
P. R608–R623.
22. Chesney J., Mitchell R., Benigni F. et al. An
inducible gene product for 6�phosphofructo�
2�kinase with an AU�rich instability ele�
ment: Role in tumor cell glycolysis and the
Warburg effect // Proc. Natl. Acad. Sci.
USA. — 1999. — V. 96, N6. — P. 3047–3052.
23. Denko N. C. Hypoxia, HIF1 and glucose
metabolism in the solid tumor // Nat. Rev.
Cancer. — 2008. — V. 8. — P. 705–713.
24. Hockel M., Vaupel P. Tumor hypoxia: defini�
tions and current clinical, biologic, and mol�
ecular aspects // J. Natl. Cancer Inst. —
2001. — V. 93, N4. — P. 266–276.
25. Lu H., Forbes R. A., Verma A. Hypoxia�
inducible factor 1 activation by aerobic gly�
colysis implicates the Warburg effect in car�
cinogenesis // J. Biol. Chem. — 2002. —
V. 277, N26. — P. 23111–23115.
26. Bartrons R., Caro J. Hypoxia, glucose meta�
bolism and the Warburg’s effect // J. Bio�
energ. Biomembr. — 2007. — V. 39, N3. —
P. 223–229.
27. Airley R. E., Mobasheri A. Hypoxic regula�
tion of glucose transport, anaerobic metabo�
lism and angiogenesis in cancer: novel path�
ways and targets for anticancer therapeutics
// Chemotherapy. — 2007. — V. 53, N4. —
P. 233–256.
28. Бобарикіна А. Ю., Мінченко Д. О., Опента7
нова І. Л. та ін. Експресія мРНК HIF�1α,
HIF�2α та VHL у різних лініях клітин при
гіпоксії // Укр. біохім. журн. — 2006. —
Т. 78, №2. — С. 49–59.
29. Hirata T., Watanabe M., Miura S. et al.
Inhibition of tumor cell growth by a specific
6�phosphofructo�2�kinase inhibitor, N�bro�
moacetylethanolamine phosphate, and its
analogues // Biosci. Biotechnol. Biochem. —
2000. — V. 64, N10. — P. 2047–2052.
30. Kessler R., Eschrich K. Splice isoforms of
ubiquitous 6�phosphofructo�2�kinase/fruc�
tose�2,6�bisphosphatase in human brain // Mol.
Brain Res. — 2001. — V. 87, N2. — P. 190–195.
31. Watanabe F., Sakai A., Furuya E. Novel iso�
forms of rat brain fructose 2�phospho 2�
kinase/fructose 2,6�bisphosphatase are gen�
erated by tissue�specific alternative splicing
// J. Neurochem. — 1997. — V. 69, N1. — P. 1–9.
32. Watanabe F., Furuya E. Tissue�specific
alternative splicing of rat brain fructose 6�
ДОМІНАНТНЕГАТИВНІ КОНСТРУКЦІЇ 6\
ФОСФОФРУКТО\2\КІНАЗИ/ФРУКТОЗО\
2,6\БІСФОСФАТАЗИ\3 ТА \4 ЛЮДИНИ:
ВПЛИВ НА ЕКСПРЕСІЮ
ЕНДОГЕННИХ мРНК 6\ФОСФОФРУКТО\
2\КІНАЗИ/
ФРУКТОЗО\2,6\БІСФОСФАТАЗ
Д. О. Мінченко1
А. Ю. Бобарикіна1
О. О. Ратушна1
Р. Ю. Марунич1
K. Tсучігарa2
М. Моне3
Х. Каро4
Г. Eсумі2
О. Г. Мінченко 1, 2
1Інститут біохімії ім. О.В. Палладіна
НАН України, Київ
2Науково�дослідний центр інноваційної
онкології Східного госпіталю
Національного онкологічного центру Японії,
Kaшівa, Японія
3INSERM U920 Лабораторія молекулярних
механізмів ангіогенезу Університету Бордо 1,
Таленс, Франція
4Відділ медицини Джеферсон медичного
коледжу Томас Джеферсон Університету,
Філадельфія, США
E7mail: ominchenko@yahoo.com
Експресія 6�фосфофрукто�2�кінази/фрук�
тозо�2,6�бісфосфатази (PFKFB), ключового ре�
гуляторного ензиму гліколізу, різко зростає
в різних злоякісних пухлинах, що розкриває
можливий механізм посиленого гліколізу
в ракових клітинах та їх проліферації. Ми
створили домінантнегативні конструкції
кДНК 6�фосфофрукто�2�кінази/фруктозо�2,6�
бісфосфатази�3 та �4 (dnPFKFB�3 та dnPFKFB�4)
для пригнічення посиленої експресії ендоген�
них PFKFB�3 та PFKFB�4. Для цього вводили
точкові мутації в АТР�зв’язувальний домен
6�фосфофрукто�2�кінази як PFKFB�3, так
і PFKFB�4 кДНК для пригнічення 6�фосфо�
фрукто�2�кіназної активності у продуктах
експресії цих конструкцій. Проводили транс�
фекцію ракових клітин цими домінантнега�
тивними конструкціями для пригнічення
експресії ендогенних PFKFB�3 і PFKFB�4 та
проліферації клітин. Встановлено, що
експресія PFKFB�3 в клітинах карциноми
підшлункової залози лінії Panc1, стабільно
трансфекованих dnPFKFB�3, знижується як
у нормальних умовах, так і за гіпоксії.
У клітинах з посиленою експресією dnPFKFB�
4 спостерігали пригнічення ендогенних як
PFKFB�4, так і PFKFB�3. Проліферація клі�
тин карциноми підшлункової залози, стабіль�
но трансфекованих як dnPFKFB�3, так
і dnPFKFB�4, знижується. Результати цих
досліджень показують можливість викорис�
тання домінантнегативних конструкцій
PFKFB�3 та PFKFB�4 для зменшення інтен�
сивності гліколізу та проліферації ракових
клітин шляхом зниження експресії ендоген�
них PFKFB.
Ключові слова: PFKFB�4 мРНК, PFKFB�3 мРНК,
домінантнегативні конструкції, ра�
кові клітини.
Експериментальні статті
55
46. Minchenko O. H., Opentanova I. L., Ochiai A.
et al. Splice isoform of 6�phosphofructo�2�
kinase/ fructose�2,6�bisphosphatase�4:
expression and hypoxic regulation // Mol. &
Cell. Biochem. — 2005. — V. 280. — N1–2. —
P. 227–234.
47. Mykhalchenko V. G., Tsuchihara K., Minchen7
ko D. O. et al. 6�Phosphofructo�2�kinase/
fructose�2,6�bisphosphatase mRNA expres�
sion in streptozotocin�diabetic rats //
Biopolymers & Cell. — 2008. — V. 24, N3. —
P. 260–266.
reduces tumorigenicity of pancreatic cancer
cells through the suppression of glucose
metabolism // Am. J. Pathol. — 2003. —
V. 162, N4. — P. 1283–1291.
44. Ryan H. E., Poloni M., McNulty W. et al.
Hypoxia�inducible factor�1 is a positive fac�
tor in solid tumor growth // Cancer Res. —
2000. — V. 60, N15. — P. 4010–4015.
45. Minchenko O. H., Ogura T., Opentanova I. L.
et al. 6�Phosphofructo�2�kinase/fructose�
2,6�bisphosphatase gene family overexpres�
sion in the lung tumor // Укр. біохім.
журн. — 2005. — Т. 77, №6. — С. 46–50.
БІОТЕХНОЛОГІЯ, Т. 1, №4, 2008
56
и PFKFB�4. Для этого вводили точечные мута�
ции в АТР�связывающий домен 6�фосфофрук�
то�2�киназы как PFKFB�3, так и PFKFB�4 для
угнетения 6�фосфофрукто�2�киназной актив�
ности в продуктах экспрессии этих конструк�
ций. Проводили трансфекцию раковых клеток
этими доминантнегативными конструкциями
для угнетения экспрессии эндогенных PFKFB�
3, а также пролиферации клеток. Установле�
но, что экспрессия PFKFB�3 в клетках карци�
номы поджелудочной железы линии Panc1,
стабильно трансфецированных dnPFKFB�3,
снижается как в нормальных условиях, так и
при гипоксии. В клетках с усиленной экспрес�
сией dnPFKFB�4 наблюдали угнетение эндо�
генных как PFKFB�4, так и PFKFB�3. Проли�
ферация клеток карциномы поджелудочной
железы, стабильно трансфецированных как
dnPFKFB�3, так и dnPFKFB�4, снижается. Ре�
зультаты этих исследований показывают воз�
можность использования доминантнегатив�
ных конструкций PFKFB�3 и PFKFB�4 для
уменьшения интенсивности гликолиза и про�
лиферации раковых клеток путем снижения
экспрессии эндогенных PFKFB.
Ключевые слова: PFKFB�3 и PFKFB�4 мРНК, до�
минант�негативные конструкции,
раковые клетки.
ДОМИНАНТНЕГАТИВНЫЕ
КОНСТРУКЦИИ 6\ФОСФОФРУКТО\2\
КИНАЗЫ/ФРУКТОЗО\2,6\БИСФОСФАТАЗЫ\3
И \4 ЧЕЛОВЕКА:
ВЛИЯНИЕ НА ЭКСПРЕССИЮ
ЭНДОГЕННЫХ мРНК 6\ФОСФОФРУКТО\2\
КИНАЗЫ/ФРУКТОЗО\2,6\БИСФОСФАТАЗ
Д. А. Минченко1
А. Ю. Бобарыкина1
О. А. Ратушна1
Р. Ю. Марунич1
K. Tсучигарa2
М. Моне3
Х. Каро4
Г. Eсуми2
А. Г. Минченко1, 2
1Институт биохимии им. А. В. Палладина
НАН Украины, Kиев
2Научно�исследовательский центр инноваци�
онной онкологии Восточного госпиталя
Национального онкологического центра Япо�
нии, Kaшивa, Япония
3INSERM U920 Лаборатория молекулярных ме�
ханизмов ангиогенеза Университета Бордо 1,
Таленс, Франция
4Отдел медицины Джефферсон медицинского
колледжа Томас Джефферсон Университета,
Филадельфия, США
E7mail: ominchenko@yahoo.com
Экспрессия 6�фосфофрукто�2�киназы/
фруктозо�2,6�бисфосфатазы (PFKFB), ключе�
вого регуляторного энзима гликолиза, резко
возрастает в различных злокачественных опу�
холях, что раскрывает возможный механизм
усиленного гликолиза в раковых клетках и их
пролиферации. Мы создали доминантнегатив�
ные конструкции кДНК 6�фосфофрукто�2�
киназы/фруктозо�2,6�бисфосфатазы�3 и �4
(dnPFKFB�3 и dnPFKFB�4) для угнетения уси�
ленной экспрессии эндогенных PFKFB�3
|
| id | nasplib_isofts_kiev_ua-123456789-28152 |
| institution | Digital Library of Periodicals of National Academy of Sciences of Ukraine |
| issn | 1995-5537 |
| language | English |
| last_indexed | 2025-12-07T17:26:31Z |
| publishDate | 2008 |
| publisher | Інститут біохімії ім. О.В. Палладіна НАН України |
| record_format | dspace |
| spelling | Minchenko, D.O. Bobarykina, A.Y. Ratushna, O.O. Marunych, R.Y. Tsuchihara, K. Moenner, M. Caro, J. Esumi, H. Minchenko, O.H. 2011-10-29T22:07:00Z 2011-10-29T22:07:00Z 2008 Dominant-negative constructs of human 6-phosphofructo-2-kinase/fructose-2,6-bisphosphatase-3 and -4: effect on the expression of endogenous 6-phosphofructo-2-kinase/fructose-2,6-bisphosphatase mRNA / D.O. Minchenko, A.Y. Bobarykina, O.O. Ratushna, R.Y. Marunych, K. Tsuchihara, M. Moenner, J. Caro, H. Esumi, O.H. Minchenko // Біотехнологія. — 2008. — Т. 1, № 4. — С. 49-56. — Бібліогр.: 47 назв. — англ. 1995-5537 https://nasplib.isofts.kiev.ua/handle/123456789/28152 577.112:616 Expression of 6-phosphofructo-2-kinase/fructose-2,6-bisphosphatase (PFKFB), a key regulatory enzyme of glycolysis, is significantly increased in different malignant tumors provides a potential mechanism of enhanced glycolysis and cancer cell proliferation. We created dominant-negative constructs of 6-phosphofructo-2-kinase/fructose-2,6-bisphosphatase-3 and -4 (dnPFKFB-3 and dnPFKFB-4) cDNA for suppression of strongly enhanced expression endogenous PFKFB-3 and PFKFB-4. We introduce point mutation in ATP-binding domain of 6-phosphofructo-2-kinase part of PFKFB-3 as well as PFKFB-4 cDNA for suppression of 6-phosphofructo-2-kinase activity in the products of dnPFKFB-3 and dnPFKFB-4 expression. Cancer cells were stable transfected with these dominant-negative constructs for suppression of endogenous PFKFB-3 and PFKFB-4 expression and cell proliferation. We have shown that PFKFB-3 expression in pancreatic cancer cell line Panc1, stable transfected by dnPFKFB-3, was significantly reduced in normal as well as in hypoxic conditions. Pancreatic cancer cells proliferation, stable transfected by dnPFKFB-3 or dnPFKFB-4, was also reduced. Results of this investigation demonstrate possibility to apply the dominant-negative constructs of PFKFB-3 and PFKFB-4 for suppression of glycolysis and tumor cells proliferation via reduction of endogenous PFKFB expression. Експресія 6-фосфофрукто-2-кінази/фруктозо-2,6-бісфосфатази (PFKFB), ключового регуляторного ензиму гліколізу, різко зростає в різних злоякісних пухлинах, що розкриває можливий механізм посиленого гліколізу в ракових клітинах та їх проліферації. Ми створили домінантнегативні конструкції кДНК 6-фосфофрукто-2-кінази/фруктозо-2,6-бісфосфатази-3 та -4 (dnPFKFB-3 та dnPFKFB-4) для пригнічення посиленої експресії ендогенних PFKFB-3 та PFKFB-4. Для цього вводили точкові мутації в АТР-зв’язувальний домен 6-фосфофрукто-2-кінази як PFKFB-3, так і PFKFB-4 кДНК для пригнічення 6-фосфо-фрукто-2-кіназної активності у продуктах експресії цих конструкцій. Проводили трансфекцію ракових клітин цими домінантнегативними конструкціями для пригнічення експресії ендогенних PFKFB-3 і PFKFB-4 та проліферації клітин. Встановлено, що експресія PFKFB-3 в клітинах карциноми підшлункової залози лінії Panc1, стабільно трансфекованих dnPFKFB-3, знижується як у нормальних умовах, так і за гіпоксії. У клітинах з посиленою експресією dnPFKFB-4 спостерігали пригнічення ендогенних як PFKFB-4, так і PFKFB-3. Проліферація клітин карциноми підшлункової залози, стабільно трансфекованих як dnPFKFB-3, так і dnPFKFB-4, знижується. Результати цих досліджень показують можливість використання домінантнегативних конструкцій PFKFB-3 та PFKFB-4 для зменшення інтенсивності гліколізу та проліферації ракових клітин шляхом зниження експресії ендогенних PFKFB. Экспрессия 6-фосфофрукто-2-киназы/фруктозо-2,6-бисфосфатазы (PFKFB), ключевого регуляторного энзима гликолиза, резко возрастает в различных злокачественных опухолях, что раскрывает возможный механизм усиленного гликолиза в раковых клетках и их пролиферации. Мы создали доминантнегативные конструкции кДНК 6-фосфофрукто-2-киназы/фруктозо-2,6-бисфосфатазы-3 и -4 (dnPFKFB-3 и dnPFKFB-4) для угнетения усиленной экспрессии эндогенных PFKFB-3 и PFKFB-4. Для этого вводили точечные мутации в АТР-связывающий домен 6-фосфофрукто-2-киназы как PFKFB-3, так и PFKFB-4 для угнетения 6-фосфофрукто-2-киназной активности в продуктах экспрессии этих конструкций. Проводили трансфекцию раковых клеток этими доминантнегативными конструкциями для угнетения экспрессии эндогенных PFKFB-3, а также пролиферации клеток. Установлено, что экспрессия PFKFB-3 в клетках карциномы поджелудочной железы линии Panc1, стабильно трансфецированных dnPFKFB-3, снижается как в нормальных условиях, так и при гипоксии. В клетках с усиленной экспрессией dnPFKFB-4 наблюдали угнетение эндогенных как PFKFB-4, так и PFKFB-3. Пролиферация клеток карциномы поджелудочной железы, стабильно трансфецированных как dnPFKFB-3, так и dnPFKFB-4, снижается. Результаты этих исследований показывают возможность использования доминантнегативных конструкций PFKFB-3 и PFKFB-4 для уменьшения интенсивности гликолиза и пролиферации раковых клеток путем снижения экспрессии эндогенных PFKFB. en Інститут біохімії ім. О.В. Палладіна НАН України Біотехнологія Експериментальні статті Dominant-negative constructs of human 6-phosphofructo-2-kinase/fructose-2,6-bisphosphatase-3 and -4: effect on the expression of endogenous 6-phosphofructo-2-kinase/fructose-2,6-bisphosphatase mRNA Домінант-негативні конструкції 6-фосфофрукто-2-кінази/фруктозо-2,6-бісфосфатази-3 та -4 людини: вплив на експресію ендогенних мРНК 6-фосфофрукто-2-кінази/фруктозо-2,6-бісфосфатаз Доминант-негативные конструкции 6-фосфофрукто-2-киназы/фруктозо-2,6-бисфосфатазы-3 и -4 человека: влияние на экспрессию эндогенных мРНК 6-фосфофрукто-2-киназы/фруктозо-2,6-бисфосфатаз Article published earlier |
| spellingShingle | Dominant-negative constructs of human 6-phosphofructo-2-kinase/fructose-2,6-bisphosphatase-3 and -4: effect on the expression of endogenous 6-phosphofructo-2-kinase/fructose-2,6-bisphosphatase mRNA Minchenko, D.O. Bobarykina, A.Y. Ratushna, O.O. Marunych, R.Y. Tsuchihara, K. Moenner, M. Caro, J. Esumi, H. Minchenko, O.H. Експериментальні статті |
| title | Dominant-negative constructs of human 6-phosphofructo-2-kinase/fructose-2,6-bisphosphatase-3 and -4: effect on the expression of endogenous 6-phosphofructo-2-kinase/fructose-2,6-bisphosphatase mRNA |
| title_alt | Домінант-негативні конструкції 6-фосфофрукто-2-кінази/фруктозо-2,6-бісфосфатази-3 та -4 людини: вплив на експресію ендогенних мРНК 6-фосфофрукто-2-кінази/фруктозо-2,6-бісфосфатаз Доминант-негативные конструкции 6-фосфофрукто-2-киназы/фруктозо-2,6-бисфосфатазы-3 и -4 человека: влияние на экспрессию эндогенных мРНК 6-фосфофрукто-2-киназы/фруктозо-2,6-бисфосфатаз |
| title_full | Dominant-negative constructs of human 6-phosphofructo-2-kinase/fructose-2,6-bisphosphatase-3 and -4: effect on the expression of endogenous 6-phosphofructo-2-kinase/fructose-2,6-bisphosphatase mRNA |
| title_fullStr | Dominant-negative constructs of human 6-phosphofructo-2-kinase/fructose-2,6-bisphosphatase-3 and -4: effect on the expression of endogenous 6-phosphofructo-2-kinase/fructose-2,6-bisphosphatase mRNA |
| title_full_unstemmed | Dominant-negative constructs of human 6-phosphofructo-2-kinase/fructose-2,6-bisphosphatase-3 and -4: effect on the expression of endogenous 6-phosphofructo-2-kinase/fructose-2,6-bisphosphatase mRNA |
| title_short | Dominant-negative constructs of human 6-phosphofructo-2-kinase/fructose-2,6-bisphosphatase-3 and -4: effect on the expression of endogenous 6-phosphofructo-2-kinase/fructose-2,6-bisphosphatase mRNA |
| title_sort | dominant-negative constructs of human 6-phosphofructo-2-kinase/fructose-2,6-bisphosphatase-3 and -4: effect on the expression of endogenous 6-phosphofructo-2-kinase/fructose-2,6-bisphosphatase mrna |
| topic | Експериментальні статті |
| topic_facet | Експериментальні статті |
| url | https://nasplib.isofts.kiev.ua/handle/123456789/28152 |
| work_keys_str_mv | AT minchenkodo dominantnegativeconstructsofhuman6phosphofructo2kinasefructose26bisphosphatase3and4effectontheexpressionofendogenous6phosphofructo2kinasefructose26bisphosphatasemrna AT bobarykinaay dominantnegativeconstructsofhuman6phosphofructo2kinasefructose26bisphosphatase3and4effectontheexpressionofendogenous6phosphofructo2kinasefructose26bisphosphatasemrna AT ratushnaoo dominantnegativeconstructsofhuman6phosphofructo2kinasefructose26bisphosphatase3and4effectontheexpressionofendogenous6phosphofructo2kinasefructose26bisphosphatasemrna AT marunychry dominantnegativeconstructsofhuman6phosphofructo2kinasefructose26bisphosphatase3and4effectontheexpressionofendogenous6phosphofructo2kinasefructose26bisphosphatasemrna AT tsuchiharak dominantnegativeconstructsofhuman6phosphofructo2kinasefructose26bisphosphatase3and4effectontheexpressionofendogenous6phosphofructo2kinasefructose26bisphosphatasemrna AT moennerm dominantnegativeconstructsofhuman6phosphofructo2kinasefructose26bisphosphatase3and4effectontheexpressionofendogenous6phosphofructo2kinasefructose26bisphosphatasemrna AT caroj dominantnegativeconstructsofhuman6phosphofructo2kinasefructose26bisphosphatase3and4effectontheexpressionofendogenous6phosphofructo2kinasefructose26bisphosphatasemrna AT esumih dominantnegativeconstructsofhuman6phosphofructo2kinasefructose26bisphosphatase3and4effectontheexpressionofendogenous6phosphofructo2kinasefructose26bisphosphatasemrna AT minchenkooh dominantnegativeconstructsofhuman6phosphofructo2kinasefructose26bisphosphatase3and4effectontheexpressionofendogenous6phosphofructo2kinasefructose26bisphosphatasemrna AT minchenkodo domínantnegativníkonstrukcíí6fosfofrukto2kínazifruktozo26bísfosfatazi3ta4lûdinivplivnaekspresíûendogennihmrnk6fosfofrukto2kínazifruktozo26bísfosfataz AT bobarykinaay domínantnegativníkonstrukcíí6fosfofrukto2kínazifruktozo26bísfosfatazi3ta4lûdinivplivnaekspresíûendogennihmrnk6fosfofrukto2kínazifruktozo26bísfosfataz AT ratushnaoo domínantnegativníkonstrukcíí6fosfofrukto2kínazifruktozo26bísfosfatazi3ta4lûdinivplivnaekspresíûendogennihmrnk6fosfofrukto2kínazifruktozo26bísfosfataz AT marunychry domínantnegativníkonstrukcíí6fosfofrukto2kínazifruktozo26bísfosfatazi3ta4lûdinivplivnaekspresíûendogennihmrnk6fosfofrukto2kínazifruktozo26bísfosfataz AT tsuchiharak domínantnegativníkonstrukcíí6fosfofrukto2kínazifruktozo26bísfosfatazi3ta4lûdinivplivnaekspresíûendogennihmrnk6fosfofrukto2kínazifruktozo26bísfosfataz AT moennerm domínantnegativníkonstrukcíí6fosfofrukto2kínazifruktozo26bísfosfatazi3ta4lûdinivplivnaekspresíûendogennihmrnk6fosfofrukto2kínazifruktozo26bísfosfataz AT caroj domínantnegativníkonstrukcíí6fosfofrukto2kínazifruktozo26bísfosfatazi3ta4lûdinivplivnaekspresíûendogennihmrnk6fosfofrukto2kínazifruktozo26bísfosfataz AT esumih domínantnegativníkonstrukcíí6fosfofrukto2kínazifruktozo26bísfosfatazi3ta4lûdinivplivnaekspresíûendogennihmrnk6fosfofrukto2kínazifruktozo26bísfosfataz AT minchenkooh domínantnegativníkonstrukcíí6fosfofrukto2kínazifruktozo26bísfosfatazi3ta4lûdinivplivnaekspresíûendogennihmrnk6fosfofrukto2kínazifruktozo26bísfosfataz AT minchenkodo dominantnegativnyekonstrukcii6fosfofrukto2kinazyfruktozo26bisfosfatazy3i4čelovekavliânienaékspressiûéndogennyhmrnk6fosfofrukto2kinazyfruktozo26bisfosfataz AT bobarykinaay dominantnegativnyekonstrukcii6fosfofrukto2kinazyfruktozo26bisfosfatazy3i4čelovekavliânienaékspressiûéndogennyhmrnk6fosfofrukto2kinazyfruktozo26bisfosfataz AT ratushnaoo dominantnegativnyekonstrukcii6fosfofrukto2kinazyfruktozo26bisfosfatazy3i4čelovekavliânienaékspressiûéndogennyhmrnk6fosfofrukto2kinazyfruktozo26bisfosfataz AT marunychry dominantnegativnyekonstrukcii6fosfofrukto2kinazyfruktozo26bisfosfatazy3i4čelovekavliânienaékspressiûéndogennyhmrnk6fosfofrukto2kinazyfruktozo26bisfosfataz AT tsuchiharak dominantnegativnyekonstrukcii6fosfofrukto2kinazyfruktozo26bisfosfatazy3i4čelovekavliânienaékspressiûéndogennyhmrnk6fosfofrukto2kinazyfruktozo26bisfosfataz AT moennerm dominantnegativnyekonstrukcii6fosfofrukto2kinazyfruktozo26bisfosfatazy3i4čelovekavliânienaékspressiûéndogennyhmrnk6fosfofrukto2kinazyfruktozo26bisfosfataz AT caroj dominantnegativnyekonstrukcii6fosfofrukto2kinazyfruktozo26bisfosfatazy3i4čelovekavliânienaékspressiûéndogennyhmrnk6fosfofrukto2kinazyfruktozo26bisfosfataz AT esumih dominantnegativnyekonstrukcii6fosfofrukto2kinazyfruktozo26bisfosfatazy3i4čelovekavliânienaékspressiûéndogennyhmrnk6fosfofrukto2kinazyfruktozo26bisfosfataz AT minchenkooh dominantnegativnyekonstrukcii6fosfofrukto2kinazyfruktozo26bisfosfatazy3i4čelovekavliânienaékspressiûéndogennyhmrnk6fosfofrukto2kinazyfruktozo26bisfosfataz |