Dominant-negative constructs of human 6-phosphofructo-2-kinase/fructose-2,6-bisphosphatase-3 and -4: effect on the expression of endogenous 6-phosphofructo-2-kinase/fructose-2,6-bisphosphatase mRNA

Expression of 6-phosphofructo-2-kinase/fructose-2,6-bisphosphatase (PFKFB), a key regulatory enzyme of glycolysis, is significantly increased in different malignant tumors provides a potential mechanism of enhanced glycolysis and cancer cell proliferation. We created dominant-negative constructs of...

Повний опис

Збережено в:
Бібліографічні деталі
Опубліковано в: :Біотехнологія
Дата:2008
Автори: Minchenko, D.O., Bobarykina, A.Y., Ratushna, O.O., Marunych, R.Y., Tsuchihara, K., Moenner, M., Caro, J., Esumi, H., Minchenko, O.H.
Формат: Стаття
Мова:Англійська
Опубліковано: Інститут біохімії ім. О.В. Палладіна НАН України 2008
Теми:
Онлайн доступ:https://nasplib.isofts.kiev.ua/handle/123456789/28152
Теги: Додати тег
Немає тегів, Будьте першим, хто поставить тег для цього запису!
Назва журналу:Digital Library of Periodicals of National Academy of Sciences of Ukraine
Цитувати:Dominant-negative constructs of human 6-phosphofructo-2-kinase/fructose-2,6-bisphosphatase-3 and -4: effect on the expression of endogenous 6-phosphofructo-2-kinase/fructose-2,6-bisphosphatase mRNA / D.O. Minchenko, A.Y. Bobarykina, O.O. Ratushna, R.Y. Marunych, K. Tsuchihara, M. Moenner, J. Caro, H. Esumi, O.H. Minchenko // Біотехнологія. — 2008. — Т. 1, № 4. — С. 49-56. — Бібліогр.: 47 назв. — англ.

Репозитарії

Digital Library of Periodicals of National Academy of Sciences of Ukraine
_version_ 1860097725026009088
author Minchenko, D.O.
Bobarykina, A.Y.
Ratushna, O.O.
Marunych, R.Y.
Tsuchihara, K.
Moenner, M.
Caro, J.
Esumi, H.
Minchenko, O.H.
author_facet Minchenko, D.O.
Bobarykina, A.Y.
Ratushna, O.O.
Marunych, R.Y.
Tsuchihara, K.
Moenner, M.
Caro, J.
Esumi, H.
Minchenko, O.H.
citation_txt Dominant-negative constructs of human 6-phosphofructo-2-kinase/fructose-2,6-bisphosphatase-3 and -4: effect on the expression of endogenous 6-phosphofructo-2-kinase/fructose-2,6-bisphosphatase mRNA / D.O. Minchenko, A.Y. Bobarykina, O.O. Ratushna, R.Y. Marunych, K. Tsuchihara, M. Moenner, J. Caro, H. Esumi, O.H. Minchenko // Біотехнологія. — 2008. — Т. 1, № 4. — С. 49-56. — Бібліогр.: 47 назв. — англ.
collection DSpace DC
container_title Біотехнологія
description Expression of 6-phosphofructo-2-kinase/fructose-2,6-bisphosphatase (PFKFB), a key regulatory enzyme of glycolysis, is significantly increased in different malignant tumors provides a potential mechanism of enhanced glycolysis and cancer cell proliferation. We created dominant-negative constructs of 6-phosphofructo-2-kinase/fructose-2,6-bisphosphatase-3 and -4 (dnPFKFB-3 and dnPFKFB-4) cDNA for suppression of strongly enhanced expression endogenous PFKFB-3 and PFKFB-4. We introduce point mutation in ATP-binding domain of 6-phosphofructo-2-kinase part of PFKFB-3 as well as PFKFB-4 cDNA for suppression of 6-phosphofructo-2-kinase activity in the products of dnPFKFB-3 and dnPFKFB-4 expression. Cancer cells were stable transfected with these dominant-negative constructs for suppression of endogenous PFKFB-3 and PFKFB-4 expression and cell proliferation. We have shown that PFKFB-3 expression in pancreatic cancer cell line Panc1, stable transfected by dnPFKFB-3, was significantly reduced in normal as well as in hypoxic conditions. Pancreatic cancer cells proliferation, stable transfected by dnPFKFB-3 or dnPFKFB-4, was also reduced. Results of this investigation demonstrate possibility to apply the dominant-negative constructs of PFKFB-3 and PFKFB-4 for suppression of glycolysis and tumor cells proliferation via reduction of endogenous PFKFB expression. Експресія 6-фосфофрукто-2-кінази/фруктозо-2,6-бісфосфатази (PFKFB), ключового регуляторного ензиму гліколізу, різко зростає в різних злоякісних пухлинах, що розкриває можливий механізм посиленого гліколізу в ракових клітинах та їх проліферації. Ми створили домінантнегативні конструкції кДНК 6-фосфофрукто-2-кінази/фруктозо-2,6-бісфосфатази-3 та -4 (dnPFKFB-3 та dnPFKFB-4) для пригнічення посиленої експресії ендогенних PFKFB-3 та PFKFB-4. Для цього вводили точкові мутації в АТР-зв’язувальний домен 6-фосфофрукто-2-кінази як PFKFB-3, так і PFKFB-4 кДНК для пригнічення 6-фосфо-фрукто-2-кіназної активності у продуктах експресії цих конструкцій. Проводили трансфекцію ракових клітин цими домінантнегативними конструкціями для пригнічення експресії ендогенних PFKFB-3 і PFKFB-4 та проліферації клітин. Встановлено, що експресія PFKFB-3 в клітинах карциноми підшлункової залози лінії Panc1, стабільно трансфекованих dnPFKFB-3, знижується як у нормальних умовах, так і за гіпоксії. У клітинах з посиленою експресією dnPFKFB-4 спостерігали пригнічення ендогенних як PFKFB-4, так і PFKFB-3. Проліферація клітин карциноми підшлункової залози, стабільно трансфекованих як dnPFKFB-3, так і dnPFKFB-4, знижується. Результати цих досліджень показують можливість використання домінантнегативних конструкцій PFKFB-3 та PFKFB-4 для зменшення інтенсивності гліколізу та проліферації ракових клітин шляхом зниження експресії ендогенних PFKFB. Экспрессия 6-фосфофрукто-2-киназы/фруктозо-2,6-бисфосфатазы (PFKFB), ключевого регуляторного энзима гликолиза, резко возрастает в различных злокачественных опухолях, что раскрывает возможный механизм усиленного гликолиза в раковых клетках и их пролиферации. Мы создали доминантнегативные конструкции кДНК 6-фосфофрукто-2-киназы/фруктозо-2,6-бисфосфатазы-3 и -4 (dnPFKFB-3 и dnPFKFB-4) для угнетения усиленной экспрессии эндогенных PFKFB-3 и PFKFB-4. Для этого вводили точечные мутации в АТР-связывающий домен 6-фосфофрукто-2-киназы как PFKFB-3, так и PFKFB-4 для угнетения 6-фосфофрукто-2-киназной активности в продуктах экспрессии этих конструкций. Проводили трансфекцию раковых клеток этими доминантнегативными конструкциями для угнетения экспрессии эндогенных PFKFB-3, а также пролиферации клеток. Установлено, что экспрессия PFKFB-3 в клетках карциномы поджелудочной железы линии Panc1, стабильно трансфецированных dnPFKFB-3, снижается как в нормальных условиях, так и при гипоксии. В клетках с усиленной экспрессией dnPFKFB-4 наблюдали угнетение эндогенных как PFKFB-4, так и PFKFB-3. Пролиферация клеток карциномы поджелудочной железы, стабильно трансфецированных как dnPFKFB-3, так и dnPFKFB-4, снижается. Результаты этих исследований показывают возможность использования доминантнегативных конструкций PFKFB-3 и PFKFB-4 для уменьшения интенсивности гликолиза и пролиферации раковых клеток путем снижения экспрессии эндогенных PFKFB.
first_indexed 2025-12-07T17:26:31Z
format Article
fulltext 49 enzyme in the regulation of glycolysis as well as gluconeogenesis in normal and different pathological conditions, in particular in malignant tumors [4–10]. X�ray crystallogra� phy shown that 6�phosphofructo�2�kinase domain has the same fold as adenylate kinase [11]. The fructose�2,6�bisphosphatase domain of the enzyme subunit bears sequence, mecha� nistic and structural similarity to the histi� dine phosphatase family of enzymes, including The homodimeric bifunctional enzyme 6� phosphofructo�2�kinase/fructose�2,6�bisphos� phatase [6�phosphofructo�2�kinase (EC 2.7.1.105); fructose�2,6�bisphosphatase (EC 3.1.3.46)] has both kinase and bisphosphatase activities and catalyses the synthesis and degradation of fructose�2,6�bisphosphate, a signal molecule that control glycolysis [1–4]. Moreover, 6�phosphofructo�2�kinase/fruc� tose�2,6�bisphosphatase (PFKFB) is a key ЕКСПЕРИМЕНТАЛЬНІ СТАТТІ УДК577.112:616 DOMINANT\NEGATIVE CONSTRUCTS OF HUMAN DOMINANT\NEGATIVE CONSTRUCTS OF HUMAN 6\PHOSPHOFRUCTO\2\KINASE/6\PHOSPHOFRUCTO\2\KINASE/ FRUCTOSE\2,6\BISPHOSPHATASE\3 AND \4:FRUCTOSE\2,6\BISPHOSPHATASE\3 AND \4: EFFECT ON THE EXPRESSION EFFECT ON THE EXPRESSION OF ENDOGENOUS 6\PHOSPHOFRUCTO\2\OF ENDOGENOUS 6\PHOSPHOFRUCTO\2\ KINASE/FRUCTOSE\2,6\BISPHOSPHATASE KINASE/FRUCTOSE\2,6\BISPHOSPHATASE mmRNA RNA Key words: PFKFB�4 mRNA, PFKFB�3 mRNA, dominant�negative constructs, cancer cells. D. O. Minchenko1 1Palladin Institute of Biochemistry of National Academy of Science of Ukraine, Kyiv A. Y. Bobarykina1 O. O. Ratushna1 2Research Center for Innovative Oncology of National Cancer Center Hospital East, R. Y. Marunych1, Kashiwa, Japan K. Tsuchihara2 M. Moenner3 3INSERM U920 Molecular Mechanisms of Angiogenesis Laboratory, University J. Caro4 Bordeaux 1, Talence, France H. Esumi2 O. H. Minchenko1, 2, ∗ 4Department of Medicine, Jefferson Medical College of Thomas Jefferson University, Philadelphia, PA, USA ∗Foreign Research Fellow of the Foundation for Promotion of Cancer Research, Tokyo E7mail: ominchenko@yahoo.com Expression of 6�phosphofructo�2�kinase/fructose�2,6�bisphosphatase (PFKFB), a key regulatory enzyme of gly� colysis, is significantly increased in different malignant tumors provides a potential mechanism of enhanced glycoly� sis and cancer cell proliferation. We created dominant�negative constructs of 6�phosphofructo�2�kinase/fructose� 2,6�bisphosphatase�3 and �4 (dnPFKFB�3 and dnPFKFB�4) cDNA for suppression of strongly enhanced expression endogenous PFKFB�3 and PFKFB�4. We introduce point mutation in ATP�binding domain of 6�phosphofructo�2� kinase part of PFKFB�3 as well as PFKFB�4 cDNA for suppression of 6�phosphofructo�2�kinase activity in the pro� ducts of dnPFKFB�3 and dnPFKFB�4 expression. Cancer cells were stable transfected with these dominant�negative constructs for suppression of endogenous PFKFB�3 and PFKFB�4 expression and cell proliferation. We have shown that PFKFB�3 expression in pancreatic cancer cell line Panc1, stable transfected by dnPFKFB�3, was significantly reduced in normal as well as in hypoxic conditions. Pancreatic cancer cells proliferation, stable transfected by dnPFKFB�3 or dnPFKFB�4, was also reduced. Results of this investigation demonstrate possibility to apply the dominant�negative constructs of PFKFB�3 and PFKFB�4 for suppression of glycolysis and tumor cells proliferation via reduction of endogenous PFKFB expression. БІОТЕХНОЛОГІЯ, Т. 1, №4, 2008 50 therapy. The most PFKFB isozymes are con� tribute to de novo nucleic acid synthesis in tumor cells, are uniformly increased in the malignant tissues and provide a potential mechanism to explain the apparent coupling of enhanced glycolysis and cell proliferation [6, 7, 17–19, 28, 29]. Previously, we have shown that the pfkfb4 gene is overexpressed in several cancer cell lines and is highly induced by hypoxia via HIF�1 dependent mechanism [14]. The pfkfb3 gene encoded 6�phosphofructo� 2�kinase/fructose�2,6�bisphosphatase isozyme ubiquitously expressed in different organs and tumor cells [8, 13–15, 17–19]. Several alternative splice variants of PFKFB� 3 mRNA with variable C�terminus were iden� tified in human brain and different rat and mouse tissues [30–35]. There were isolated eight isoforms of PFKFB�3 mRNA from brain and some other tissues. The cDNA sequences encoding the 5′�untranslated region, the ami� no�terminal domain, and the catalytic core do� main were identical among all these isoforms. However, heterogeneity of the carboxyl�ter� minus was found by sequence analysis. Many genes whose expression is regulated by hypoxia are overexpressed in malignant tis� sues and cell lines and contain HIF�1 binding site (hypoxia�responsible element, HRE) [14, 16, 36–38]. HRE was recently identified in pfkfb3 and pfkfb4 genes [14, 39–41]. Transcription factor HIF is central in coordi� nating many of the transcriptional adapta� tions to hypoxia and a necessary mediator of the hypoxic effect as well as Pasteur effect in mammalian cells and Warburg effect in tumors [29, 37, 42, 43]. Thus, targeting PFKFB enzymes, either directly or through inhibition of HIF�1, appears as a promising approach for the treatment of certain tumors. Despite importance of PFKFB�3 and PFKFB�4 in the regulation of glycolysis, the dominant�negative constructs of 6�phospho� fructo�2�kinase/fructose�2,6�bisphosphatase� 3 and �4 cDNA were not been created and used yet for suppression of glycolysis. In this work we have created dnPFKFB�3 and dnPFKFB�4 constructs and studied the expression of endogenous PFKFB�3 and PFKFB�4 mRNA in pancreatic cancer cells stable transfected with these constructs. Materials and methods Cell lines. Human pancreatic cancer cell lines Pank1 and PSN�1 were obtained from the American Type Culture Collection (ATCC, the acid phosphatases and phosphoglycerate mutases [5, 11]. Therefore, fructose�2,6�bis� phosphate plays a unique role in the control of glucose homeostasis by allowing the liver to switch from glycolysis to gluconeogenesis [4, 5, 7]. There are four 6�phosphofructo�2� kinase/fructose�2,6�bisphosphatase isoen� zymes (PFKFB�1, PFKFB�2, PFKFB�3 and PFKFB�4) in mammals, each coded by a differ� ent gene (pfkfb1, pfkfb2, pfkfb3 and pfkfb4). Moreover, these genes express several iso� forms of each isoenzyme with different kinet� ic and regulatory properties [4, 5, 12, 13]. It was shown that different tissues as well as cancer cell lines express more than one iso� form [13–16]. This multiple expression of PFKFB isozymes with different properties suggests that each isoenzyme can play a spe� cific role in the regulation of glycolysis in some physiologic and different pathophysio� logical conditions. Overexpression of PFKFB isozymes as well as enhanced glycolysis is observed in most malignant tumors and in different cancer cell lines and significantly increases in hypoxic conditions [13–19]. The metabolism within a solid tumor is significantly different from that of the surrounding normal tissue. Tumors growing under conditions of normal oxygen tension show elevated glycolytic rates, produce high levels of lactate and pyruvate (the Warburg effect) that correlate with the increased expression of glycolytic enzymes and glucose transporters via HIF�1 dependent mechanism [1–4, 20–25]. In tumor over 50% of the cellular energy is produced by glycolysis with the remainder being generated at the mitochondria. The reliance of tumor cells on glycolysis for energy production causes them to consume more glucose because of the low efficiency of glycolysis in generating ATP [23]. Thus, glycolysis is essential for tumor survival and spread. Moreover, 6�phospho� fructo�2�kinase/fructose�2,6�bisphosphatase has a key role for the neoplastic transforma� tion and provide rationale for the development of agents that selectively inhibit the PFKFB�3 enzyme as antineoplastic agents. Moreover, hypoxia is a common feature of many cancers and has been linked to malignant transforma� tion, metastasis, and treatment resistance [23–27]. Most of tumors are subjected to hypoxic conditions due to the abnormal vascu� lature that supply them with oxygen and nutrients. Transcription complex HIF�1 is overexpressed in a variety of tumors and its expression appears to correlate with poor prognosis and responses to chemo� or radio� Експериментальні статті 51 (Invitrogen, USA) vector as described previ� ously [14] and used for creation of dominant� negative constructs (dnPFKFB�3 and dnPFKFB�4). These constructs were verified by sequencing the insert in the plasmid. Sequence analysis was performed using ABI Prism (Model 3100, version 3.7). The dnPFKFB�3 and dnPFKFB�4 cDNA were recloned into pcDNA3.1 (Invitrogen, USA) and used for transfection assays. The expression of PFKFB�3 mRNA in Panc1 cells was examined by ribonuclease pro� tection assays as described previously [15, 46], but probes corresponds to 3′�region (3193–3540; GenBank accession number NM_004566). The 18S rRNA antisense probe was used to ensure equal loading of the sample of total RNA. The expression of PFKFB�3 and PFKFB�4 mRNA in Pst�1 cells was examined by real time RCR analysis assays. Quanti� tative PCR was performed on «Stratagene Mx 3000P cycler», using SYBRGreen Mix as described previously [47]. Reaction was per� formed in triplicate. Analysis of quantitative PCR was performed using special computer program «Differential expression calculator» and statistic analysis — in Excel program. Results and Discussion We synthesized the human PFKFB�3 and PFKFB�4 cDNA using total RNA from human pancreatic cancer cell line Panc1. Both cDNA were amplified and cloned into pCRII�TOPO vector. For inactivation of 6�phosphofructo�2� kinase we changed four nucleotide residues in domain «A» using special primers. As shown in Fig. 1 and 2, this nucleotide replacement in USA) and grown according to the supplier’s protocols. The cells were incubated at 37 0C before harvesting under normoxic (21% oxy� gen and 5% carbon dioxide) or hypoxic condi� tions, which were modulated by dimethyloxa� lylglycine (1 mM during 6 hours) [15]. RNA isolation. Total RNA was extracted using Trizol reagent according to the manu� facturer’s protocols (Invitrogen, USA). RNA pellet was washed with 75% ethanol, dis� solved in nuclease�free water and used for reverse transcription. Synthesis and cloning of PFKFB\3 and PFKFB\4 cDNA. The human PFKFB�3 and PFKFB�4 cDNA was synthesized by RT�PCR using total RNA from human pancreatic can� cer cell lines Pank1 and oligo(dT). For first� strand cDNA synthesis was used Sensiscript RT Kit (QIAGEN, Germany). Human PFKFB� 3 PCR amplification was performed with the following oligonucleotides: 5′�GATGCCGTTG� GAACTGACGC�3′ (forward primer) and 3′� CTGAGGCAGACGTGTCGGTT�5′ (reverse primer) using HotStarTaq Master Mix Kit (QIAGEN). These oligonucleotides correspond to nucleotide sequences 329–348 and 1889–1908 of human PFKFB�3 mRNA (GenBank acces� sion number NM_004566). The amplification of human PFKFB�4 was performed with the following oligonucleotides: 5′�GATGGCGTCC� CCACGGGAATTG �3′ (forward primer) and 3′�GCTCACCAGTGACCATGTTC�5′ (reverse primer) using HotStarTaq Master Mix Kit (QIAGEN). These oligonucleotides correspond to nucleotide sequences 17–38 and 1416–11435 of human PFKFB�3 mRNA (GenBank acces� sion number NM_004566). The PFKFB�3 and PFKFB�4 cDNA were cloned into pCRII�TOPO Fig. 1. Fragment of 6\phosphofructo\2\kinase part of human PFKFB\3 cDNA (GenBank accession number NM_004566), containing domain «A» (underlined). Four nucleotide residues (GGCA) into domain «A» were replaced by CTGC. These changes create new restriction site (PstI) and replace two amino acids residues: G and K Fig. 2. Fragment of 6\phosphofructo\2\kinase part of human PFKFB\4 cDNA (GenBank accession number NM_004567), containing domain «A» (underlined). Four nucleotide residues (GGCA) into domain «A» were replaced by CTGC. These changes create new restriction site (PstI) and replace two amino acids residues: G and K БІОТЕХНОЛОГІЯ, Т. 1, №4, 2008 52 PFKFB�3 and PFKFB�4 mRNA expression was also measured in other pancreatic carcino� ma cell line PSN�1 stable transfected by pcDNA3.1(+) vector, dnPFKFB�3 or dnPFKFB�4. Results of these experiments are shown on Fig. 6. PSN�1 cells transfected with dnPFKFB�3 shown lower level of endogenous PFKFB�3 mRNA expression. Moreover, the expression of PFKFB�4 mRNA in these cells also decreased. It is possible that there is some interaction between different PFKFB genes in molecular mechanisms of PFKFB suppression by dominant�negative constructs. Same effect has dnPFKFB�4 on the of endogenous PFKFB� 4 and PFKFB�3 mRNA. PFKFB�3 and PFKFB�4 creates new restric� tion site (PstI) and changes two amino acids residues: G to L and K to Q. These changes should suppress the 6�phosphofructo�2�kinase activity because K residue is crucial for keep� ing kinase activity. These modified PFKFB�3 and PFKFB�4 cDNA represent dominant�neg� ative variants in respect to 6�phosphofructo� 2�kinase activity. We recloned modified human PFKFB�3 and PFKFB�4 cDNA into eukaryotic expres� sion vector pcDNA3.1(+) using EcoRI and XbaI restriction nuclease sites. Structure of dominant�negative construct of PFKFB�3 (dnPFKFB�3) shown on Fig. 3. Same structure has dnPFKFB�4. Both dominant�negative con� structs were used for transfection experi� ments. We received clone of Panc1 cells stable transfected by dnPFKFB�3. The effect of PFKFB�3 dominant�negative construct on the expression of endogenous PFKFB�3 mRNA is shown in Fig. 4. For this analysis was used 3′�terminus of PFKFB�3 mRNA because dnPFKFB�3 construct does not contains this region of PFKFB�3. Pancreatic cancer cells, stable transfected by dnPFKFB� 3, have significantly lower expression of endogenous PFKFB�3 mRNA as in normoxic and hypoxic conditions, which were modulat� ed by dimethyloxalylglycine (Fig. 4 and 5). Fig. 3. Dominant\negative plasmid construction of human PFKFB\3 cDNA, which contains PFKFB\3 cDNA with modified 6\phosphofructo\2\kinase domain «A» into pcDNA3.1(+) vector Fig. 4. Endogenous PFKFB\3 mRNA expression in pancreatic carcinoma cell line Panc1 stable trans\ fected by pcDNA3.1(+) vector (Panc1 cells) and stable transfected by dnPFKFB\3 (Panc1 + dnPFKFB\3) in normoxic (N) and hypoxic conditions (I), which were modulated by dimethyloxalylglycine (1 mM during 6 hours). The 18S rRNA antisense probe was used to ensure equal loading of the sample of total RNA Fig. 5. Quantification of endogenous PFKFB\3 mRNA expression in pancreatic carcinoma cell line Panc1 stable transfected by pcDNA3.1(+) vector or dnPFKFB\3 in normoxic (N) and hypoxic (I) condi\ tions; n = 5 Експериментальні статті 53 9. Bando H., Atsumi T., Nishio T. et al. Phosphorylation of the 6�phosphofructo�2� kinase/fructose 2,6�bisphosphatase/ PFKFB3 family of glycolytic regulators in human cancer // Clin. Cancer Res. 2005. — V. 11, N16 — P. 5784–5792. 10. Calvo M. N., Bartrons R., Castano E. et al. PFKFB3 gene silencing decreases glycolysis, induces cell�cycle delay and inhibits anchor� age�independent growth in HeLa cells // FEBS Lett. — 2006. — V. 580, N13. — Р. 3308–3314. 11. Bertrand L., Vertommen D., Depiereux E. et al. Modelling the 2�kinase domain of 6�phos� phofructo�2�kinase/fructose�2,6�bisphos� phatase on adenylate kinase // Biochem. J. — 1997. — V. 321, Pt. 3. — P. 615–621. 12. Sakakibara R., Okudaira T., Fujiwara K. et al. Tissue distribution of placenta�type 6�phos� phofructo� 2�kinase/fructose�2,6�bisphos� phatase // Biochem. Biophys. Res. Commun. — 1999. — V. 257, N1. — P. 177–181. 13. Minchenko O., Opentanova I., Caro J. Hypoxic regulation of the 6�phosphofructo� 2�kinase/fructose�2,6�bisphosphatase�3 gene family (PFKFB�1�4) expression in vivo // FEBS Lett. — 2003. — V. 554, N3. — P. 264–270. 14. Minchenko O. H., Opentanova I. L., Minchen7 ko D. O. et al. Hypoxia induces transcription of 6�phosphofructo�2�kinase/fructose�2,6� bisphosphatase 4 gene via hypoxia�inducible factor�1alpha activation // Ibid. — 2004. — V. 576, N1. — P. 14–20. 15. Minchenko A. G., Leshchinsky I., Opentanova I. et al. Hypoxia�inducible factor�1�mediated expression of the 6�phosphofructo�2� kinase/fructose�2,6�bisphosphatase�3 (PFKFB3) gene // J. Biol. Chem. — 2002. — V. 277, N8. — P. 6183–6187. 16. Mykhalchenko V. G., Kovtun O. O., Bobaryki7 na A. Y., Minchenko O. H. Molecular mecha� nisms of the regulation of the 6�phospho� fructo�2�kinase/fructose�2,6�bisphosphatase genes expression in hypoxia // Bulletin Taras Shevchenko Kyiv National Univer� sity. — 2006. — Issue 11. — P. 18–24. 17. Minchenko O. H., Ogura T., Opentanova I. L. et al. 6�Phosphofructo�2�kinase/fructose� 2,6�bisphosphatase gene family overexpres� sion in the lung tumor // Укр. біохім. журн. — 2005. — Т. 77, №6. — С. 46–50. 18. Bobarykina A. Y., Minchenko D. O., Openta7 nova I. L. et al. Hypoxic regulation of PFKFB�3 and PFKFB�4 gene expression in gastric and pancreatic cancer cell lines and expression of PFKFB genes in gastric can� cers // Acta Biochim. Pol. — 2006. — V. 53, N4. — Р. 789–799. 19. Minchenko O. H., Ochiai A., Opentanova I. L. et al. Overexpression of 6�phosphofructo�2� 1. Okar D. A., Lange A. J. Fructose�2,6�bisphos� phate and control of carbohydrate metabo� lism in eukaryotes // Biofactors. — 1999. — V. 10, N1. — P. 1–14. 2. Kawaguchi T., Veech R. L., Uyeda K. Regulation of energy metabolism in macrophages during hypoxia. Roles of fruc� tose 2,6�bisphosphate and ribose 1,5�bispho� sphate // J. Biol. Chem. — 2001. — V. 276, N30. — P. 28554 — 28561. 3. Rousseau G. G., Hue L. Mammalian 6�phos� phofructo�2�kinase/fructose�2,6�bisphos� phatase: a bifunctional enzyme that control glycolysis // Prog. Nucleic Acid Res. Mol. Biol. — 1993. — V. 45. — P. 99 — 127. 4. Okar D. A., Manzano A., Navarro7Sabate A. et al. PFK�2/FBPase�2: maker and breaker of the essential biofactor fructose�2,6�bisphos� phate // Trends Biochem. Sci. — 2001. — V. 26, N1. — P. 30 — 35. 5. Rider M. H., Bertrand L., Vertommen D. et al. 6�phosphofructo�2�kinase/fructose�2,6�bis� phosphatase: head�head with a bifunctional enzyme that controls glycolysis // Biochem. J. — 2004. — V. 381, Pt. 3. — P. 561–579. 6. Atsumi T., Chesney J., Metz C. et al. High expression of inducible 6�phosphofructo�2� kinase/fructose�2,6�bisphosphatase�3 (iPFK�2; PFKFB3) in human cancers // Cancer Res. — 2002. — V. 62, N20. — P. 5881–5887. 7. Atsumi T., Nishio T., Niwa H. et al. Expression of inducible 6�phosphofructo�2�kinase/fruc� tose�2,6�bisphosphatase/PFKFB3 isoforms in adipocytes and their potential role in gly� colytic regulation // Diabetes. — 2005. — V. 54, N12. — P. 3349–3357. 8. Chesney J. 6�phosphofructo�2�kinase/fruc� tose�2,6�bisphosphatase and tumor cell gly� colysis // Curr. Opin. Clin. Nutr. Metab. Care. — 2006. — V. 9, N5. — P. 535–539. Fig. 6. Endogenous PFKFB\3 and PFKFB\4 mRNA expression in pancreatic carcinoma cell line PSN\1 stable transfected with pcDNA3.1(+) vector, dnPFKFB\3 and dnPFKFB\4 LITERATURE БІОТЕХНОЛОГІЯ, Т. 1, №4, 2008 54 phosphate 2�kinase/fructose 2,6�bisphos� phatase // FEBS Lett. — 1999. — V. 458, N1. — P. 304–308. 33. Mykhalchenko V. G., Minchenko D. O., Tsuchihara K. et al. Expression of mouse 6� phosphofructo�2�kinase/fructose�2,6�bis� phosphatase�3 mRNA alternative splice variants in hypoxia // Укр. біохім. журн. — 2008. — Т. 80, №1. — С. 19–25. 34. Minchenko D. O., Tsuchihara K., Komisa7 renko S. V. et al. Unique alternative splice variants of mouse PFKFB�3 mRNA: tissue specific expression // Scientific Bulletin National O.O. Bohomoletz Medical University. — 2008. — №1. — P. 72–78. 35. Minchenko O. H., Opentanova I. L., Ochiai A. et al. Splice isoform of 6�phosphofructo�2� kinase/ fructose�2,6�bisphosphatase�4: ex� pression and hypoxic regulation. Mol. & Cell. Biochem. — 2005. — V. 280, N1–2. — P. 227–234. 36. Wykoff C. C., Pugh C. W., Maxwell P. H. et al. The HIF pathway: implications for patterns of gene expression in cancer // Novartis Found Symp. — 2001. — V. 240. — P. 212–225. 37. Wenger R. H. Cellular adaptation to hypoxia: O2�sensing protein hydroxylases, hypoxia� inducible transcription factors, and O2�regu� lated gene expression // FASEB J. — 2002. — V. 16, N10. — P. 1151–1162. 38. Minchenko A. G., Caro J.: Regulation of endothelin�1 gene expression in human microvascular endothelial cells by hypoxia and cobalt: role of hypoxia responsible ele� ment // Mol. & Cell. Biochem. — 2000. — V. 208. — P. 53–62. 39. Minchenko O. H., Opentanova I. L., Ogura T. et al. Expression and hypoxia�responsiveness of the 6�phosphofructo�2�kinase/fructose� 2,6�bisphosphatase 4 in the mammary gland malignant cell lines // Acta Biochim. Pol. — 2005. — V. 52, N4. — P. 881–888. 40. Fukasawa M., Tsuchiya T., Takayama E. et al. Identification and characterization of the hypoxia�responsive element of the human placental 6�phosphofructo�2�kinase/fructose� 2,6�bisphosphatase gene // J. Biochem. — 2004. — V. 136, N3. — P. 273–277. 41. Obach M., Navarro7Sabate A., Caro J. et al. 6� Phosphofructo�2�kinase (pfkfb3) gene pro� moter contains hypoxia�inducible factor�1 binding sites necessary for transactivation in response to hypoxia // J. Biol. Chem. — 2004. — V. 279, N51. — P. 53562–53570. 42. Walenta S., Salameh A., Lyng H. et al. Correlation of high lactate levels in head and neck tumors with incidence of metastasis // Am. J. Pathol. — 1997. — V. 150, N3. — P. 409–415. 43. Chen J., Zhao S., Nakada K. et al. Dominant� negative hypoxia�inducible factor�1 alpha kinase/fructose�2,6�bisphosphatase�4 in the human breast and colon malignant tumors // Biochimie. — 2005. — V. 87, N11. — P. 1005–1010. 20. Warburg O. On respiratory impairment in cancer cells // Science. — 1956. — V. 123, N3191. — P. 309–314. 21. Hopfl G., Ogunshola O., Gassmann M. HIFs and tumors — causes and consequences // Am. J. Physiol. — 2004. — V. 286, N4. — P. R608–R623. 22. Chesney J., Mitchell R., Benigni F. et al. An inducible gene product for 6�phosphofructo� 2�kinase with an AU�rich instability ele� ment: Role in tumor cell glycolysis and the Warburg effect // Proc. Natl. Acad. Sci. USA. — 1999. — V. 96, N6. — P. 3047–3052. 23. Denko N. C. Hypoxia, HIF1 and glucose metabolism in the solid tumor // Nat. Rev. Cancer. — 2008. — V. 8. — P. 705–713. 24. Hockel M., Vaupel P. Tumor hypoxia: defini� tions and current clinical, biologic, and mol� ecular aspects // J. Natl. Cancer Inst. — 2001. — V. 93, N4. — P. 266–276. 25. Lu H., Forbes R. A., Verma A. Hypoxia� inducible factor 1 activation by aerobic gly� colysis implicates the Warburg effect in car� cinogenesis // J. Biol. Chem. — 2002. — V. 277, N26. — P. 23111–23115. 26. Bartrons R., Caro J. Hypoxia, glucose meta� bolism and the Warburg’s effect // J. Bio� energ. Biomembr. — 2007. — V. 39, N3. — P. 223–229. 27. Airley R. E., Mobasheri A. Hypoxic regula� tion of glucose transport, anaerobic metabo� lism and angiogenesis in cancer: novel path� ways and targets for anticancer therapeutics // Chemotherapy. — 2007. — V. 53, N4. — P. 233–256. 28. Бобарикіна А. Ю., Мінченко Д. О., Опента7 нова І. Л. та ін. Експресія мРНК HIF�1α, HIF�2α та VHL у різних лініях клітин при гіпоксії // Укр. біохім. журн. — 2006. — Т. 78, №2. — С. 49–59. 29. Hirata T., Watanabe M., Miura S. et al. Inhibition of tumor cell growth by a specific 6�phosphofructo�2�kinase inhibitor, N�bro� moacetylethanolamine phosphate, and its analogues // Biosci. Biotechnol. Biochem. — 2000. — V. 64, N10. — P. 2047–2052. 30. Kessler R., Eschrich K. Splice isoforms of ubiquitous 6�phosphofructo�2�kinase/fruc� tose�2,6�bisphosphatase in human brain // Mol. Brain Res. — 2001. — V. 87, N2. — P. 190–195. 31. Watanabe F., Sakai A., Furuya E. Novel iso� forms of rat brain fructose 2�phospho 2� kinase/fructose 2,6�bisphosphatase are gen� erated by tissue�specific alternative splicing // J. Neurochem. — 1997. — V. 69, N1. — P. 1–9. 32. Watanabe F., Furuya E. Tissue�specific alternative splicing of rat brain fructose 6� ДОМІНАНТНЕГАТИВНІ КОНСТРУКЦІЇ 6\ ФОСФОФРУКТО\2\КІНАЗИ/ФРУКТОЗО\ 2,6\БІСФОСФАТАЗИ\3 ТА \4 ЛЮДИНИ: ВПЛИВ НА ЕКСПРЕСІЮ ЕНДОГЕННИХ мРНК 6\ФОСФОФРУКТО\ 2\КІНАЗИ/ ФРУКТОЗО\2,6\БІСФОСФАТАЗ Д. О. Мінченко1 А. Ю. Бобарикіна1 О. О. Ратушна1 Р. Ю. Марунич1 K. Tсучігарa2 М. Моне3 Х. Каро4 Г. Eсумі2 О. Г. Мінченко 1, 2 1Інститут біохімії ім. О.В. Палладіна НАН України, Київ 2Науково�дослідний центр інноваційної онкології Східного госпіталю Національного онкологічного центру Японії, Kaшівa, Японія 3INSERM U920 Лабораторія молекулярних механізмів ангіогенезу Університету Бордо 1, Таленс, Франція 4Відділ медицини Джеферсон медичного коледжу Томас Джеферсон Університету, Філадельфія, США E7mail: ominchenko@yahoo.com Експресія 6�фосфофрукто�2�кінази/фрук� тозо�2,6�бісфосфатази (PFKFB), ключового ре� гуляторного ензиму гліколізу, різко зростає в різних злоякісних пухлинах, що розкриває можливий механізм посиленого гліколізу в ракових клітинах та їх проліферації. Ми створили домінантнегативні конструкції кДНК 6�фосфофрукто�2�кінази/фруктозо�2,6� бісфосфатази�3 та �4 (dnPFKFB�3 та dnPFKFB�4) для пригнічення посиленої експресії ендоген� них PFKFB�3 та PFKFB�4. Для цього вводили точкові мутації в АТР�зв’язувальний домен 6�фосфофрукто�2�кінази як PFKFB�3, так і PFKFB�4 кДНК для пригнічення 6�фосфо� фрукто�2�кіназної активності у продуктах експресії цих конструкцій. Проводили транс� фекцію ракових клітин цими домінантнега� тивними конструкціями для пригнічення експресії ендогенних PFKFB�3 і PFKFB�4 та проліферації клітин. Встановлено, що експресія PFKFB�3 в клітинах карциноми підшлункової залози лінії Panc1, стабільно трансфекованих dnPFKFB�3, знижується як у нормальних умовах, так і за гіпоксії. У клітинах з посиленою експресією dnPFKFB� 4 спостерігали пригнічення ендогенних як PFKFB�4, так і PFKFB�3. Проліферація клі� тин карциноми підшлункової залози, стабіль� но трансфекованих як dnPFKFB�3, так і dnPFKFB�4, знижується. Результати цих досліджень показують можливість викорис� тання домінантнегативних конструкцій PFKFB�3 та PFKFB�4 для зменшення інтен� сивності гліколізу та проліферації ракових клітин шляхом зниження експресії ендоген� них PFKFB. Ключові слова: PFKFB�4 мРНК, PFKFB�3 мРНК, домінантнегативні конструкції, ра� кові клітини. Експериментальні статті 55 46. Minchenko O. H., Opentanova I. L., Ochiai A. et al. Splice isoform of 6�phosphofructo�2� kinase/ fructose�2,6�bisphosphatase�4: expression and hypoxic regulation // Mol. & Cell. Biochem. — 2005. — V. 280. — N1–2. — P. 227–234. 47. Mykhalchenko V. G., Tsuchihara K., Minchen7 ko D. O. et al. 6�Phosphofructo�2�kinase/ fructose�2,6�bisphosphatase mRNA expres� sion in streptozotocin�diabetic rats // Biopolymers & Cell. — 2008. — V. 24, N3. — P. 260–266. reduces tumorigenicity of pancreatic cancer cells through the suppression of glucose metabolism // Am. J. Pathol. — 2003. — V. 162, N4. — P. 1283–1291. 44. Ryan H. E., Poloni M., McNulty W. et al. Hypoxia�inducible factor�1 is a positive fac� tor in solid tumor growth // Cancer Res. — 2000. — V. 60, N15. — P. 4010–4015. 45. Minchenko O. H., Ogura T., Opentanova I. L. et al. 6�Phosphofructo�2�kinase/fructose� 2,6�bisphosphatase gene family overexpres� sion in the lung tumor // Укр. біохім. журн. — 2005. — Т. 77, №6. — С. 46–50. БІОТЕХНОЛОГІЯ, Т. 1, №4, 2008 56 и PFKFB�4. Для этого вводили точечные мута� ции в АТР�связывающий домен 6�фосфофрук� то�2�киназы как PFKFB�3, так и PFKFB�4 для угнетения 6�фосфофрукто�2�киназной актив� ности в продуктах экспрессии этих конструк� ций. Проводили трансфекцию раковых клеток этими доминантнегативными конструкциями для угнетения экспрессии эндогенных PFKFB� 3, а также пролиферации клеток. Установле� но, что экспрессия PFKFB�3 в клетках карци� номы поджелудочной железы линии Panc1, стабильно трансфецированных dnPFKFB�3, снижается как в нормальных условиях, так и при гипоксии. В клетках с усиленной экспрес� сией dnPFKFB�4 наблюдали угнетение эндо� генных как PFKFB�4, так и PFKFB�3. Проли� ферация клеток карциномы поджелудочной железы, стабильно трансфецированных как dnPFKFB�3, так и dnPFKFB�4, снижается. Ре� зультаты этих исследований показывают воз� можность использования доминантнегатив� ных конструкций PFKFB�3 и PFKFB�4 для уменьшения интенсивности гликолиза и про� лиферации раковых клеток путем снижения экспрессии эндогенных PFKFB. Ключевые слова: PFKFB�3 и PFKFB�4 мРНК, до� минант�негативные конструкции, раковые клетки. ДОМИНАНТНЕГАТИВНЫЕ КОНСТРУКЦИИ 6\ФОСФОФРУКТО\2\ КИНАЗЫ/ФРУКТОЗО\2,6\БИСФОСФАТАЗЫ\3 И \4 ЧЕЛОВЕКА: ВЛИЯНИЕ НА ЭКСПРЕССИЮ ЭНДОГЕННЫХ мРНК 6\ФОСФОФРУКТО\2\ КИНАЗЫ/ФРУКТОЗО\2,6\БИСФОСФАТАЗ Д. А. Минченко1 А. Ю. Бобарыкина1 О. А. Ратушна1 Р. Ю. Марунич1 K. Tсучигарa2 М. Моне3 Х. Каро4 Г. Eсуми2 А. Г. Минченко1, 2 1Институт биохимии им. А. В. Палладина НАН Украины, Kиев 2Научно�исследовательский центр инноваци� онной онкологии Восточного госпиталя Национального онкологического центра Япо� нии, Kaшивa, Япония 3INSERM U920 Лаборатория молекулярных ме� ханизмов ангиогенеза Университета Бордо 1, Таленс, Франция 4Отдел медицины Джефферсон медицинского колледжа Томас Джефферсон Университета, Филадельфия, США E7mail: ominchenko@yahoo.com Экспрессия 6�фосфофрукто�2�киназы/ фруктозо�2,6�бисфосфатазы (PFKFB), ключе� вого регуляторного энзима гликолиза, резко возрастает в различных злокачественных опу� холях, что раскрывает возможный механизм усиленного гликолиза в раковых клетках и их пролиферации. Мы создали доминантнегатив� ные конструкции кДНК 6�фосфофрукто�2� киназы/фруктозо�2,6�бисфосфатазы�3 и �4 (dnPFKFB�3 и dnPFKFB�4) для угнетения уси� ленной экспрессии эндогенных PFKFB�3
id nasplib_isofts_kiev_ua-123456789-28152
institution Digital Library of Periodicals of National Academy of Sciences of Ukraine
issn 1995-5537
language English
last_indexed 2025-12-07T17:26:31Z
publishDate 2008
publisher Інститут біохімії ім. О.В. Палладіна НАН України
record_format dspace
spelling Minchenko, D.O.
Bobarykina, A.Y.
Ratushna, O.O.
Marunych, R.Y.
Tsuchihara, K.
Moenner, M.
Caro, J.
Esumi, H.
Minchenko, O.H.
2011-10-29T22:07:00Z
2011-10-29T22:07:00Z
2008
Dominant-negative constructs of human 6-phosphofructo-2-kinase/fructose-2,6-bisphosphatase-3 and -4: effect on the expression of endogenous 6-phosphofructo-2-kinase/fructose-2,6-bisphosphatase mRNA / D.O. Minchenko, A.Y. Bobarykina, O.O. Ratushna, R.Y. Marunych, K. Tsuchihara, M. Moenner, J. Caro, H. Esumi, O.H. Minchenko // Біотехнологія. — 2008. — Т. 1, № 4. — С. 49-56. — Бібліогр.: 47 назв. — англ.
1995-5537
https://nasplib.isofts.kiev.ua/handle/123456789/28152
577.112:616
Expression of 6-phosphofructo-2-kinase/fructose-2,6-bisphosphatase (PFKFB), a key regulatory enzyme of glycolysis, is significantly increased in different malignant tumors provides a potential mechanism of enhanced glycolysis and cancer cell proliferation. We created dominant-negative constructs of 6-phosphofructo-2-kinase/fructose-2,6-bisphosphatase-3 and -4 (dnPFKFB-3 and dnPFKFB-4) cDNA for suppression of strongly enhanced expression endogenous PFKFB-3 and PFKFB-4. We introduce point mutation in ATP-binding domain of 6-phosphofructo-2-kinase part of PFKFB-3 as well as PFKFB-4 cDNA for suppression of 6-phosphofructo-2-kinase activity in the products of dnPFKFB-3 and dnPFKFB-4 expression. Cancer cells were stable transfected with these dominant-negative constructs for suppression of endogenous PFKFB-3 and PFKFB-4 expression and cell proliferation. We have shown that PFKFB-3 expression in pancreatic cancer cell line Panc1, stable transfected by dnPFKFB-3, was significantly reduced in normal as well as in hypoxic conditions. Pancreatic cancer cells proliferation, stable transfected by dnPFKFB-3 or dnPFKFB-4, was also reduced. Results of this investigation demonstrate possibility to apply the dominant-negative constructs of PFKFB-3 and PFKFB-4 for suppression of glycolysis and tumor cells proliferation via reduction of endogenous PFKFB expression.
Експресія 6-фосфофрукто-2-кінази/фруктозо-2,6-бісфосфатази (PFKFB), ключового регуляторного ензиму гліколізу, різко зростає в різних злоякісних пухлинах, що розкриває можливий механізм посиленого гліколізу в ракових клітинах та їх проліферації. Ми створили домінантнегативні конструкції кДНК 6-фосфофрукто-2-кінази/фруктозо-2,6-бісфосфатази-3 та -4 (dnPFKFB-3 та dnPFKFB-4) для пригнічення посиленої експресії ендогенних PFKFB-3 та PFKFB-4. Для цього вводили точкові мутації в АТР-зв’язувальний домен 6-фосфофрукто-2-кінази як PFKFB-3, так і PFKFB-4 кДНК для пригнічення 6-фосфо-фрукто-2-кіназної активності у продуктах експресії цих конструкцій. Проводили трансфекцію ракових клітин цими домінантнегативними конструкціями для пригнічення експресії ендогенних PFKFB-3 і PFKFB-4 та проліферації клітин. Встановлено, що експресія PFKFB-3 в клітинах карциноми підшлункової залози лінії Panc1, стабільно трансфекованих dnPFKFB-3, знижується як у нормальних умовах, так і за гіпоксії. У клітинах з посиленою експресією dnPFKFB-4 спостерігали пригнічення ендогенних як PFKFB-4, так і PFKFB-3. Проліферація клітин карциноми підшлункової залози, стабільно трансфекованих як dnPFKFB-3, так і dnPFKFB-4, знижується. Результати цих досліджень показують можливість використання домінантнегативних конструкцій PFKFB-3 та PFKFB-4 для зменшення інтенсивності гліколізу та проліферації ракових клітин шляхом зниження експресії ендогенних PFKFB.
Экспрессия 6-фосфофрукто-2-киназы/фруктозо-2,6-бисфосфатазы (PFKFB), ключевого регуляторного энзима гликолиза, резко возрастает в различных злокачественных опухолях, что раскрывает возможный механизм усиленного гликолиза в раковых клетках и их пролиферации. Мы создали доминантнегативные конструкции кДНК 6-фосфофрукто-2-киназы/фруктозо-2,6-бисфосфатазы-3 и -4 (dnPFKFB-3 и dnPFKFB-4) для угнетения усиленной экспрессии эндогенных PFKFB-3 и PFKFB-4. Для этого вводили точечные мутации в АТР-связывающий домен 6-фосфофрукто-2-киназы как PFKFB-3, так и PFKFB-4 для угнетения 6-фосфофрукто-2-киназной активности в продуктах экспрессии этих конструкций. Проводили трансфекцию раковых клеток этими доминантнегативными конструкциями для угнетения экспрессии эндогенных PFKFB-3, а также пролиферации клеток. Установлено, что экспрессия PFKFB-3 в клетках карциномы поджелудочной железы линии Panc1, стабильно трансфецированных dnPFKFB-3, снижается как в нормальных условиях, так и при гипоксии. В клетках с усиленной экспрессией dnPFKFB-4 наблюдали угнетение эндогенных как PFKFB-4, так и PFKFB-3. Пролиферация клеток карциномы поджелудочной железы, стабильно трансфецированных как dnPFKFB-3, так и dnPFKFB-4, снижается. Результаты этих исследований показывают возможность использования доминантнегативных конструкций PFKFB-3 и PFKFB-4 для уменьшения интенсивности гликолиза и пролиферации раковых клеток путем снижения экспрессии эндогенных PFKFB.
en
Інститут біохімії ім. О.В. Палладіна НАН України
Біотехнологія
Експериментальні статті
Dominant-negative constructs of human 6-phosphofructo-2-kinase/fructose-2,6-bisphosphatase-3 and -4: effect on the expression of endogenous 6-phosphofructo-2-kinase/fructose-2,6-bisphosphatase mRNA
Домінант-негативні конструкції 6-фосфофрукто-2-кінази/фруктозо-2,6-бісфосфатази-3 та -4 людини: вплив на експресію ендогенних мРНК 6-фосфофрукто-2-кінази/фруктозо-2,6-бісфосфатаз
Доминант-негативные конструкции 6-фосфофрукто-2-киназы/фруктозо-2,6-бисфосфатазы-3 и -4 человека: влияние на экспрессию эндогенных мРНК 6-фосфофрукто-2-киназы/фруктозо-2,6-бисфосфатаз
Article
published earlier
spellingShingle Dominant-negative constructs of human 6-phosphofructo-2-kinase/fructose-2,6-bisphosphatase-3 and -4: effect on the expression of endogenous 6-phosphofructo-2-kinase/fructose-2,6-bisphosphatase mRNA
Minchenko, D.O.
Bobarykina, A.Y.
Ratushna, O.O.
Marunych, R.Y.
Tsuchihara, K.
Moenner, M.
Caro, J.
Esumi, H.
Minchenko, O.H.
Експериментальні статті
title Dominant-negative constructs of human 6-phosphofructo-2-kinase/fructose-2,6-bisphosphatase-3 and -4: effect on the expression of endogenous 6-phosphofructo-2-kinase/fructose-2,6-bisphosphatase mRNA
title_alt Домінант-негативні конструкції 6-фосфофрукто-2-кінази/фруктозо-2,6-бісфосфатази-3 та -4 людини: вплив на експресію ендогенних мРНК 6-фосфофрукто-2-кінази/фруктозо-2,6-бісфосфатаз
Доминант-негативные конструкции 6-фосфофрукто-2-киназы/фруктозо-2,6-бисфосфатазы-3 и -4 человека: влияние на экспрессию эндогенных мРНК 6-фосфофрукто-2-киназы/фруктозо-2,6-бисфосфатаз
title_full Dominant-negative constructs of human 6-phosphofructo-2-kinase/fructose-2,6-bisphosphatase-3 and -4: effect on the expression of endogenous 6-phosphofructo-2-kinase/fructose-2,6-bisphosphatase mRNA
title_fullStr Dominant-negative constructs of human 6-phosphofructo-2-kinase/fructose-2,6-bisphosphatase-3 and -4: effect on the expression of endogenous 6-phosphofructo-2-kinase/fructose-2,6-bisphosphatase mRNA
title_full_unstemmed Dominant-negative constructs of human 6-phosphofructo-2-kinase/fructose-2,6-bisphosphatase-3 and -4: effect on the expression of endogenous 6-phosphofructo-2-kinase/fructose-2,6-bisphosphatase mRNA
title_short Dominant-negative constructs of human 6-phosphofructo-2-kinase/fructose-2,6-bisphosphatase-3 and -4: effect on the expression of endogenous 6-phosphofructo-2-kinase/fructose-2,6-bisphosphatase mRNA
title_sort dominant-negative constructs of human 6-phosphofructo-2-kinase/fructose-2,6-bisphosphatase-3 and -4: effect on the expression of endogenous 6-phosphofructo-2-kinase/fructose-2,6-bisphosphatase mrna
topic Експериментальні статті
topic_facet Експериментальні статті
url https://nasplib.isofts.kiev.ua/handle/123456789/28152
work_keys_str_mv AT minchenkodo dominantnegativeconstructsofhuman6phosphofructo2kinasefructose26bisphosphatase3and4effectontheexpressionofendogenous6phosphofructo2kinasefructose26bisphosphatasemrna
AT bobarykinaay dominantnegativeconstructsofhuman6phosphofructo2kinasefructose26bisphosphatase3and4effectontheexpressionofendogenous6phosphofructo2kinasefructose26bisphosphatasemrna
AT ratushnaoo dominantnegativeconstructsofhuman6phosphofructo2kinasefructose26bisphosphatase3and4effectontheexpressionofendogenous6phosphofructo2kinasefructose26bisphosphatasemrna
AT marunychry dominantnegativeconstructsofhuman6phosphofructo2kinasefructose26bisphosphatase3and4effectontheexpressionofendogenous6phosphofructo2kinasefructose26bisphosphatasemrna
AT tsuchiharak dominantnegativeconstructsofhuman6phosphofructo2kinasefructose26bisphosphatase3and4effectontheexpressionofendogenous6phosphofructo2kinasefructose26bisphosphatasemrna
AT moennerm dominantnegativeconstructsofhuman6phosphofructo2kinasefructose26bisphosphatase3and4effectontheexpressionofendogenous6phosphofructo2kinasefructose26bisphosphatasemrna
AT caroj dominantnegativeconstructsofhuman6phosphofructo2kinasefructose26bisphosphatase3and4effectontheexpressionofendogenous6phosphofructo2kinasefructose26bisphosphatasemrna
AT esumih dominantnegativeconstructsofhuman6phosphofructo2kinasefructose26bisphosphatase3and4effectontheexpressionofendogenous6phosphofructo2kinasefructose26bisphosphatasemrna
AT minchenkooh dominantnegativeconstructsofhuman6phosphofructo2kinasefructose26bisphosphatase3and4effectontheexpressionofendogenous6phosphofructo2kinasefructose26bisphosphatasemrna
AT minchenkodo domínantnegativníkonstrukcíí6fosfofrukto2kínazifruktozo26bísfosfatazi3ta4lûdinivplivnaekspresíûendogennihmrnk6fosfofrukto2kínazifruktozo26bísfosfataz
AT bobarykinaay domínantnegativníkonstrukcíí6fosfofrukto2kínazifruktozo26bísfosfatazi3ta4lûdinivplivnaekspresíûendogennihmrnk6fosfofrukto2kínazifruktozo26bísfosfataz
AT ratushnaoo domínantnegativníkonstrukcíí6fosfofrukto2kínazifruktozo26bísfosfatazi3ta4lûdinivplivnaekspresíûendogennihmrnk6fosfofrukto2kínazifruktozo26bísfosfataz
AT marunychry domínantnegativníkonstrukcíí6fosfofrukto2kínazifruktozo26bísfosfatazi3ta4lûdinivplivnaekspresíûendogennihmrnk6fosfofrukto2kínazifruktozo26bísfosfataz
AT tsuchiharak domínantnegativníkonstrukcíí6fosfofrukto2kínazifruktozo26bísfosfatazi3ta4lûdinivplivnaekspresíûendogennihmrnk6fosfofrukto2kínazifruktozo26bísfosfataz
AT moennerm domínantnegativníkonstrukcíí6fosfofrukto2kínazifruktozo26bísfosfatazi3ta4lûdinivplivnaekspresíûendogennihmrnk6fosfofrukto2kínazifruktozo26bísfosfataz
AT caroj domínantnegativníkonstrukcíí6fosfofrukto2kínazifruktozo26bísfosfatazi3ta4lûdinivplivnaekspresíûendogennihmrnk6fosfofrukto2kínazifruktozo26bísfosfataz
AT esumih domínantnegativníkonstrukcíí6fosfofrukto2kínazifruktozo26bísfosfatazi3ta4lûdinivplivnaekspresíûendogennihmrnk6fosfofrukto2kínazifruktozo26bísfosfataz
AT minchenkooh domínantnegativníkonstrukcíí6fosfofrukto2kínazifruktozo26bísfosfatazi3ta4lûdinivplivnaekspresíûendogennihmrnk6fosfofrukto2kínazifruktozo26bísfosfataz
AT minchenkodo dominantnegativnyekonstrukcii6fosfofrukto2kinazyfruktozo26bisfosfatazy3i4čelovekavliânienaékspressiûéndogennyhmrnk6fosfofrukto2kinazyfruktozo26bisfosfataz
AT bobarykinaay dominantnegativnyekonstrukcii6fosfofrukto2kinazyfruktozo26bisfosfatazy3i4čelovekavliânienaékspressiûéndogennyhmrnk6fosfofrukto2kinazyfruktozo26bisfosfataz
AT ratushnaoo dominantnegativnyekonstrukcii6fosfofrukto2kinazyfruktozo26bisfosfatazy3i4čelovekavliânienaékspressiûéndogennyhmrnk6fosfofrukto2kinazyfruktozo26bisfosfataz
AT marunychry dominantnegativnyekonstrukcii6fosfofrukto2kinazyfruktozo26bisfosfatazy3i4čelovekavliânienaékspressiûéndogennyhmrnk6fosfofrukto2kinazyfruktozo26bisfosfataz
AT tsuchiharak dominantnegativnyekonstrukcii6fosfofrukto2kinazyfruktozo26bisfosfatazy3i4čelovekavliânienaékspressiûéndogennyhmrnk6fosfofrukto2kinazyfruktozo26bisfosfataz
AT moennerm dominantnegativnyekonstrukcii6fosfofrukto2kinazyfruktozo26bisfosfatazy3i4čelovekavliânienaékspressiûéndogennyhmrnk6fosfofrukto2kinazyfruktozo26bisfosfataz
AT caroj dominantnegativnyekonstrukcii6fosfofrukto2kinazyfruktozo26bisfosfatazy3i4čelovekavliânienaékspressiûéndogennyhmrnk6fosfofrukto2kinazyfruktozo26bisfosfataz
AT esumih dominantnegativnyekonstrukcii6fosfofrukto2kinazyfruktozo26bisfosfatazy3i4čelovekavliânienaékspressiûéndogennyhmrnk6fosfofrukto2kinazyfruktozo26bisfosfataz
AT minchenkooh dominantnegativnyekonstrukcii6fosfofrukto2kinazyfruktozo26bisfosfatazy3i4čelovekavliânienaékspressiûéndogennyhmrnk6fosfofrukto2kinazyfruktozo26bisfosfataz