Creation of cellular models for the analysis of sodium-dependent phosphate transporter NaPi2b, a potential marker for ovarian cancer
The aim of present study was to develop a model for a functional analysis of a recently identified marker of the ovarian cancer - sodium-dependent phosphate transporter NaPi2b. For this purpose, we have created HEK293 stable cell lines expressing wild type or mutant forms of NaPi2b (T330V substituti...
Збережено в:
| Дата: | 2009 |
|---|---|
| Автори: | , , , |
| Формат: | Стаття |
| Мова: | Англійська |
| Опубліковано: |
Інститут молекулярної біології і генетики НАН України
2009
|
| Теми: | |
| Онлайн доступ: | https://nasplib.isofts.kiev.ua/handle/123456789/5651 |
| Теги: |
Додати тег
Немає тегів, Будьте першим, хто поставить тег для цього запису!
|
| Назва журналу: | Digital Library of Periodicals of National Academy of Sciences of Ukraine |
| Цитувати: | Creation of cellular models for the analysis of sodium-dependent phosphate transporter NaPi2b, a potential marker for ovarian cancer / V.S. Gryshkova, D.S. Lituyev, V.V. Filonenko, R.G. Kiyamova // Біополімери і клітина. — 2009. — Т. 25, № 2. — С. 95-100. — Бібліогр.: 23 назв. — англ. |
Репозитарії
Digital Library of Periodicals of National Academy of Sciences of Ukraine| _version_ | 1860127725549780992 |
|---|---|
| author | Gryshkova, V.S. Lituyev, D.S. Filonenko, V.V. Kiyamova, R.G. |
| author_facet | Gryshkova, V.S. Lituyev, D.S. Filonenko, V.V. Kiyamova, R.G. |
| citation_txt | Creation of cellular models for the analysis of sodium-dependent phosphate transporter NaPi2b, a potential marker for ovarian cancer / V.S. Gryshkova, D.S. Lituyev, V.V. Filonenko, R.G. Kiyamova // Біополімери і клітина. — 2009. — Т. 25, № 2. — С. 95-100. — Бібліогр.: 23 назв. — англ. |
| collection | DSpace DC |
| description | The aim of present study was to develop a model for a functional analysis of a recently identified marker of the ovarian cancer - sodium-dependent phosphate transporter NaPi2b. For this purpose, we have created HEK293 stable cell lines expressing wild type or mutant forms of NaPi2b (T330V substitution in a large extracellular loop and a 6 amino acid residues deletion in the C-terminal cytoplasmic tail), revealed in the ovarian cancer cell lines. The expression of wild type and mutant forms NaPi2b in the stable cell lines created was confirmed by Western-blot analysis with monoclonal antibodies against NaPi2b. The cellular models described here will be useful for studying the function of sodium-dependent phosphate transporter NaPi2b in health and disease.
|
| first_indexed | 2025-12-07T17:42:11Z |
| format | Article |
| fulltext |
ÑÒÐÓÊÒÓÐÀ ² ÔÓÍÊÖ²¯ Á²ÎÏÎ˲ÌÅвÂ
Creation of cellular models for the analysis of
sodium-dependent phosphate transporter NaPi2b,
a potential marker for ovarian cancer
V. S. Gryshkova, D. S. Lituyev, V. V. Filonenko, R. G. Kiyamova
In sti tute of Mo lec u lar Bi ol ogy abd Ge net ics, Na tional Acad emy of Sci ences of Ukraine
150 Ac a de mi cian Zabolotnogo str., Kyiv, Ukraine, 03680
v.v.filonenko@imbg.org.ua
The aim of present study was to develop a model for a functional analysis of a recently identified marker of
the ovarian cancer – sodium-dependent phosphate transporter NaPi2b. For this purpose, we have created
HEK293 stable cell lines expressing wild type or mutant forms of NaPi2b (T330V substitution in a large
extracellular loop and a 6 amino acid residues deletion in the C-terminal cytoplasmic tail), revealed in the
ovarian cancer cell lines. The expression of wild type and mutant forms NaPi2b in the stable cell lines
created was confirmed by Western-blot analysis with monoclonal antibodies against NaPi2b. The cellular
models described here will be useful for studying the function of sodium-dependent phosphate transporter
NaPi2b in health and disease.
Keywords: so dium-de pend ent phos phate trans porter NaPi2b, mu ta tion, anti-NaPi2b MAb.
In tro duc tion. Ep i the lial ovar ian can cer (EOC) is one
of the lead ing causes of can cer-re lated death in women
and the lead ing cause of gynecologic can cer death. The
lack of spe cific mark ers for EOC makes it dif fi cult to
achieve the clin i cal ob jec tive for early de tec tion and
therapy. Thus, the iden ti fi ca tion and char ac ter iza tion
of novel ovar ian can cer mark ers is cru cial for the deve-
lopment of novel di ag nos tic and immunotherapeutic
ap proaches in gynecologic on col ogy and for understa-
nding the molecular mechanisms of malignant growth.
The re cent find ings sug gest that the so dium-de -
pend ent phos phate trans porter NaPi2b could be consi-
dered as a po ten tial pro spec tive marker of ovar ian can -
cer. Firstly, NaPi2b is overexpressed in ovar ian can cer
in com par i son to nor mal tis sues and other types of can -
cer [1]. Sec ondly, NaPi2b was re cently iden ti fied as
MX35 can cer an ti gen by two in de pend ent ap proaches:
a) screen ing of ovar ian can cer cell line OVCAR3
cDNA ex pres sion li brary with monoclonal an ti body
MX35; and b) af fin ity pu ri fi ca tion of MX35 an ti gen
fol lowed by mass spec trom e try anal y sis [2]. MX35
MAb was gen er ated more than 20 years ago at Me mo -
rial Sloan-Kettering Can cer Cen ter by im mu niz ing
mice with fresh ovar ian car ci noma cells and screen ing
gen er ated hybridomas with a panel of ovar ian can cer
cell lines [3].
Fur ther stud ies showed that MX35 an ti gen is ex -
pressed at high level inapproximately 90 % of hu man
ovar ian ep i the lial can cers, which cre ated the base for
us ing hu man ized MX35 MAb in early phase clin i cal
tri als [3, 4]. In nor mal tis sues, the ex pres sion of so -
dium-de pend ent phos phate trans porter 2b at the pro tein
level is restricted to small intestine [5], lung [6], liver
[7], mammary and salivary glands [8, 9].
The hu man so dium-de pend ent phos phate trans -
porter NaPi2b is en coded by SLC34A2 gene which be -
95
ISSN 0233-7657. Á³îïîë³ìåðè ³ êë³òèíà. 2009. Ò. 25. ¹ 2
Ó ²íñòè òóò ìî ëå êó ëÿð íî¿ á³îëî㳿 ³ ãå íå òè êè ÍÀÍ Óêðà¿ íè, 2009
longs to type II fam ily of so dium-de pend ent phos phate
trans port ers (SLC34 fam ily). It is in volved in reg u lat -
ing ho meo sta sis of in or ganic phos phate in hu man body
by in tes ti nal Pi ab sorp tion, whereas ho mol o gous so -
dium-de pend ent phos phate cotransporter NaPi2a is
crit i cal for re nal Pi re ab sorp tion [10].
NaPi2b is a transmembrane pro tein with mo lec u lar
weight in 76–110 kDa range de pend ing on the state of
glycosylation [6–9, 11, 12]. It is pre dicted to be an -
chored to the plasma mem brane through at least 8
highly hy dro pho bic a-he li cal re gions [13]. It has been
pre vi ously pro posed that NaPi2b pos sesses a large
extracellular loop (188–360 aa), 8 transmembrane do -
mains and the N-and C-therminal cy to plas mic tails.
The larg est extracellular loop con tains sev eral po ten tial
sites of glycosylation and a re gion rich in cysteine res i -
dues, which might be in volved in disulfide bond for ma -
tion [2].
We have re cently de scribed the pro duc tion of seve-
ral monoclonal an ti bod ies di rected against NaPi2b
extracellular loop (188–360 aa) and nar rowed down
their epitopes be tween amino res i dues 311 and 340
[14]. These an ti bod ies might have a ther a peu tic value,
since NaPi2b is a mem brane protein and is overexp-
ressed in ovarian cancer.
The re cent stud ies pro vided the ev i dence that
mutatiîns in SLC34A2 gene are as so ci ated with
pulmonary alveolar microlithiasis (PAM) which is
char ac ter ized by the de po si tion of cal cium phos phate
micro liths in lungs [15]. To date, there are no data
which could link mutations in SLC34A2 gene to ma-
lignant transformation.
In this study we de scribe two mu ta tions in NaPi2b
gene that could be po ten tially as so ci ated with ovar ian
can cer: T330V in a large extracellular loop and a 6 aa
de le tion in the C-ter mi nal end of trans porter. These
mu ta tions, as well as oth ers were iden ti fied by
bioinformatic anal y sis of NaPi2b se quences in var i ous
DNA data bases. Fur ther more, we have cre ated ex pres -
sion con structs of wild type and mu tant forms of
NaPi2b suit able for mak ing sta ble cell lines. High level
of ex pres sion of wild type and mu tant forms of NaPi2b
in es tab lished HEK293 sta ble cell lines was con firmed
by West ern-blot anal y sis. Gen er ated cell lines will be
used to study the reg u la tion of NaPi2b un der var i ous
ex per i men tal con di tions, such as mitogenic stim u la -
tion, treat ment of cells with sig nal transduction
inhibitors, exposure to cellular stresses etc.
Ma te rial and Meth ods. Bioinformatic approa-
ches. GeneBank data bases were searched for po ten tial
mutations in so dium-de pend ent cotransporter NaPi2b.
CLUSTALW (1.82) pro gram (www.ebi.ac.uk/clus
talw/) was used for mul ti ple se quence align ment of dif -
fer ent EST clones cor re spond ing to NaPi2b.
Clon ing of wild type NaPi2b into pcDNA3.1. The
full length cDNA clone of hu man NaPi2b
(NaPi2b_WT) was am pli fied from the orig i nal clone
DKFZp6860655Q2 (re ceived from RZPD gene bank)
with prim ers con tain ing clon ing sites and se quences for
the EE-tag (Ta ble). The am pli fied cDNA frag ment was
then li gated into mam ma lian ex pres sion vec tor
pcDNA3.1+ (Invitrogen, USA) that al lows the ex pres -
sion of cloned cDNA in mam ma lian cells un der the
con trol of the CMV pro moter. Gen er ated cDNA
plasmids were con firmed by re stric tion anal y sis and
DNA se quenc ing. Plasmid DNA used in sub se quent
stud ies was pu ri fied by DNA pu ri fi ca tion kit
(Promega, USA).
96
GRYSHKOVA V. S. ET AL.
Transporter Primer
FNaPi2b_WT AGTGGATCCATGGCTCCCTGGCCTGA
RNaPi2b_WT CGGAATTCCTACTCCATCGGCATGAACTCCATCAAGGCCGTGCATTCGGTCT
FNaPi2b_del6 GCC GAA GAA ACT CCA GAA CTG GAT GCG CTC GCT GAA GCC CTG GG
RNaPi2b_del6 CCC AGG GCT TCA GCG AGC GCA TCC AGT TCT GGA GTT TCT TCG GC
FNaPi2b_T330V CTC CCC TTC CCT CTG TTG GGT GGA TGG CAT CCA AAA CTG GAC
RNaPi2b_T330V GTC CAG TTT TGG ATG CCA TCC ACC CAA CAG AGG GAA GGG GAG
Oligonucleotide primers used for cloning and site-directed mutagenesis
Site-di rected mu ta gen e sis. 20 ng of the pcDNA3.1/
NaPi2b plasmid was am pli fied with 2.5 U of Pfu DNA
poly mer ase in the pres ence of over lap ping prim ers for
mu ta gen e sis (9 pmol of each). The prim ers con tained a
mu ta tion (ac 988 gt for T330V and del1768–1785 nt
for del6aa, see Ta ble) in the mid dle of the se quence.
PCR am pli fi ca tion was per formed in 50 ml with 18–22
ther mal cy cles (95 oC for 30 s, 55 oC for 1 min and 68 oC
for 16 min). Am pli fied DNA was pre cip i tated,
redissolved in 15 ml of wa ter and then the pa ren tal
dam-meth yl ated DNA was di gested with 10 U of DpnI
for 1 h at 37 oC. 100 ml of XL1-Blue ultracompetent
cells were trans formed with 4 ml of the re ac tion mix -
ture, grown for 45 min in SOC me dium and plated onto
LB-ampicillin plates. Plasmid DNA was pu ri fied by
DNA pu ri fi ca tion kit (Promega, USA). Gen er ated mu -
ta tions were ver i fied by se quenc ing anal y sis.
Pro duc tion of sta ble HEK293 cells. Ini tially, the
pro duced DNA con structs were linearized with ScaI re -
stric tion en zyme (Fermentas, Lith u a nia) ac cord ing to
the man u fac turer’s rec om men da tions. Transfection of
HEK293 cells with FuGene (Roche, Swit zer land) was
per formed in 6 cm plates when cell den sity reached
60–70 %. 5 mg of each plasmid DNA (pcDNA3.1/
NaPi2b-WT, pcDNA3.1/NaPi2b-T330V, pcDNA3.1/
NaPi2b-D6 aa or empty vec tor) was mixed with 500 ml
of stan dard DMEM me dium. FuGene re agent (10 ml)
was added to each sam ple and in cu bated at room tem -
per a ture for 10 min be fore the ad di tion to cells. Af ter
24 h in cu ba tion, the me dium was re placed with com -
plete DMEM me dium (10 % FBS, 1 mM Glutamine,
pen i cil lin (50 U/ml)/strep to my cin (0,25 mg/ml) an ti bi -
ot ics). Af ter 48 h, the me dium was re placed with com -
plete DMEM me dium con tain ing 1mg/ml G418 an ti bi -
otic (Gibco, USA).
Transfected cells were cul tured in the pres ence of
G418 for 7–10 days in or der to elim i nate nontrans-
fected cells. The gen er ated sta ble cell lines were cul -
tured in the pres ence of G418.
Cell lysis and West ern-blot anal y sis. Stably
transfected HEK293 cells were lysed in buffer con tain -
ing 10 mM Tris-HCl, pH 7.5, 150 mM NaCl, 10 mM
MgCl2, 0,5 % NP-40, and a mix ture of Halt Pro te ase
In hib i tor Cock tail (Pierce, USA). Pro tein con cen tra -
tion was mea sured by Brad ford as say (Pierce, USA),
and equal amounts of pro teins (10 mg) were sep a rated
in 8 % SDS-PAGE and blot ted to polyvinylidene
difluoride (PVDF) mem brane (Millipore, USA). The
mem brane was blocked with 3 % BSA in PBS (phos -
phate-sa line buffer) con tain ing 0,1 % Tween-20
(PBST) for 1 h. Anti-NaPi2b and anti-EE-tag anti-
bod ies were in cu bated with mem branes at 4 °C over -
night. Gen er a tion of monoclonal an ti bod ies against the
extracellular loop of trans porter was pre vi ously de -
scribed [5]. Af ter wash ing with PBST, HRP-con ju -
gated goat anti-mouse lgG 1:5000 (Promega, USA)
was added to the mem brane for 1 h at RT. West ern
blots were de vel oped us ing the ECL sys tem (Amer-
sham, Swe den) and then ex posed to Agfa X-ray film.
Re sults and Dis cus sion. We have re cently iden ti -
fied so dium-de pend ent phos phate cotransporter
NaPi2b as MX35 an ti gen which is overexpressed in
90 % cases of hu man ep i the lial ovar ian can cer [2, 3]. In
nor mal cells, NaPi2b me di ates the trans-ep i the lial
efflux of in or ganic phos phate and so dium ions across
the api cal mem brane of entherocytes in small in tes tine
and plays an im por tant role in the main te nance of phos -
phate ho meo sta sis in hu man body [16]. NaPi2b is also
ex pressed on the api cal sur face of ep i the lial cells in
other or gans to pro vide an ap pro pri ate in or ganic phos -
phate level in al ve o lar surfactant [6], bile [7], sa liva [9],
and epididymal fluid [11]. No ta bly, NaPi2b is ex -
pressed at a very low level in nor mal ovary, in con trary
to the high ex pres sion in ep i the lial ovar ian can cer [1,
5]. So far, the ra tio nale for high level ex pres sion of
NaPi2b trans porter in ovar ian can cer is not clear. This
might re flect the in creased de mand in can cer cells for
in or ganic phos phate which is re quired for biosynthetic
pro cesses and sig nal transduction. The func tion of
phos phate trans porter is known to be reg u lated by di -
verse extracellular stim uli, in clud ing FGF 23, EGF,
glucocorticoids, vi ta min D and estrogens [17–21].
There fore, de reg u la tion of sig nal ing path ways in duced
by oncogenic trans for ma tion may lead to the aug men -
ta tion of nu tri ents up take through the in creased ex pres -
sion of trans port ers at the level of tran scrip tion and
trans la tion.
We have per formed de tailed bioinformatic anal y sis
of po ten tial mu ta tions in SLC34A2 gene in avail able
da ta bases and com posed the map of se quence vari a -
tions in hu man NaPi2b se quence (data not shown).
This study al lowed us to iden tify 15 dif fer ences in the
97
CREATION OF MODELS FOR THE ANALYSIS OF SODIUM-DEPENDENT PHOSPHATE TRANSPORTER NaPi2b
cod ing se quence of hu man NaPi2b: seven of them were
found in genomic DNA of the pa tients suf fer ing from
pul mo nary al ve o lar microlithiasis; one in genomic
DNA of a pa tient with testicular microlithiasis; three in
cDNA clones from ovar ian can cer cell lines and four
from ap par ently nor mal tis sues.
Bioinformatic anal y sis of NaPi2b se quences from
ovar ian can cer cell lines re vealed three mu ta tions po -
ten tially as so ci ated with ovar ian can cer: a) sin gle
amino acid sub sti tu tion T330V in a large extracellular
loop; b) 6 aa de le tion (591–596 aa); and c) 56 aa de le -
tion (461–519 aa) in C-ter mi nus of transporter (Fig. 1,
see inset).
A point mu ta tion T330V is lo cated in a large
extracellular loop of NaPi2b pro tein and there fore
could in flu ence an ti genic prop er ties of trans porter.
Corut et al. have de scribed T330M sub sti tu tion in
NaPi2b and have in di cated that this mu ta tion might in -
ac ti vate NaPi2b trans porter due to the sub sti tu tion of
po lar res i due to non-po lar one [15]. So, this po si tion
may rep re sent a hot spot of mu ta tion in NaPi2b, espe-
cially in ovarian cancer.
The iden ti fied de le tions in NaPi2b are lo cated in
the C-ter mi nus tail – this re gion of the phos phate trans -
porter is pos si bly re spon si ble for the in ter ac tion with
bind ing part ners im pli cated in the reg u la tion of cel lu lar
lo cal iza tion and func tion sim i larly to NaPi2a [22]. A 6
aa de le tion is flanked by short di rect re peats, which
might be in volved in the mech a nism of mu ta gen e sis by
rep li ca tion slip page [23], site-spe cific re com bi na tion
and oth ers. We pro pose that these mu ta tions may ex ist
in ovar ian can cer and may influence NaPi2b cellular
localization and function.
We have cre ated mu tant cDNA con structs of
NaPi2b with a point mu ta tion T330V and a 6aa de le tion
of 591 … 596 aa by site-di rected mu ta gen e sis. Un for -
tu nately, we were not suc cess ful in mak ing a 59 aa de -
le tion mu tant in mam ma lian ex pres sion plasmid. Clon -
ing of wild type NaPi2b in frame with the N-ter mi nally
lo cated EE-tag epitope into pcDNA3.1 vec tor was per -
formed as de scribed in Ma te ri als and Meth ods. All ge-
nerated con structs were linearized and used for sta ble
transfection of HEK293 cells. Af ter 7–10 days se lec -
tion of transfected cells on geneticin con tain ing me -
dium we have se lected col o nies for test ing NaPi2b ex -
pres sion.
The ex pres sion of NaPi2b (wild type and mu tant
forms) in HEK293 was con firmed by West ern-blot
anal y sis of to tal cell lysates with anti-EE monoclonal
an ti body (Fig. 2, A) or anti-NaPi2b monoclonal an ti -
bod ies (Fig. 2, B). Fur ther more, we found that
anti-NaPi2b MAb gen er ated against the extracellular
loop of trans porter L2 (20/3) spe cif i cally re cog nises
wild type and a 6 aa de le tion mu tant, but does not de tect
the NaPi2b mu tant car ry ing sub sti tu tion T330V in the
extracellular loop of NaPi2b lo cated within a re gion of
epitope for L2 (20/3) MAb (311–340 aa). These data
clearly in di cate that T330V sub sti tu tion of hy dro philic
to nonpolar amino acid could be cru cial for the epitope
rec og ni tion by L2 (20/3) MAb. It should be no ticed that
the MX35 epitope is also lo cated in the same re gion of
the large extracellular loop [2] and MX35 MAb does
98
GRYSHKOVA V. S. ET AL.
Fig. 1. Schematic representation of NaPi2b
domain organization and the location of T330V
substitution, 59 and 6 amino acids deletions: Ñ –
cysteine residue; � – deletion of 461 ... 519 amino
acids (59 amino acids in C-terminus); l – T330V
substitution; m – deletion of 591 ... 596 amino
acids (6 amino acids in C-terminus)
not de tect NaPi2b mu tant car ry ing sub sti tu tion T330V
as well (data not shown).
Con clu sions. We have cre ated sta ble cell lines ex -
press ing wild-type and mu tant forms of NaPi2b phos -
phate trans porter and have shown that T330V mu ta tion
in the extracellular loop is not rec og nized by
anti-NaPi2b L2 (20/3) MAb by West ern-blot anal y sis
that could be ex plained by the de struc tion of the
epitope for these an ti bod ies.
The gen er ated sta ble cell lines will be used for the
fur ther anal y sis of phos phate trans porter NaPi2b in
nor mal and trans formed cells. We are plan ning to in -
ves ti gate the im pact of gen er ated mu ta tions on the
phos phate trans port func tion and cel lu lar pro cesses,
such as DNA biosynthesis, growth and proliferation.
The gen er ated sta ble cell lines will be avail able for
re search ers elu ci dat ing the func tion of NaPi2b trans -
porter and those who are study ing the in or ganic phos -
phate ho meo sta sis un der nor mal and patho log i cal
conditions.
Acknowledgements. This study was supported in
part by grant from the National Academy of Sciences
of Ukraine and the Kerr Program, the Ludwig Institute
for Cancer Research. V. Gryshkova was supported by a
short-term fellowship from UICC (ICRETT No
ICR/07/030) to perform this work at University
College London (UCL), United Kingdom. Authors
would like to thank Prof. I. Gout for reading of the
manuscript and critical comments.
Â. Ñ. Ãðèø êî âà, Ä. Ñ. ˳òóºâ, Â. Â. Ô³ëî íåí êî, Ð. Ã. ʳÿìî âà
Ñòâî ðåí íÿ êë³òèí íèõ ìî äå ëåé äëÿ àíàë³çó Na-çà ëåæ íî ãî
ôîñ ôàò íî ãî òðàíñ ïîð òåða NaPi2b – ïî òåíö³éíî ãî ìàð êåða
ðàêy ÿº÷íèê³â
Ðå çþ ìå
Ìåòà ðî áî òè ïî ëÿ ãà ëà ó ñòâî ðåíí³ êë³òèí íî¿ ìî äåë³ äëÿ
ôóíêö³îíàëü íî ãî àíàë³çó Na-çà ëåæ íî ãî ôîñ ôàò íî ãî òðàíñ -
ïîð òå ðà NaPi2b, íå ùî äàâ íî ³äåí òèô³êî âà íî ãî ÿê ìàð êåð ðàêó
ÿº÷íèê³â. Îòðè ìàíî ñòàá³ëüí³ êë³òèíí³ ë³í³¿ HEK293, ÿê³
åêñïðå ñó þòü äè êèé òèï, òà ìó òàíòí³ ôîð ìè NaPi2b (òî÷ êî âà
çàì³íà T330V ó âå ëè êî ìó ïî çàêë³òèí íî ìó äî ìåí³ òà äå ëåö³ÿ
øåñòè àì³íî êèñ ëîò íèõ çà ëèøê³â íà Ñ-ê³íö³ òðàíñ ïîð òå ðà),
âè ÿâ ëåí³ â êë³òèí íèõ ë³í³ÿõ ðàêó ÿº÷íè êà. Åêñïðåñ³þ äè êî ãî
òèïó òà ìó òàí òíèõ ôîðì NaPi2b ó còàá³ëüíèõ êë³òèí íèõ
ë³í³ÿõ ï³äòâåð äæå íî Âåñ òåðí-áëîò-àíàë³çîì çà äî ïî ìî ãîþ
ìî íîê ëî íàëü íèõ àí òèò³ë ïðî òè NaPi2b. Îïè ñàí³ êë³òèíí³ ìî -
äåë³ ìîæ íà âè êî ðèñ òî âó âà òè äëÿ âèâ ÷åí íÿ ôóíêö³é òðàíñ ïîð -
òå ðà NaPi2b çà íîð ìè òà ïà òî ëî㳿.
Êëþ ÷îâ³ ñëî âà: Na-çà ëåæ íèé ôîñ ôàò íèé òðàíñ ïîð òåð
NaPi2b, ìó òàö³ÿ, ìî íîê ëî íàëüí³ àí òèò³ëà ïðî òè NaPi2b.
Â. Ñ. Ãðèø êî âà, Ä. Ñ. Ëè òó åâ, Â. Â. Ôè ëî íåí êî, Ð. Ã. Êè ÿ ìî âà
Ñîç äà íèå êëå òî÷ íûõ ìî äå ëåé äëÿ àíà ëè çà Na-çà âè ñè ìî ãî
ôîñ ôàò íî ãî òðàíñ ïîð òå ðà NaPi2b – ïî òåí öè àëü íî ãî ìàð êå ðà
ðàêà ÿè÷ íè êîâ
Ðå çþ ìå
Öåëü ðà áî òû ñî ñòî ÿ ëà â ñî çäà íèè ìî äå ëè äëÿ ôóíê öè î íàëü íî -
ãî àíà ëè çà Na-çà âè ñè ìî ãî ôîñ ôàò íî ãî òðàíñ ïîð òå ðà NaPi2b,
íå äàâ íî èäåí òè ôè öè ðî âàí íî ãî êàê ìàð êåð ðàêà ÿè÷ íè êîâ. Ïî -
ëó ÷å íû ñòà áèëü íûå êëå òî÷ íûå ëè íèè HEK293, ýêñ ïðåñ ñè ðó þ -
ùèå äè êèé òèï, è ìó òàí òíûå ôîð ìû NaPi2b (òî ÷å÷ íàÿ çà ìå íà
T330V â áîëü øîì âíåê ëå òî÷ íîì äî ìå íå è äå ëå öèÿ øåñòè àìè -
íî êèñ ëîò íûõ îñòàò êîâ íà Ñ-êîí öå òðàíñ ïîð òå ðà), âû ÿâ ëåí -
íûå â êëå òî÷ íûõ ëè íè ÿõ ðàêà ÿè÷ íè êà. Åêñïðåñ ñèÿ äè êî ãî òèïà
è ìó òàí òíûõ ôîðì NaPi2b â ñòà áèëü íûõ êëå òî÷ íûõ ëè íè ÿõ
ïîä òâåð æäå íà Âåñ òåðí-áëîò-àíà ëè çîì ñ ïî ìîùüþ ìî íîê ëî -
íàëü íûõ àíòè-NaPi2b àí òè òåë. Îïè ñàí íûå êëåòî÷íûå ìîäåëè
ìîæíà èñïîëüçîâàòü äëÿ èçó÷åíèÿ ôóíêöèé òðàíñïîðòåðà
NaPi2b â íîðìå è ïðè ïàòîëîãèè.
Êëþ ÷å âûå ñëî âà: Na-çà âè ñè ìûé ôîñ ôàò íûé òðàíñ ïîð òåð
NaPi2b, ìó òà öèÿ, ìî íîê ëî íàëü íûå àíòè-NaPi2b àí òè òå ëà.
99
CREATION OF MODELS FOR THE ANALYSIS OF SODIUM-DEPENDENT PHOSPHATE TRANSPORTER NaPi2b
Fig. 2. Expression of wild type and mutant forms of NaPi2b in stably
transfected HEK293 cells. WB analysis of HEK293 cells lysates
with: A – anti-EE-tag antibody; B – anti-NaPi2b antibody (L2(20/3);
C – anti-GAPDH antibody. HEK293 cells transfected with
pcDNA3.1/NaPi2b-WT (1); pcDNA3.1/NaPi2b-D6 aa (2);
pcDNA3.1/NaPi2b-T330V (3) and pcDNA3.1 (4)
REFERENCES
1. Rangel L. B., Sherman-Baust C. A., Wernyj R. P., Schwartz D.
R., Cho K. R., Morin P. J. Characterization of novel human
ovarian cancer-specific transcripts (HOSTs) identified by
serial analysis of gene expression // Oncogene.–2003.–22,
N 46.–P. 7225–7232.
2. Yin B. W. T., Kiyamova R., Chua R., Caballero O. L., Gout I.,
Gryshkova V., Bhaskaran N., Souchelnytskyi S., Hellman U.,
Filonenko V., Jungbluth A. A., Odunsi K., Lloyd K. O., Old L.
J., Ritter G. Monoclonal antibody MX35 detects the
membrane transporter NaPi2b (SLC34A2) in human carci-
nomas; a new target for cancer immunotherapy // Cancer
Immun. [serial online].–2008.–8, N 3.–URL: http://www.
cancerimmunity.org/v8p3/080103.htm.
3. Mattes M. J., Look K., Furukawa K., Pierce V. K., Old L. J.,
Lewis J. L., Lloyd K. O. Mouse monoclonal antibodies to hu-
man epithelial differentiation antigens expressed on the sur-
face of ovarian carcinoma ascites cells // Cancer Res.–1987.–
47, 24, pt 1.–P. 6741–6750.
4. Rubin S. C., Kostakoglu L., Divgi C., Federici M. G., Finstad
C. L., Lloyd K. O., Larson S. M., Hoskins W. J. Biodistri-
bution and intraoperative evaluation of radiolabeled mono-
clonal antibody MX35 in patients with epithelial ovarian
cancer // Gynecol. Oncol.–1993.–51, N 1.–P. 61–66.
5. Feild J. A., Zhang L., Brun K. A., Brooks D. P., Edwards R.
M. Cloning and functional characterization of a sodium-
dependent phosphate transporter expressed in human lung
and small intestine // Biochem. and Biophys. Res. Com-
muns.–1999.–258, N 3.–P. 78–82.
6. Traebert M., Hattenhauer O., Murer H., Kaissling B., Biber
J. Expression of a type II sodium-phosphate cotransporter in
murine type II alveolar epithelial cells // Amer. J. Physiol.–
1999.– 277, N 5, pt 1.–P. L868–L873.
7. Frei P., Gao B., Hagenbuch B., Mate A., Biber J., Murer H.,
Meier P. J., Stieger B. Identification and localization of so-
dium-phosphate cotransporters in hepatocytes and cholan-
giocytes of rat liver // Amer. J. Physiol. Gastrointest. Liver
Physiol.–2005.–288, N 4.–P. G771–G778.
8. Huber K., Muscher A., Breves G. Sodium-dependent phos-
phate transport across the apical membrane of alveolar epi-
thelium in caprine mammary gland // Comparative Bio-
chem. and Physiol.– 2007.–146.–P. 215–222.
9. Homann V., Rosin-Steiner S., Stratmann T., Arnold T., Gaen-
gler P., Kinne R. K. Sodium-phosphate cotransporter in hu-
man salivary glands: molecular evidence for the involvement
of NPT2b in acinar phosphate secretion and ductal phosphate
reabsorption // Arch. Oral Biol.–2005.–50, N 9.–P. 759–768.
10. Murer H., Forster I., Biber J. The sodium phosphate co-
transporter family SLC34 // Pflugers Arch. – Eur. J. Physiol.–
2004.–447, N 10.–P. 763–767.
11. Xu Y., Yeung C.-H., Setiawan I., Avram C., Biber J., Wagen-
feld A., Lang F., Cooper T. G. Sodium-inorganic phosphate
cotransporter NaPi2b in the epididymis and its potential role
in male fertility studied in a transgenic mouse model // Biol.
Reprod.–2003.–69, N 4.–P. 1135–1141.
12. Lundquist P., Murer H., Biber J. Type II Na+-P cotransporters
in osteoblast mineral formation; regulation by inorganic
phosphate // Cell. Physiol. Biochem.–2007.–19, N 1–4.–
P. 43–56.
13. Hilfiker H., Hattenhauer O., Traebert M., Forster I., Murer
H., Biber J. Characterization of a new murine type II so-
dium-phosphate cotransporter expressed in mammalian small
intestine // Proc. Nat. Acad. Sci. USA.–1998.–95, N 24.–
P. 14564–14569.
14. Kiyamova R., Gryshkova V., Ovcharenko G., Lituyev D.,
Malyuchik S., Usenko V., Khozhayenko Yu., Gurtovyy V., Yin
B., Ritter G., Old L., Filonenko V., Gout I. Development of
monoclonal antibodies specific for the human sodium-
dependent phosphate cotransporter NaPi2b // Hybridoma.–
2008.–27, N 4.– P. 277–284.
15. Corut A., Senyigit A., Ugur S. A., Altin S., Ozcelik U., Calisir
H., Yildirim Z., Gocmen A., Tolun A. Mutations in SLC34A2
cause pulmonary alveolar microlithiasis and are possibly
associated with testicular microlithiasis // Amer. J. Hum.
Genet.–2006.–79, N 4.–P. 650–656.
16. Murer H., Hernando N., Forster I., Biber J. Molecular
mechanisms in proximal tubular and small intestinal
phosphate // Mol. Membrane Biol.–2001.–18, N 1.–P. 3–11.
17. Miyamoto K., Ito M., Kuwahata M., Kato S., Segawa H. Inhi-
bition of intestinal sodium-dependent inorganic phosphate
transport by fibroblast growth factor 23 // Ther. Apher. Dial.–
2005.–9, N 4.–P. 331–335.
18. Xu H., Collins J., Bai L., Kiela P., Ghishan F. Regulation of
the human sodium-phosphate cotransporter NaPi2b gene
promoter by epidermal growth factor // Amer. J. Physiol.–
2001.–280, N 3.–P. C628–C636.
19. Arima K., Hines E.R., Kiela P.R., Drees J.B., Collins J.F.,
Ghishan F.K. Glucocorticoid regulation and glycosylation of
mouse intestinal type llb Na-Pi cotransporter during onto-
geny // Amer. J. Physiol.–2002.–283, N 2.–P. G426–G434.
20. Katai K., Miyamoto K., Kishida S., Segawa H., Nii T., Tanaka
H., Tani Y., Arai H., Tatsumi S., Morita K., Taketani Y.,
Takeda E. Regulation of intestinal Na+-dependent phosphate
co-transporters by a low-phosphate diet and 1,25-dihydroxy-
vitamin D3 // Biochem. J.–1999.–343, pt 3.–P. 705–712.
21. Xu H., Uno J. K., Inouye M., Xu L., Drees J. B., Collins J. F.,
Ghishan F. K. Regulation of intestinal NaPi2b cotransporter
gene expression by estrogen // Amer. J. Physiol. Gastrointest.
Liver Physiol.–2003.–285, N 6.–P. G1317–G1324.
22. Lanaspa M. A., Giral H., Breusegem S. Y., Halaihel N., Baile
G., Catalan J., Carrodeguas J. A., Barry N. P., Levi M., Sor-
ribas V. Interaction of MAP17 with NHERF3/4 induces
translocation of the renal Na/Pi IIa transporter to the trans-
Golgi // Amer. J. Physiol. Renal Physiol.–2007.–292, N 1.–
P. 230–242.
23. Ball E. V., Stenson P. D., Abeysinghe S. S. Microdeletions
and microinsertions causing human genetic disease common
mechanisms of mutagenesis and the role of local DNA
sequence complexity // Hum. Mutat.–2005.–26, N 3.–P. 205–
213.
ÓÄÊ 577.2, 577.27
Íàä³éøëà äî ðåäàêö³¿ 17.10.08
100
GRYSHKOVA V. S. ET AL.
|
| id | nasplib_isofts_kiev_ua-123456789-5651 |
| institution | Digital Library of Periodicals of National Academy of Sciences of Ukraine |
| issn | 0233-7657 |
| language | English |
| last_indexed | 2025-12-07T17:42:11Z |
| publishDate | 2009 |
| publisher | Інститут молекулярної біології і генетики НАН України |
| record_format | dspace |
| spelling | Gryshkova, V.S. Lituyev, D.S. Filonenko, V.V. Kiyamova, R.G. 2010-02-01T14:19:49Z 2010-02-01T14:19:49Z 2009 Creation of cellular models for the analysis of sodium-dependent phosphate transporter NaPi2b, a potential marker for ovarian cancer / V.S. Gryshkova, D.S. Lituyev, V.V. Filonenko, R.G. Kiyamova // Біополімери і клітина. — 2009. — Т. 25, № 2. — С. 95-100. — Бібліогр.: 23 назв. — англ. 0233-7657 https://nasplib.isofts.kiev.ua/handle/123456789/5651 577.2, 577.27 The aim of present study was to develop a model for a functional analysis of a recently identified marker of the ovarian cancer - sodium-dependent phosphate transporter NaPi2b. For this purpose, we have created HEK293 stable cell lines expressing wild type or mutant forms of NaPi2b (T330V substitution in a large extracellular loop and a 6 amino acid residues deletion in the C-terminal cytoplasmic tail), revealed in the ovarian cancer cell lines. The expression of wild type and mutant forms NaPi2b in the stable cell lines created was confirmed by Western-blot analysis with monoclonal antibodies against NaPi2b. The cellular models described here will be useful for studying the function of sodium-dependent phosphate transporter NaPi2b in health and disease. en Інститут молекулярної біології і генетики НАН України Структура і функції біополімерів Creation of cellular models for the analysis of sodium-dependent phosphate transporter NaPi2b, a potential marker for ovarian cancer Створення клітинних моделей для аналізу Na-залежного фосфатного транспортера NaPi2b - потенційного маркера раку яєчників Создание клеточных моделей для анализа Na-зависимого фосфатного транспортера NaPi2b – потенциального маркера рака яичников Article published earlier |
| spellingShingle | Creation of cellular models for the analysis of sodium-dependent phosphate transporter NaPi2b, a potential marker for ovarian cancer Gryshkova, V.S. Lituyev, D.S. Filonenko, V.V. Kiyamova, R.G. Структура і функції біополімерів |
| title | Creation of cellular models for the analysis of sodium-dependent phosphate transporter NaPi2b, a potential marker for ovarian cancer |
| title_alt | Створення клітинних моделей для аналізу Na-залежного фосфатного транспортера NaPi2b - потенційного маркера раку яєчників Создание клеточных моделей для анализа Na-зависимого фосфатного транспортера NaPi2b – потенциального маркера рака яичников |
| title_full | Creation of cellular models for the analysis of sodium-dependent phosphate transporter NaPi2b, a potential marker for ovarian cancer |
| title_fullStr | Creation of cellular models for the analysis of sodium-dependent phosphate transporter NaPi2b, a potential marker for ovarian cancer |
| title_full_unstemmed | Creation of cellular models for the analysis of sodium-dependent phosphate transporter NaPi2b, a potential marker for ovarian cancer |
| title_short | Creation of cellular models for the analysis of sodium-dependent phosphate transporter NaPi2b, a potential marker for ovarian cancer |
| title_sort | creation of cellular models for the analysis of sodium-dependent phosphate transporter napi2b, a potential marker for ovarian cancer |
| topic | Структура і функції біополімерів |
| topic_facet | Структура і функції біополімерів |
| url | https://nasplib.isofts.kiev.ua/handle/123456789/5651 |
| work_keys_str_mv | AT gryshkovavs creationofcellularmodelsfortheanalysisofsodiumdependentphosphatetransporternapi2bapotentialmarkerforovariancancer AT lituyevds creationofcellularmodelsfortheanalysisofsodiumdependentphosphatetransporternapi2bapotentialmarkerforovariancancer AT filonenkovv creationofcellularmodelsfortheanalysisofsodiumdependentphosphatetransporternapi2bapotentialmarkerforovariancancer AT kiyamovarg creationofcellularmodelsfortheanalysisofsodiumdependentphosphatetransporternapi2bapotentialmarkerforovariancancer AT gryshkovavs stvorennâklítinnihmodeleidlâanalízunazaležnogofosfatnogotransporteranapi2bpotencíinogomarkerarakuâêčnikív AT lituyevds stvorennâklítinnihmodeleidlâanalízunazaležnogofosfatnogotransporteranapi2bpotencíinogomarkerarakuâêčnikív AT filonenkovv stvorennâklítinnihmodeleidlâanalízunazaležnogofosfatnogotransporteranapi2bpotencíinogomarkerarakuâêčnikív AT kiyamovarg stvorennâklítinnihmodeleidlâanalízunazaležnogofosfatnogotransporteranapi2bpotencíinogomarkerarakuâêčnikív AT gryshkovavs sozdaniekletočnyhmodeleidlâanalizanazavisimogofosfatnogotransporteranapi2bpotencialʹnogomarkerarakaâičnikov AT lituyevds sozdaniekletočnyhmodeleidlâanalizanazavisimogofosfatnogotransporteranapi2bpotencialʹnogomarkerarakaâičnikov AT filonenkovv sozdaniekletočnyhmodeleidlâanalizanazavisimogofosfatnogotransporteranapi2bpotencialʹnogomarkerarakaâičnikov AT kiyamovarg sozdaniekletočnyhmodeleidlâanalizanazavisimogofosfatnogotransporteranapi2bpotencialʹnogomarkerarakaâičnikov |