Krefftascaris (Nematoda, Ascaridoidea) from Australian Side-Necked Turtles with Description of Krefftascaris sharpiloi sp. n. from Chelodina rugosa
Previously known records of ascaridoid nematodes Krefftascaris Sprent, 1980 are summarized and new records of the genus reported. Krefftascaris sharpiloi Tkach, Kuzmin et Snyder, sp. n. is described from specimens found in the stomach of the northern snake-necked turtle Chelodina rugosa collected fr...
Збережено в:
| Опубліковано в: : | Вестник зоологии |
|---|---|
| Дата: | 2010 |
| Автори: | , , |
| Формат: | Стаття |
| Мова: | Англійська |
| Опубліковано: |
Інститут зоології ім. І.І. Шмальгаузена НАН України
2010
|
| Теми: | |
| Онлайн доступ: | https://nasplib.isofts.kiev.ua/handle/123456789/65655 |
| Теги: |
Додати тег
Немає тегів, Будьте першим, хто поставить тег для цього запису!
|
| Назва журналу: | Digital Library of Periodicals of National Academy of Sciences of Ukraine |
| Цитувати: | Krefftascaris (Nematoda, Ascaridoidea) from Australian Side-Necked Turtles with Description of Krefftascaris sharpiloi sp. n. from Chelodina rugosa / V.V. Tkach, Yu.I. Kuzmin, S.D. Snyder // Вестник зоологии. — 2010. — Т. 44, № 1. — С. 3–13. — Бібліогр.: 22 назв. — англ. |
Репозитарії
Digital Library of Periodicals of National Academy of Sciences of Ukraine| _version_ | 1860038259693846528 |
|---|---|
| author | Tkach, V.V. Kuzmin, Yu.I. Snyder, S.D. |
| author_facet | Tkach, V.V. Kuzmin, Yu.I. Snyder, S.D. |
| citation_txt | Krefftascaris (Nematoda, Ascaridoidea) from Australian Side-Necked Turtles with Description of Krefftascaris sharpiloi sp. n. from Chelodina rugosa / V.V. Tkach, Yu.I. Kuzmin, S.D. Snyder // Вестник зоологии. — 2010. — Т. 44, № 1. — С. 3–13. — Бібліогр.: 22 назв. — англ. |
| collection | DSpace DC |
| container_title | Вестник зоологии |
| description | Previously known records of ascaridoid nematodes Krefftascaris Sprent, 1980 are summarized and new records of the genus reported. Krefftascaris sharpiloi Tkach, Kuzmin et Snyder, sp. n. is described from specimens found in the stomach of the northern snake-necked turtle Chelodina rugosa collected from two localities in Northern Territory, Australia. The new species differs from the only previously known Krefftascaris species, K. parmenteri Sprent, 1980, by the presence of thickened and bifurcated anterior edges of the lateral cuticular alae and a difference in the relative distance from the anterior end to the nerve ring which is 1.5 to 2 times greater in K. parmenteri. Comparison of approximately 2.100 bases of ribosomal DNA sequences This study contains first reports of Krefftascaris in Chelodina rugosa, Chelodina burrungandjii, Chelodina canni and Emydura tanybaraga and the first records of this genus in the Northern Territory, Queensland and Western Australia. Molecular phylogenetic analysis based on sequences of nuclear small ribosomal subunit gene has demonstrated close affinities between Krefftascaris and Heterocheilus, the type genus of the Heterocheilidae and Heterocheilinae. Parasitism of several species and genera of Heterocheilidae in crocodiles allows us to hypothesize that Krefftascaris may have been acquired by turtles from crocodilians.
Обобщены извест.ные ранее и приведены новые данные о нематодах рода Krefftascaris Sprent 1980. Новый вид рода, Krefftascaris sharpiloi Tkach, Kuzmin et Snyder, sp. n., описан из желудка бокошейной чере.пахи Chelodina rugosa из Северной Территории (Австралия). Он отличается от ранее извест.ного K. parmenteri Sprent, 1980 наличием разветвленных утолщений на переднем краю лате.раль.ных кутикулярных крыльев, а также положением нервного кольца относительно переднего кон.ца тела. Это расстояние, отнесенное к длине тела, у нового вида в 1,5–2 раза меньше, чем у K. parmenteri. Сравнение последовательностей около 2100 оснований рибосомальной ДНК Виды рода Krefftascaris впервые обнаружены у хозяев Chelodina rugosa, C. burrungandjii, C. canni и Emydura tanybaraga и на территории австралийских шатов Северная Территория, Квинсленд и Западная Австралия. Моле.ку.лярно-филогенетический анализ, основанный на последо.ва.тель.нос.тях нуклеотидов ядерного гена малой рибосомальной субъеди.ни.цы, показал близость Krefftascaris к роду Heterocheilus, типовому в семействе Heterocheilidae и подсемействе Hetero.chei.linae. Паразитирование некоторых видов и родов Heterocheilidae у крокодилов позволяет нам предположить, что предки Krefftascaris перешли к паразитированию у черепах от этой группы хозяев.
|
| first_indexed | 2025-12-07T16:54:29Z |
| format | Article |
| fulltext |
UDC 595.132:598.134(94)
KREFFTASCARIS (NEMATODA, ASCARIDOIDEA)
FROM AUSTRALIAN SIDE-NECKED TURTLES
WITH DESCRIPTION OF KREFFTASCARIS SHARPILOI SP. N.
FROM CHELODINA RUGOSA
V. V. Tkach1, Yu. I. Kuzmin2, S. D. Snyder3
1 University of North Dakota, 10 Cornell str., Grand Forks, ND 58202, U. S. A.
E-mail: vasyl.tkach@und.nodak.edu
2 Shmalhausen Institute of Zoology, B. Chmielnicky str., 15, Kyiv, 01601 Ukraine
E-mail: rhabdias@izan.kiev.ua
3 University of Nebraska at Omaha, Omaha, NE 68182 U. S. A.
E-mail: sdsnyder@mail.unomaha.edu
Received 14 December 2009
Accepted 11 January 2010
Krefftascaris (Nematoda, Ascaridoidea) from Australian Side-Necked Turtles with Description of
Krefftascaris sharpiloi sp. n. from Chelodina rugosa. Tkach V. V., Kuzmin Yu. I., Snyder S. D. —
Previously known records of ascaridoid nematodes Krefftascaris Sprent, 1980 are summarized and new
records of the genus reported. Krefftascaris sharpiloi Tkach, Kuzmin et Snyder, sp. n. is described from
specimens found in the stomach of the northern snake-necked turtle Chelodina rugosa collected from
two localities in Northern Territory, Australia. The new species differs from the only previously known
Krefftascaris species, K. parmenteri Sprent, 1980, by the presence of thickened and bifurcated anterior
edges of the lateral cuticular alae and a difference in the relative distance from the anterior end to the
nerve ring which is 1.5 to 2 times greater in K. parmenteri. Comparison of approximately 2.100 bases
of ribosomal DNA sequences This study contains first reports of Krefftascaris in Chelodina rugosa,
Chelodina burrungandjii, Chelodina canni and Emydura tanybaraga and the first records of this genus in
the Northern Territory, Queensland and Western Australia. Molecular phylogenetic analysis based on
sequences of nuclear small ribosomal subunit gene has demonstrated close affinities between
Krefftascaris and Heterocheilus, the type genus of the Heterocheilidae and Heterocheilinae. Parasitism
of several species and genera of Heterocheilidae in crocodiles allows us to hypothesize that Krefftascaris
may have been acquired by turtles from crocodilians.
Ke y wo r d s: Nematoda, Ascaridiidae, Krefftascaris, sp. n., Australia, turtles, Chelodina, Elseya,
ribosomal DNA sequences, molecular phylogeny.
Krefftascaris (Nematoda, Ascaridoidea) èç áîêîøåéíûõ ÷åðåïàõ Àâñòðàëèè, ñ îïèñàíèåì Krefftascaris
sharpiloi sp. n. èç Chelodina rugosa. Òêà÷ Â. Â., Êóçüìèí Þ. È., Ñíàéäåð Ñ. Ä. — Îáîáùåíû èçâåñò-
íûå ðàíåå è ïðèâåäåíû íîâûå äàííûå î íåìàòîäàõ ðîäà Krefftascaris Sprent 1980. Íîâûé âèä ðîäà,
Krefftascaris sharpiloi Tkach, Kuzmin et Snyder, sp. n., îïèñàí èç æåëóäêà áîêîøåéíîé ÷åðåïàõè
Chelodina rugosa èç Ñåâåðíîé Òåððèòîðèè (Àâñòðàëèÿ). Îí îòëè÷àåòñÿ îò ðàíåå èçâåñòíîãî
K. parmenteri Sprent, 1980 íàëè÷èåì ðàçâåòâëåííûõ óòîëùåíèé íà ïåðåäíåì êðàþ ëàòåðàëüíûõ
êóòèêóëÿðíûõ êðûëüåâ, à òàêæå ïîëîæåíèåì íåðâíîãî êîëüöà îòíîñèòåëüíî ïåðåäíåãî êîíöà òåëà.
Ýòî ðàññòîÿíèå, îòíåñåííîå ê äëèíå òåëà, ó íîâîãî âèäà â 1,5–2 ðàçà ìåíüøå, ÷åì ó K. parmenteri.
Ñðàâíåíèå ïîñëåäîâàòåëüíîñòåé îêîëî 2100 îñíîâàíèé ðèáîñîìàëüíîé ÄÍÊ Âèäû ðîäà Krefftascaris
âïåðâûå îáíàðóæåíû ó õîçÿåâ Chelodina rugosa, C. burrungandjii, C. canni è Emydura tanybaraga è íà
òåððèòîðèè àâñòðàëèéñêèõ øàòîâ Ñåâåðíàÿ Òåððèòîðèÿ, Êâèíñëåíä è Çàïàäíàÿ Àâñòðàëèÿ. Ìîëå-
êóëÿðíî-ôèëîãåíåòè÷åñêèé àíàëèç, îñíîâàííûé íà ïîñëåäîâàòåëüíîñòÿõ íóêëåîòèäîâ ÿäåðíîãî ãåíà
ìàëîé ðèáîñîìàëüíîé ñóáúåäèíèöû, ïîêàçàë áëèçîñòü Krefftascaris ê ðîäó Heterocheilus, òèïîâîìó â
ñåìåéñòâå Heterocheilidae è ïîäñåìåéñòâå Heterocheilinae. Ïàðàçèòèðîâàíèå íåêîòîðûõ âèäîâ è
ðîäîâ Heterocheilidae ó êðîêîäèëîâ ïîçâîëÿåò íàì ïðåäïîëîæèòü, ÷òî ïðåäêè Krefftascaris ïåðåøëè
ê ïàðàçèòèðîâàíèþ ó ÷åðåïàõ îò ýòîé ãðóïïû õîçÿåâ.
Êëþ÷åâûå ñ ëîâ à: Nematoda, Ascaridiidae, Krefftascaris, íîâûé âèä, Àâñòðàëèÿ, ÷åðåïàõè,
Chelodina, Elseya, ðÄÍÊ, ïîñëåäîâàòåëüíîñòü íóêëåîòèäîâ, ìîëåêóëÿðíàÿ ôèëîãåíèÿ.
Vestnik zoologii, 44(1): 3–13, 2010 Ôàóíà è ñèñòåìàòèêà
Introduction
Krefftascaris Sprent, 1980 is a monotypic genus known only from Australian freshwater turtles, and has
not been reported since original description. K. parmenteri Sprent, 1980 was described from fresh-water turtles
Chelodina longicollis (Shaw, 1794) and Elseya dentata (Gray, 1863) from New South Wales (Sprent, 1980).
Sprent did not clearly specify the systematic position of the new genus and only mentioned its probable close
relationships with the parasites of crocodilians (Ortleppascaris Sprent, 1978 and Gedoelstacaris Sprent, 1978)
and terrestrial reptiles (Angusticaecum Baylis, 1920, Hexametra Travassos, 1919 and Polydelphis Dujardin,
1845).
As part of a survey of the parasite fauna of Australian freshwater turtles (Snyder, Tkach, 2006, 2007,
2009; Tkach, Snyder, 2006, 2007 a, b, 2008; Kuzmin et al., 2009) we found ascaridiid nematodes in several
species of freshwater turtles from multiple localities in Queensland, Western Australia, and Northern
Territory, Australia. The majority of these specimens were identified as Krefftascaris parmenteri. However,
specimens from Chelodina rugosa Ogilby, 1890 collected from two localities in Northern Territory appeared
to be morphologically different from K. parmenteri. This material is described herein as a new species based
on combined morphological and molecular evidence. A molecular phylogenetic analysis is attempted in order
to clarify systematic position of Krefftascaris.
Material and methods
Between June 2004 and December 2007, specimens belonging to 12 species of freshwater turtles, were
collected by baited traps or by hand from numerous localities in New South Wales, Queensland, Northern
Territory and Western Australia. All collections proceeded under permits from authorities of corresponding
states.
Most turtles harboured one to several species of parasitic worms including digeneans, aspidogastreans,
cestodes and nematodes; however, for the purpose of this work we refer only to nematodes. After recovery
from the host intestine the nematodes were rinsed in saline, killed with hot 70% ethanol and stored in 70%
ethanol. For light microscopy they were cleared in phenol-glycerine (1 : 3 ratio). Measurements were taken
from a compound microscope using digital imaging and Rincon measurement software (v. 7.1.2, Imaging
Planet, Goleta, California). Photographs and drawings were made with DFC480 digital camera and drawing
tube mounted on Leica DM5000 compound microscope equipped with DIC optics. Nematodes belonging to
the new species were found in material from C. rugosa from two localities in Northern Territories (Hayes
Creek Billabong and a small lagoon on Mango Farm in the Daly River floodplain). Specimens of
K. parmenteri used for morphological differentiation with the new species originated from C. rugosa and
C. burrunganjii from Western Australia, Queensland and Northern Territory.
All measurements are in micrometers unless otherwise stated.
Genomic DNA for molecular analysis was extracted from: six specimens of Krefftascaris parmenteri
obtained from Chelodina rugosa collected from the Mary and Daly Rivers in Northern Territory) and
Leichardt Lagoon in Northern Queensland; Chelodina canni collected from Armraynald Station and Ross
River Dam in Northern Queensland; Chelodina burrungandjii collected from Parry Creek Farm Billabong in
Western Australia and Emydura tanybaraga collected from a small lagoon on Mango Farm in Northern
Territory. DNA was also extracted from two specimens of the new species obtained from Chelodina rugosa
collected from Hayes Creek Billabong and a small lagoon on Mango Farm, both in Northern Territory
(tabl. 1). Tissue for DNA extraction was taken from the middle part of the body while taxonomically
important anterior and posterior parts were preserved as vouchers for morphological identification. DNA was
extracted according to Tkach and Pawlowski (1999).
For species differentiation, DNA fragments spanning the 3’ end of 18S nuclear rDNA gene, internal
transcribed spacer region (ITS1 + 5.8S + ITS2) and 5’ end of the 28S gene were amplified by PCR on an
Eppendorf Master Gradient thermal cycler using the newly designed forward primer c1860f (5’– TGAAAA
TCCTCCGTGCTCGG–3’) and the reverse primer n900r (5’–GGTTCGATTAGTCTTTCGCC–3’). PCR
primers as well as additional forward internal primer 28S 2 (5’–CCGCTGAATTTAAGCATAT–3’) and
reverse internal primers 28S 2R (5’–ATATGCTTAAATTCAGCGG–3’), 300R (5’–CAACTTTCCC
TCACGGTACTTG–3’) and ECD2 (5’–CTTGGTCCGTGTTTCAAGACGGG–3’) were used for
sequencing. PCR products were purified directly using Qiagen Qiaquick™ (Valencia, CA) columns, cycle-
sequenced using ABI BigDye™ chemistry, alcohol-precipitated, and run on an ABI Prism 3100™ automated
capillary sequencer. Contiguous sequences were assembled and edited using Sequencher™ (GeneCodes
Corp., ver. 4.1.4) and submitted to GenBank: Krefftascaris parmenteri (GU245685– GU245690), Krefftascaris
sharpiloi sp. n. (GU245691– GU245692). Sequences were aligned for pairwise comparison in the BioEdit
program, version 7.0.1 (Hall, 1999).
For phylogenetic analysis, nearly complete nuclear small ribosomal subunit (18S) gene was amplified
from the new species using forward primer G18S4 (5’–GCTTGTCTCAAAGATTAAGCC–3’) and reverse
primer c1960r (5’–CGACTTTTGCCCGGTTCAAGCCAC–3’). PCR primers and additional internal
reverse primers n635r (5’–CGCCTGCTGCCTTCCTTGG–3’) and n649r (5’–TAAGAACGGCCATG
CACCAC–3’) were used for sequencing. Sequence of K. sharpiloi nov. sp. was aligned with previously
published sequences (Nadler, Hudspeth, 1998, 2000; Nadler et al., 2007) of 16 other species belonging to 7
4 V. V. Tkach, Yu. I. Kuzmin, S. D. Snyder
ascaridoid families and 3 outgroup taxa available in GenBank: Brumptaemilius justini (AF036589),
Raillietnema sp. (DQ503461), Nemhelix bakeri (DQ118537), Dujardinascaris waltoni (EF180081), Cruzia
americana (U94371), Heterocheilus tunicatus (U94373), Contracaecum eudyptulae (EF180072), Porrocaecum
depressum (U94379), Toxocara canis (U94382), Pseudoterranova decipiens (U94380), Anisakis sp. (U94365),
Terranova caballeroi (U94381), Hysterothylacium reliquens (U94376), Iheringascaris inquies (U94377),
Raphidascaris acus (DQ503460), Ascaris lumbricoides (U94366), Baylisascaris procyonis (U94368), Parascaris
equorum (U94378), Toxascaris leonina (U94383). Choice of ingroup and outgroup taxa was based on recent
molecular phylogenetic studies of the Ascaridoidea and related nematode lineages (Nadler, Hudspeth, 1998,
2000; Nadler et al., 2007). Choice of the gene was defined by the selection of sequences currently available
in the GenBank. Sequences were aligned using Clustal W module implemented in the BioEdit 7.01 (Hall,
1999) with subsequent refinement by eye using BioEdit. A Maximum Likelihood (ML) and Maximum
Parsimony (MP) analyses were performed using PAUP* ver. 4.0b10 (Swofford, 2002). Nodal support was
calculated based on 1,000 bootstrap replicates with 100 replicates at each step for MP analysis and 1,000
bootstrap replicates for ML analysis.
Krefftascaris sharpiloi Tkach, Kuzmin et Snyder, sp. n. (fig 1; 2, a, c, d)
De s c r i p t i o n
Gene r a l. Body slender, irregularly coiled. Body cuticle transversely striated.
Lateral alae present along the whole body from base of pseudolabia to the caudal region.
At the head end, lateral alae possess characteristic bifurcate thickening of their ed-
ges (fig. 1, a). Pseudolabia trapezoid, rounded. Two large cephalic papillae present at
base of each pseudolabium. Labial pulp with two rounded anterior processes. Buccal
cavity small, elongated. Oesophagus with indistinct border between muscular and glan-
dular parts, cylindrical, with somewhat dilated anterior end. Ventriculus three-lobed.
Caecum long, its anterior end somewhat posterior to level of nerve ring (fig. 1, b).
Excretory pore just posterior to the nerve ring. Deirids were not observed.
Ma l e s (holotype and 1 paratype; measurements of paratype in parentheses).
Smaller than females, body 37.3 (41.6) mm long, 405.0 (465.0) wide at midlength.
Pseudolabia 35.0 (42.0) long. Oesophagus 3.9 (3.7) mm long [10.6 (9.0) % of body
length], ventriculus 151.0 (152.0) long. Nerve ring at 343.0 (379.0), excretory pore at
430.0 (455.0) from anterior end. Posterior part of body bent ventrally. Tail short, con-
ical, with pointed end (fig. 1, d). Distance from anus to tail tip 112.0 (98.0) [0.3 (0.2)
% of body length].
Spicules strongly sclerotized (fig. 1, c). Right spicule 683.0 (678.0) long, with elon-
gated funnel-shaped capitulum. Left spicule 583.0 (580.0) long, with shorter capitulum.
Both spicules with smooth distal parts and sharply pointed ends. Gubernaculum 123.0
(130.0) long, with rounded proximal part and pointed distal end in lateral view. Four
5Krefftascaris (Nematoda, Ascaridoidea) from Australian Side-Necked Turtles...
Ta b l e 1. Hosts and localities of Krefftascaris spp. in Australia
Ò à á ëèö à 1. Õîçÿåâà è ìåñòà îáíàðóæåíèÿ Krefftascaris spp. â Àâñòðàëèè
K. parmenteri C. longicollis Gara River, NSW Sprent (1980)
E. dentata Gara River, NSW Sprent (1980)
C. burrungan-
djii
Parry Creek Farm Billabong, WA (15°35.817’ S;
128°16.724’ E)
present study
C. rugosa Leichardt Lagoon, QLD (17°51.040’ S; 141° 07.707’ E) present study
Mary River, NT (12°34.624’ S; 131°43.476’ E) present study
Daly River, NT (14°00.31’ S; 131°14.46’ E) present study
C. canni Armraynald Station, QLD (17°57.432’ S; 139°45.393’ E) present study
Ross River Dam, near Thuringowa, QLD (19°24.582’ S,
146°44.302’ E)
present study
E. tanyabaraga Daly River Mango Farm, NT (13°44.30’ S; 130°40.84’ E) present study
K. sharpiloi
sp. n.
C. rugosa Hayes Ck Billabong, NT (13°39.589’ S; 131°23.990’ E) present study
Daly River Mango Farm, NT (13°44.30’ S; 130°40.84’ E) present study
Species Hosts Localities
Source
of information
pairs of ventrolateral genital papillae associated with small genital alae (fig. 1, c). First
pair of genital papillae situated at some distance from other ones, second pair at mid-
way between first pair and level of anus, fourth pair adanal. A pair of lateral papillae
positioned between levels of the third and the fourth pairs of ventrolateral papillae
6 V. V. Tkach, Yu. I. Kuzmin, S. D. Snyder
Fig. 1. Krefftascaris sharpiloi sp. n.: a — head end, dorsal view (female paratype); b — anterior end, lateral
view (female paratype); c — male posterior end, lateral view (holotype); d — position of male caudal papillae,
lateral view (first ventrolateral papilla not shown); e — female posterior end, lateral view (paratype). Scale
bars: a, c, d — 0.1 mm; b, e — 0.5 mm.
Ðèñ. 1. Krefftascaris sharpiloi sp. n.: a — ãîëîâíîé êîíåö, äîðñàëüíûé âèä (ñàìêà, ïàðàòèï); b —
ïåðåäíèé êîíåö òåëà, ëàòåðàëüíûé âèä (ñàìêà, ïàðàòèï); c — õâîñòîâîé êîíåö ñàìöà, ëàòåðàëüíûé
âèä (ïàðàòèï); d — ðàñïîëîæåíèå õâîñòîâûõ ñîñî÷êîâ ñàìöà, ëàòåðàëüíî (ïåðâûé âåíòðîëàòåðàëüíûé
ñîñî÷åê íå ïîêàçàí); e — çàäíèé êîíåö òåëà ñàìêè (ïàðàòèï). Ìàñøòàáíàÿ ëèíåéêà: a, c, d — 0,1 ìì;
b, e — 0,5 ìì.
(fig. 1, d). Two pairs of short, robust ventrolateral adanal papillae not connected to
genital alae. Two pairs of subventral papillae situated at tail midlength, all arranged in
transversal row. One ventral preanal papilla present on anal anterior lip.
F ema l e s (4 paratypes). Somewhat larger than males, body 32.5–47.2 mm long,
492.0–692.0 thick at midlength. Pseudolabia 45.0–57.0 long. Oesophagus 4.0–4.6 mm
long (9.6–12.4% of body length), ventriculus 89.0–190.0 long. Nerve ring at
321.0–416.0, excretory pore at 387.0–460.0 from anterior end. Tail short, conical, with
cuticular needle on top (fig. 1, e). Tail length 502.0–604.0 (1.2–1.5% of body length).
Vulva pre-equatorial, at 5.4–6.7 mm from anterior end (14.1–16.6% of body length).
Lips of vulva indistinct. Vagina thick-walled, first directed anteriorly, then turned pos-
teriorly (fig. 2, c). Uteri didelphic. Ovaries forming numerous loops in posterior part of
body. Eggs rounded, with thick smooth transparent shell (fig. 2, d), 99.0–114.0 long
and 62.0–78.0 wide (n = 10).
T a xonom i c Summa r y
Type series: holotype ({) and 5 paratypes (1 { and 4 }).
7Krefftascaris (Nematoda, Ascaridoidea) from Australian Side-Necked Turtles...
Fig. 2. K. sharpiloi sp. n. (a, c, d) and K. parmenteri (b): a, b — head end, dorsal view (arrow indicates
thickening of cuticle on anterior edge of lateral alae in K. sharpiloi sp. n.); c — fragment of juvenile female
showing vulva (arrow) and distal part of vagina; d — fragment of gravid female showing eggs in uterus. Scale
bars: a, b — 0.1 mm; c, d — 0.5 mm.
Ðèñ. 2. K. sharpiloi sp. n. (a, c, d) è K. parmenteri (b): a, b — ãîëîâíîé êîíåö, äîðñàëüíî (óòîëùåíèå
êóòèêóëû íà ïåðåäíåì êðàþ ëàòåðàëüíûõ êðûëüåâ ó K. sharpiloi sp. n. ïîêàçàíî ñòðåëêîé); c —
ôðàãìåíò òåëà þâåíèëüíîé ñàìêè ñ âóëüâîé (ñòðåëêà) è äèñòàëüíîé ÷àñòüþ âàãèíû; d — ôðàãìåíò
òåëà âçðîñëîé ñàìêè ñî çðåëûìè ÿéöàìè â ìàòêå. Ìàñøòàáíàÿ ëèíåéêà: a, b — 0,1 ìì; c, d — 0,5 ìì.
Type specimens deposited in the Queensland Museum, Brisbane Australia. Holo-
type: G231391 ({); 5 paratypes: G231392–231393 and G231689–231691 (1 { and 4 }).
Type host: Northern snake-necked turtle Chelodina rugosa Ogilby, 1890.
Prevalence: 10%; intensity: 3–6 specimens.
Type locality: Hayes Creek Billabong, Northern Territory, Australia; 13°39.589’ S,
131°23.990’ E.
Other localities: Daly River Mango Farm, Northern Territory, Australia; 13°44.30’ S,
130° 40.84’ E.
E t ymo l o g y. The species is named in honour of prominent helminthologist
Viktor Sharpilo in recognition of his contributions to helminthology and particularly to
our knowledge of reptilian nematodes. He was a mentor of two co-authors of this pub-
lication, Vasyl Tkach and Yuriy Kuzmin.
Rema r k s
Krefftascaris sharpiloi sp. n. is morphologically most similar to K. parmenteri
Sprent, 1980, the only species of Krefftascaris known prior to this study. The two species
are similar in body size and shape, size and shape of the head structures, and the shape
and position of male and female genital structures. Kreftascaris sharpiloi sp. n. differs
from K. parmenteri in the presence of prominent bifurcating thickenings on the anteri-
or edges of the lateral alae, which are less pronounced and lack bifurcation in K. par-
menteri (fig. 2, a, b). The two species also differ in the relative distance from anterior
end to the nerve ring. When calculated as a percentage of the body length, this distance
is 1.5–2 times greater in K. parmenteri, than in K. sharpiloi sp. n. (tabl. 2).
Pairwise comparison of approximately 2,100 bases of ribosomal DNA sequences
(partial 18S, complete ITS1+5.8S+ITS2, partial 28S) obtained from 2 specimens of the
new species and 3 specimens of K. parmenteri showed 75 nucleotide differences between
the two species. Sequences of Krefftascaris sharpiloi sp. n. showed no intraspecific vari-
ability. Only 4 nucleotide substitutions were found in the ITS region of K. parmenteri
from two localities in Northern Queensland compared with specimens from Northern
Territory and Western Australia, which were identical to one another. These regions and
collecting localities are quite distant from one another (fig. 3). For instance, the Ross
River Dam in Northern Queensland and the Parry Creek Farm Billabong in the Western
Australia are situated more than 1900 km apart. In contrast, sequences of K. parmenteri
obtained from localities situated only 200–300 km apart did not show any differences.
More importantly, sequences of K. parmenteri and K. sharpiloi sp. n. obtained from spec-
imens collected from the same host species, C. rugosa, and at the same site on the Daly
8 V. V. Tkach, Yu. I. Kuzmin, S. D. Snyder
Ta b l e 2. Differences in distance to nerve ring in Krefftascaris sharpiloi sp. n. and Krefftascaris parmenteri
Sprent, 1980
Òà á ëèö à 2. Îòëè÷èÿ â ðàññòîÿíèè äî íåðâíîãî êîëüöà ó Krefftascaris sharpiloi sp. n. è Krefftascaris par-
menteri Sprent, 1980
Species
Distance to nerve ring
in mm in % of body length
* Mean values. ** Recalculated from minimum and maximum values.
Krefftascaris sharpiloi sp. n. *:
males
females
361
374
0.92
0.91
Krefftascaris parmenteri (our data)*:
males
females
461
495
1.73
1.45
Krefftascaris parmenteri (after Sprent, 1980)**:
males
females
363
470
1.71
1.62
River floodplain in Northern Territory, had 75 nucleotide differences. Thus, molecular
data strongly support the status of K. sharpiloi sp. n. as a new species.
Krefftascaris parmenteri Sprent, 1980 (fig. 2, b)
The species was previously known only from the original description only (Sprent,
1980). We have found K. parmenteri from additional localities and host species. Combined
data on host and geographic distribution of this species are summarized below.
T a xonom i c Summa r y
Type host: common snake-necked turtle Chelodina longicollis Ogilby, 1890.
Other hosts: Northern snapping turtle Elseya dentata (reported by Sprent, 1980),
sandstone snake-neck turtle C. burrungandjii, northern snake-necked turtle C. rugosa,
Cann’s long-necked turtle C. canni, northern yellow-faced turtle Emydura tanybaraga
(our data).
Type specimens: Queensland Museum. Holotype: G12108 ({). Allotype: G12109 (}).
Type locality: Gara River, New South Wales.
Other localities: Ross River Dam, Leichardt Lagoon and Armraynald Station in
Northern Queensland, Daly River and Mary River in Northern Territory and Parry
Creek Farm Billabong in Western Australia (our data, for details see tabl. 1).
Mo l e c u l a r p h y l o g en e t i c a n a l y s i s
The alignment was trimmed to the length of the shortest sequence. The total length
of the alignment was 1688 bases with the shortest sequence being 1682 bases long and
longest being 1685 bases long. Due to the conserved nature of the gene, only 5 sites
9Krefftascaris (Nematoda, Ascaridoidea) from Australian Side-Necked Turtles...
Fig. 3. Distribution of Krefftascaris spp. in Australia: — K. sharpiloi sp. n.; — K. parmenteri.
Ðèñ. 3. Ðàñïðîñòðàíåíèå âèäîâ ðîäà Krefftascaris â Àâñòðàëèè: — K. sharpiloi sp. n.; — K. parmenteri.
were excluded from the analysis. Of the remaining 1683 sites, 168 were variable and 70
were parsimony-informative. Due to the low level of variability and small number of
parsimony-informative characters the 18S gene is not the best DNA region for phylo-
genetic inference at this taxonomic level. Unfortunately, our choice of molecular tar-
get for analysis was limited by the sequences currently available in the GenBank. The
18S sequences were best represented for the Ascaridoidea and suitable outgroups.
Both ML and MP analyses yielded almost identical tree topology (fig. 4) with
varying levels of bootstrap support. The only difference between the two trees was clus-
tering of Contracaecum and Toxocara in a weakly (53%) supported clade in MP anal-
ysis while in the ML analysis the support for this clade was lower than 50% and thus
they are on figure 4 as a polytomy. Several clades were only weakly supported as a result
of conserved nature of the analyzed gene. General topology of the branches and termi-
nal taxa was similar to that demonstrated and discussed in detail in the previous phy-
logenetic treatments of the Ascaridioidea (Nadler, Hudspeth, 1998, 2000; Nadler et al.,
2007). Krefftascaris sharpiloi clustered together with Heterocheilus tunicatus, a member
of the Heterocheilidae. This clade received high 96% bootstrap support in the MP anal-
ysis and 90% support in the ML analysis.
10 V. V. Tkach, Yu. I. Kuzmin, S. D. Snyder
Fig. 4. Phylogenetic tree based on analysis of partial sequences of 18S rDNA gene using Maximum
Likelihood and Maximum Parsimony algorithms in PAUP*. Higher than 50% bootstrap support values for
ML/MP analyses are shown above internodes. Rectangle indicates close relationship between Krefftascaris
and Heterocheilidae. GenBank accession numbers are shown next to species names. Abbreviations: Car —
Carnoyidae, Cos — Cosmocercidae, Het — Heterocheilidae, Kat — Kathlaniidae, Asc — Ascarididae, Tox —
Toxocaridae, Ani — Anisakidae, Rap — Raphidascarididae.
Ðèñ. 4. Ôèëîãåíåòè÷åñêîå äðåâî ïî äàííûì àíàëèçà ïîñëåäîâàòåëüíîñòåé ôðàãìåíòà ãåíà 18S ðÄÍÊ
ñ èñïîëüçîâàíèåì àëãîðèòìîâ ìàêñèìàëüíîãî ïîäîáèÿ è ìàêñèìàëüíîé ïàðñèìîíèè â ïðîãðàììå
PAUP*. Ïðÿìîóãîëüíèê óêàçûâàåò íà ôèëîãåíåòè÷åñêóþ áëèçîñòü Krefftascaris è Heterocheilidae.
Ñîêðàùåíèÿ: Car — Carnoyidae, Cos — Cosmocercidae, Het — Heterocheilidae, Kat — Kathlaniidae,
Asc — Ascarididae, Tox — Toxocaridae, Ani — Anisakidae, Rap — Raphidascarididae.
Discussion
J. F. A. Sprent (1980) reported a short cuticular needle at the tip of the tail in
young female specimens of K. parmenteri. However, we observed this structure in both
young and adult females of K. parmenteri and K. sharpiloi sp. n. It seems possible that
this fragile feature may be lost in fixed specimens depending on the fixation procedure.
Metric characters in nematodes parasites of animals usually display a high degree
of variability due to continued growth of these parasites during the adult stage. This
variability frequently prevents efficient use of metric characters in the differentiation of
closely related species. However, if the same measurement (e. g. the distance between
the anterior end and the nerve ring) differs remarkably and consistently among groups
of similarly sized specimens this character may be useful for species differentiation.
Additionally, relative metric characters in nematodes demonstrate lower limits of vari-
ability than do absolute measurements (Baker, 1978). This line of evidence gives us
cause to consider the difference in relative distance from the anterior end to the nerve
ring a valid character for species differentiation between K. sharpiloi sp. n. and K. par-
menteri.
Although we have collected Chelodina throughout the range of these turtles, the
new species, K. sharpiloi, was found only in C. rugosa collected in Northern Territory.
Kreftascaris parmenteri, in contrast, was observed in three Chelodina species, Emydura
tanybaraga and Elseya dentata from a much broader geographical range: New South
Wales (Sprent, 1980), Queensland, Northern Territory and Western Australia (fig. 3).
Our findings represent first records of Krefftascaris in Chelodina rugosa, C. burrungand-
jii, C. canni and Emydura tanybaraga and is also the first report of this genus in the
Northern Territory, Queensland and Western Australia. Krefftascaris parmenteri is only
second endoparasite species known from Ch. burrungandjii.
Recent publications of nematodes from Australian freshwater turtles (Ferguson,
Smales, 1998, 2006; Zelmer, Platt, 2005) did not report Krefftascaris, although some of
the authors (Zelmer, Platt, 2005) have examined the same turtle species from localities
close to the sites of our own collections. This may reflect the fact that members of
Krefftascaris, despite broad distribution on the continent, are somewhat rare parasites
of Australian freshwater turtles; the general prevalence of Krefftascaris spp. in all turtles
examined in our study was 5.9%. On the other hand, the collection efforts to date do
not account for seasonal fluctuations in Kreftascaris populations that may cause these
worms to be overlooked.
Hundreds of Emydura (short-necked turtles) have been examined as part of our
research and by others from a number of localities throughout the range of this genus.
Nevertheless, only a single individual of E. tanybaraga collected from a billabong near
Daly River in Northern Territory NT infected with K. parmenteri was found in. Thus,
Krefftascaris have been found in representatives of all genera of Australian side-necked
turtles other than monotypical Pseudemydura Siebenrock, 1901. Its only species
Pseudemydura umbrina Siebenrock, 1901 is critically endangered and thus could not be
examined for parasites.
Available prevalence data suggest that Chelodina is probably the preferred host
group of Krefftascaris.
Previous molecular phylogenetic works (Nadler, Hudspeth, 1998, 2000; Nadler et
al., 2007) have significantly improved our knowledge of the phylogenetic interrelation-
ships within the Ascaridoidea. However, previous studies did not include sequences of
Krefftascaris. In our analysis, K. sharpiloi clustered together with a member of the
Heterocheilidae with high bootstrap support in both ML and MP searches. Krefftascaris
also shows morphological similarity (structure of the head end, presence of labial pulp
and 4 pairs of precloacal/genital papillae, etc.) with some heterocheilids, especially
11Krefftascaris (Nematoda, Ascaridoidea) from Australian Side-Necked Turtles...
those from crocodilians (Sprent, 1983, 1999). Therefore, we provisionally place
Krefftascaris in the Heterocheilidae. Members of the Heterocheilidae and particularly
Heterocheilinae include several parasites of Australian crocodiles (Sprent, 1983, 1999).
We hypothesize that Krefftascaris or its ancestor may have been acquired in the course
of evolution from crocodilians. However, any definite statement on this matter would
be premature with limited currently available data. Inclusion of additional ascaridoid
taxa and especially those from crocodilians into future phylogenetic studies will provide
a better basis for discussion of this hypothesis.
The level of intraspecific sequence variability in the sequenced ITS–28S region
among populations of K. parmenteri separated by nearly 2000 kilometres was only four
nucleotide substitutions. This is nearly 20 times lower than the observed level of inter-
specific variability between K. parmenteri and K. sharpiloi sp. n. (75 bases). Although
the two species are easily differentiated genetically, they are very similar morphologi-
cally. The observed morphological differences were stable, but relatively minor. This is
reminiscent of the situation observed in other groups of Australian freshwater turtle par-
asites such as digenean genera Aptorchis Nicoll, 1914, Choanocotyle Jue Sue and Platt,
1998, Buckarootrema Platt and Brooks, 2001 and nematode genus Camallanus Railliet
et Henry, 1915. All of these genera have been shown to circumscribe two or more mor-
phologically very similar species that, nevertheless, possess very distinct genetic differ-
ences (Platt, Tkach, 2003; Snyder, Tkach, 2006; Tkach, Snyder, 2006, 2007 a, b, 2008;
Kuzmin et al., 2009). This pattern suggests rather recent and active speciation process-
es resulting from the disruption of previously uninterrupted turtle distributions by pro-
gressive aridization of the climate and a consequent separation of major river drainages.
Further accumulation of faunistic, morphological and sequence data will allow better
assessment of the trends in the evolution of parasites of Australian freshwater turtles.
We thank Dr. Tony Tucker, Dr. Nancy FitzSimmons and Ms. Maggie Snyder for collection assistance
and Mr. Gordon Graham of CALM Kununurra and Dr. David Blair of James Cook University for making
available laboratory space. This material is based upon work supported by the National Science Foundation
under Grant Nos. NSF 0515460, 0132289, and 0515492.
Baker M. R. Morphology and taxonomy of Rhabdias spp. (Nematoda: Rhabdiasidae) from reptiles and
amphibians of southern Ontario // Canadian J. of Zoology. — 1978. — 56. — P. 2127–2141.
Ferguson M. A., Smales L. R. Spiroxys chelodinae Berry, 1985 (Nematoda: Spiruroidea) and Camallanus
chelonius Baker, 1983 (Nematoda: Camallanoidea) from freshwater turtles (Pleurodira: Chelidae) in
Queensland, Australia // Transactions of the Royal Society of South Australia. — 1998. — 122. —
P. 185–189.
Ferguson M. A., Smales L. R. Helminth Assemblages of the Turtle Emydura macquarii (Pleurodira: Chelidae)
Queensland, Australia // J. of Parasitology. — 2006. — 92. — P. 186–188.
Hall T. A. BioEdit: a user-friendly biological sequence alignment editor and analysis program for Windows
95/98/NT // Nucleic Acids Symposium Series. — 1999. — 41. — P. 95–98.
Kuzmin Yu., Tkach V. V., Snyder S. D., Maier M. D. Camallanus tuckeri n. sp. (Nematoda, Camallanidae)
from freshwater turtles (Pleurodira: Chelidae), in the Kimberley, Western Australia // Comparative
Parasitology. — 2009. — 76 (2). — P. 133–140.
Nadler S. A., Hudspeth D. S. S. Ribosomal DNA and Phylogeny of the Ascaridoidea Nemata: Secernentea):
Implications for Morphological Evolution and Classification // Molecular Phylogenetics and
Evolution. — 1998. — 10 (2). — P. 221–236.
Nadler S. A., Hudspeth D. S. S. Phylogeny of the Ascaridoidea (Nematoda: Ascaridida) based on three genes
and morphology: hypothesis of structural and sequence evolution // J. of Parasitology. — 2000. — 86
(2). — P. 380–393.
Nadler S. A., Carreno R. A., Mejia-Madrid H. et al. Molecular phylogeny of clade III nematodes reveals
multiple origins of tissue parasitism // Parasitology. — 2007. — 134. — P. 1421–1442.
Platt T. R., Tkach V. V. Two new species of Choanocotyle Jue Sue and Platt, 1998 (Digenea:
Choanocotylidae) from an Australian freshwater turtle (Testudines: Pleurodira: Chelidae) // J. of
Parasitology. — 2003. — 89. — P. 145–150.
Snyder S. D., Tkach V. V. Paradeuterobaris victoriae n. sp. (Digenea: Microscaphidiidae) and Buckarootrema
minuta n. sp. (Digenea: Pronocephalidae) from the Victoria River Red-Faced Turtle, Emydura
victoriae (Pleurodira: Chelidae) in Australia // Comparative Parasitology. — 2006. — 73. — P. 7–13.
12 V. V. Tkach, Yu. I. Kuzmin, S. D. Snyder
Snyder S. D., Tkach V. V. Neosychnocotyle maggiae, n. gen, n. sp, (Platyhelminthes: Aspidogastrea) from
freshwater turtles in northern Australia // J. of Parasitology. — 2007. — 93. — P. 399–403.
Snyder S. D., Tkach V. V. Haplorchis popelkae n. sp. (Digenea: Heterophyidae) from short-necked turtles
(Chelidae) in northern Australia // J. of Parasitology. — 2009. — 95. — P. 204–207.
Sprent J. F. A. Ascaridoid nematodes of amphibians and reptiles: Angusticaecum and Krefftascaris n. g. //
J. of Helminthology. — 1980. — 54. — P. 55–73.
Sprent J. F. A. Ascaridoid nematodes of amphibians and reptiles: Typhlophorus, Hartwichia and
Trispiculascaris // J. of Helminthology. — 1983. — 57. — P. 179–189.
Sprent J. F. A. Species of Typhlophoros von Linstow, 1906 (Nematoda: Ascaridoidea) in Old World
crocodilians // Systematic Parasitology. — 1999. — 43(3). — P. 229–236.
Swofford D. L. PAUP*. Phylogenetic analysis using parsimony (and other methods), version 4.0b10 (Alvitec).
Sunderland, Massachusetts: Sinauer Associates, 2002.
Tkach V. V., Pawlowski J. A new method of DNA extraction from the ethanol-fixed parasitic worms // Acta
Parasitologica. — 1999. — 44. — P. 147–148.
Tkach V. V., Snyder S. D. Doodytrema carettochelydis n. gen., n. sp., (Digenea: Microscaphidiidae) from
the Pig-Nosed Turtle, Carettochelys insculpta, (Cryptodira: Carettochelyidae) in Australia //
Comparative Parasitology. — 2006. — 73. — P. 165–171.
Tkach V. V., Snyder S. D. Aptorchis megacetabulus n. sp. (Platyhelminthes: Digenea) from the Northern
Long-Necked Turtle, Chelodina rugosa (Pleurodira: Chelidae), in Australia // J. of Parasitology. —
2007 a. — 93. — P. 404–408.
Tkach V. V., Snyder S. D. Choanocotyle platti n. sp. from the northern long-necked turtle, Chelodina rugosa
(Pleurodira: Chelidae) in Australia // Acta Parasitologica. — 2007 b. — 52. — P. 318–324.
Tkach V. V., Snyder S. D. Aptorchis glandularis n. sp. (Digenea: Plagiorchioidea) from the northwestern red-
faced turtle, Emydura australis, (Pleurodira: Chelidae) in the Kimberley, Western Australia // J. of
Parasitology. — 2008. — 94. — P. 918–924.
Zelmer D. A., Platt T. R. Structure and similarity of helminth communities of six species of Australian
turtles // J. of Parasitology. — 2005. — 94. — P. 781–787.
13Krefftascaris (Nematoda, Ascaridoidea) from Australian Side-Necked Turtles...
|
| id | nasplib_isofts_kiev_ua-123456789-65655 |
| institution | Digital Library of Periodicals of National Academy of Sciences of Ukraine |
| issn | 0084-5604 |
| language | English |
| last_indexed | 2025-12-07T16:54:29Z |
| publishDate | 2010 |
| publisher | Інститут зоології ім. І.І. Шмальгаузена НАН України |
| record_format | dspace |
| spelling | Tkach, V.V. Kuzmin, Yu.I. Snyder, S.D. 2014-06-30T07:29:20Z 2014-06-30T07:29:20Z 2010 Krefftascaris (Nematoda, Ascaridoidea) from Australian Side-Necked Turtles with Description of Krefftascaris sharpiloi sp. n. from Chelodina rugosa / V.V. Tkach, Yu.I. Kuzmin, S.D. Snyder // Вестник зоологии. — 2010. — Т. 44, № 1. — С. 3–13. — Бібліогр.: 22 назв. — англ. 0084-5604 https://nasplib.isofts.kiev.ua/handle/123456789/65655 595.132:598.134(94) Previously known records of ascaridoid nematodes Krefftascaris Sprent, 1980 are summarized and new records of the genus reported. Krefftascaris sharpiloi Tkach, Kuzmin et Snyder, sp. n. is described from specimens found in the stomach of the northern snake-necked turtle Chelodina rugosa collected from two localities in Northern Territory, Australia. The new species differs from the only previously known Krefftascaris species, K. parmenteri Sprent, 1980, by the presence of thickened and bifurcated anterior edges of the lateral cuticular alae and a difference in the relative distance from the anterior end to the nerve ring which is 1.5 to 2 times greater in K. parmenteri. Comparison of approximately 2.100 bases of ribosomal DNA sequences This study contains first reports of Krefftascaris in Chelodina rugosa, Chelodina burrungandjii, Chelodina canni and Emydura tanybaraga and the first records of this genus in the Northern Territory, Queensland and Western Australia. Molecular phylogenetic analysis based on sequences of nuclear small ribosomal subunit gene has demonstrated close affinities between Krefftascaris and Heterocheilus, the type genus of the Heterocheilidae and Heterocheilinae. Parasitism of several species and genera of Heterocheilidae in crocodiles allows us to hypothesize that Krefftascaris may have been acquired by turtles from crocodilians. Обобщены извест.ные ранее и приведены новые данные о нематодах рода Krefftascaris Sprent 1980. Новый вид рода, Krefftascaris sharpiloi Tkach, Kuzmin et Snyder, sp. n., описан из желудка бокошейной чере.пахи Chelodina rugosa из Северной Территории (Австралия). Он отличается от ранее извест.ного K. parmenteri Sprent, 1980 наличием разветвленных утолщений на переднем краю лате.раль.ных кутикулярных крыльев, а также положением нервного кольца относительно переднего кон.ца тела. Это расстояние, отнесенное к длине тела, у нового вида в 1,5–2 раза меньше, чем у K. parmenteri. Сравнение последовательностей около 2100 оснований рибосомальной ДНК Виды рода Krefftascaris впервые обнаружены у хозяев Chelodina rugosa, C. burrungandjii, C. canni и Emydura tanybaraga и на территории австралийских шатов Северная Территория, Квинсленд и Западная Австралия. Моле.ку.лярно-филогенетический анализ, основанный на последо.ва.тель.нос.тях нуклеотидов ядерного гена малой рибосомальной субъеди.ни.цы, показал близость Krefftascaris к роду Heterocheilus, типовому в семействе Heterocheilidae и подсемействе Hetero.chei.linae. Паразитирование некоторых видов и родов Heterocheilidae у крокодилов позволяет нам предположить, что предки Krefftascaris перешли к паразитированию у черепах от этой группы хозяев. We thank Dr. Tony Tucker, Dr. Nancy FitzSimmons and Ms. Maggie Snyder for collection assistance and Mr. Gordon Graham of CALM Kununurra and Dr. David Blair of James Cook University for making available laboratory space. This material is based upon work supported by the National Science Foundation under Grant Nos. NSF 0515460, 0132289, and 0515492. en Інститут зоології ім. І.І. Шмальгаузена НАН України Вестник зоологии Фауна и систематика Krefftascaris (Nematoda, Ascaridoidea) from Australian Side-Necked Turtles with Description of Krefftascaris sharpiloi sp. n. from Chelodina rugosa Krefftascaris (Nematoda, Ascaridoidea) из бокошейных черепах Австралии, с описанием Krefftascaris sharpiloi sp. n. из Chelodina rugosa Article published earlier |
| spellingShingle | Krefftascaris (Nematoda, Ascaridoidea) from Australian Side-Necked Turtles with Description of Krefftascaris sharpiloi sp. n. from Chelodina rugosa Tkach, V.V. Kuzmin, Yu.I. Snyder, S.D. Фауна и систематика |
| title | Krefftascaris (Nematoda, Ascaridoidea) from Australian Side-Necked Turtles with Description of Krefftascaris sharpiloi sp. n. from Chelodina rugosa |
| title_alt | Krefftascaris (Nematoda, Ascaridoidea) из бокошейных черепах Австралии, с описанием Krefftascaris sharpiloi sp. n. из Chelodina rugosa |
| title_full | Krefftascaris (Nematoda, Ascaridoidea) from Australian Side-Necked Turtles with Description of Krefftascaris sharpiloi sp. n. from Chelodina rugosa |
| title_fullStr | Krefftascaris (Nematoda, Ascaridoidea) from Australian Side-Necked Turtles with Description of Krefftascaris sharpiloi sp. n. from Chelodina rugosa |
| title_full_unstemmed | Krefftascaris (Nematoda, Ascaridoidea) from Australian Side-Necked Turtles with Description of Krefftascaris sharpiloi sp. n. from Chelodina rugosa |
| title_short | Krefftascaris (Nematoda, Ascaridoidea) from Australian Side-Necked Turtles with Description of Krefftascaris sharpiloi sp. n. from Chelodina rugosa |
| title_sort | krefftascaris (nematoda, ascaridoidea) from australian side-necked turtles with description of krefftascaris sharpiloi sp. n. from chelodina rugosa |
| topic | Фауна и систематика |
| topic_facet | Фауна и систематика |
| url | https://nasplib.isofts.kiev.ua/handle/123456789/65655 |
| work_keys_str_mv | AT tkachvv krefftascarisnematodaascaridoideafromaustraliansideneckedturtleswithdescriptionofkrefftascarissharpiloispnfromchelodinarugosa AT kuzminyui krefftascarisnematodaascaridoideafromaustraliansideneckedturtleswithdescriptionofkrefftascarissharpiloispnfromchelodinarugosa AT snydersd krefftascarisnematodaascaridoideafromaustraliansideneckedturtleswithdescriptionofkrefftascarissharpiloispnfromchelodinarugosa AT tkachvv krefftascarisnematodaascaridoideaizbokošeinyhčerepahavstraliisopisaniemkrefftascarissharpiloispnizchelodinarugosa AT kuzminyui krefftascarisnematodaascaridoideaizbokošeinyhčerepahavstraliisopisaniemkrefftascarissharpiloispnizchelodinarugosa AT snydersd krefftascarisnematodaascaridoideaizbokošeinyhčerepahavstraliisopisaniemkrefftascarissharpiloispnizchelodinarugosa |