In silico analysis of the structure of variable domains of mouse single-chain antibodies specific to the human recombinant interferon β1b

In silico analysis of the DNA encoding singlechain Fv antibodies (ScFv) specific to the human recombinant interferon β1b and α2b (rhIFNβ1b, rhIFNα2b) has been carried out. The V, D and J-gene segments, the complementaritydetermining (CDR) and framework (FR) regions, n-nucleotides as well as mutation...

Full description

Saved in:
Bibliographic Details
Published in:Цитология и генетика
Date:2009
Main Authors: Flyak, A.I., Pavlova, M.V., Gilchuk, P.V.
Format: Article
Language:English
Published: Інститут клітинної біології та генетичної інженерії НАН України 2009
Subjects:
Online Access:https://nasplib.isofts.kiev.ua/handle/123456789/66623
Tags: Add Tag
No Tags, Be the first to tag this record!
Journal Title:Digital Library of Periodicals of National Academy of Sciences of Ukraine
Cite this:In silico analysis of the structure of variable domains of mouse single-chain antibodies specific to the human recombinant interferon β1b / A.I. Flyak, M.V. Pavlova, P.V. Gilchuk // Цитология и генетика. — 2009. — Т. 43, № 1. — С. 54-60. — Бібліогр.: 19 назв. — англ.

Institution

Digital Library of Periodicals of National Academy of Sciences of Ukraine
_version_ 1859639114709598208
author Flyak, A.I.
Pavlova, M.V.
Gilchuk, P.V.
author_facet Flyak, A.I.
Pavlova, M.V.
Gilchuk, P.V.
citation_txt In silico analysis of the structure of variable domains of mouse single-chain antibodies specific to the human recombinant interferon β1b / A.I. Flyak, M.V. Pavlova, P.V. Gilchuk // Цитология и генетика. — 2009. — Т. 43, № 1. — С. 54-60. — Бібліогр.: 19 назв. — англ.
collection DSpace DC
container_title Цитология и генетика
description In silico analysis of the DNA encoding singlechain Fv antibodies (ScFv) specific to the human recombinant interferon β1b and α2b (rhIFNβ1b, rhIFNα2b) has been carried out. The V, D and J-gene segments, the complementaritydetermining (CDR) and framework (FR) regions, n-nucleotides as well as mutation rates which take place during the affinity maturation of the examined sequences have been determined. For the panel of ScFv against rhIFNβ1b isolated from an immune combinatorial cDNA library uniqueness of the CDRH3 loop by the length and amino acid composition has been shown. Multiple alignments with the nearest homologies from the NCBI databases have revealed that the sequences of ScFv obtained are new. Проведен in silico анализ структуры последовательностей ДНК, кодирующих специфические к интерферону β1b и α2b человека (rhIFN β1b, rhIFN α2b) одноцепочечные антитела (ScFv – single chain Fv): определены V, D и J сегменты, границы антиген связывающих (CDR) и каркасных (FR) участков, n нуклеотиды, а также величина мутационных процессов, которые имели место при аффинном дозревании последовательностей in vivo. Для представителей панели ScFv против rhIFN β1b, изолированных из иммунной комбинаторной библиотеки кДНК V генов, показана уникальность участка CDRH3 как по длине, так и по аминокислотному составу. Множественное выравнивание с ближайшими гомологами базы данных NCBI показало, что полученные нами последовательности ScFv являются новыми. Проведено in silico аналіз структури послідовностей ДНК, які кодують специфічні до рекомбінантного інтерферону β1b та α2b людини (rhIFN β1b, rhIFN-α2b) одноланцюгові антитіла (ScFv – single chain Fv): визначено V , D та J генні сегменти, межі антигензв’язувальних (CDR) та каркасних (FR) ділянок, n- нуклеотиди, а також величину мутаційних процесів, що мали місце при афінному дозріванні даних послідовностей in vivo. Для представників панелі ScFv проти rhIFN β1b, ізольованих з імунної комбінаторної бібліотеки кДНК V генів, показано унікальність ділянки CDRH3 як за довжиною, так і за амінокислотним складом. Множинне вирівнювання з найближчими гомологами бази даних NCBI показало, що одержані нами послідовності ScFv є новими.
first_indexed 2025-12-07T13:20:14Z
format Article
fulltext УДК 577.27 A.I. FLYAK 1, M.V. PAVLOVA 1, P.V. GILCHUK 2 1 National Taras Shevchenko University of Kyiv, Ukraine 2 Institute of Molecular Biology and Genetics NAS of Ukraine, Kyiv E�mail: gilchuk@ukr.net E�mail: flyaka@mail.ru IN SILICO ANALYSIS OF THE STRUCTURE OF VARIABLE DOMAINS OF MOUSE SINGLE�CHAIN ANTIBODIES SPECIFIC TO THE HUMAN RECOMBINANT INTERFERON β1b In silico analysis of the DNA encoding single�chain Fv antibodies (ScFv) specific to the human recombinant interfer� on β1b and α2b (rhIFN�β1b, rhIFN�α2b) has been carried out. The V�, D� and J�gene segments, the complementarity� determining (CDR) and framework (FR) regions, n�nucleotides as well as mutation rates which take place during the affinity maturation of the examined sequences have been determined. For the panel of ScFv against rhIFN�β1b isolated from an immune combinatorial cDNA library uniqueness of the CDRH3 loop by the length and amino acid composition has been shown. Multiple alignments with the nearest homologies from the NCBI databases have revealed that the sequences of ScFv obtained are new. Introduction. An important feature of antibodies is the extraordinary variability of their antigen�bind� ing sites ensuring specific and high�affinity interac� tion with the target antigen. Due to their high bind� ing ability antibodies are of great value as unique molecular probes for fundamental research, as well as in biotechnology and medicine. Modern gene manipulation techniques enable generation of recombinant antibody fragments – single�chain antibodies (ScFv’s), as well as their production in Escherichia coli cells. ScFv’s are obtained by translating DNA sequences of immu� noglobulin heavy�chain (VH) and light�chain (VL) variable domains joined in one gene [1]. The appro� aches to construction and selection of combinato� rial cDNA libraries of V�genes in vitro allow isola� tion of ScFv with desired affinity and specificity, bypassing the stages of traditional hybridoma tech� nology [2, 3]. The diversity of antigen�binding regions of anti� body variable domains is defined by the structure of the underlying encoding gene elements. The genes of the light chain result from recombination of one variable (V) and joining (J) gene segments. Recombination events in the heavy chain are more complex due to the presence of an additional D� segment. One of the mechanisms of increasing diver� sity is incorporation of n�nucleotides (nontem� plated nucleotides) at the gene segment joint site [4]. Later on, the DNA sequences of variable (V) domains are affected by the influence of somatic hypermutations taking place during the affinity maturation of B�cells. The highest rate of point mutations occurs at complementarity determining regions (CDR), as opposed to framework regions (FR) where the rate is relatively low. Up to date, there have been created a number of databases of antibody germline gene segments, as well as software for identification of V�, D�, and J� gene segments, n�nucleotides, CDR and FR seg� ments, mutation rates, etc. A detailed analysis of nucleotide and aminoacid sequences of antibody V�domains is needed for a number of reasons. First of all, it allows determining the degree of confor� mational uniqueness of the antigen binding site of the obtained antibodies, which can be achieved by comparing their aminoacid sequences with yet known immunoglobulin sequences. Second, while analyzing multiple antibody variants against one antigen (a panel of antibodies), determining V�, D�, and J�gene segments, n�nucleotides, and mutations rates enables evaluation of the panel’s heterogene� ISSN 0564–3783. Цитология и генетика. 2009. № 154 © A.I. FLYAK, M.V. PAVLOVA, P.V. GILCHUK, 2009 ity and proper choice of the most promising candi� date molecules for further work. However, what makes most sense is that determining CDR and FR regions of antibody V�domains is an indispen� sable prerequisite for beginning manipulations to improve their functional characteristics, such as decreasing immunogeneity (in case of humaniza� tion), or DNA combinatorial mutagenesis – an in vitro technique used to increase affinity and stabil� ity of obtained antibodies. The most widespread strategy for humanization is grafting of CDR regions of an antigen�specific monoclonal antibody with FR regions of selected V�domains of human antibodies [5]. An example of the practical value of the abovementioned tech� nology is the fact that today out of 30 monoclonal antibody�based drugs approved by FDA (Food and Drug Administration, USA) for clinical applica� tion over one third are humanized antibodies [6]. The core of the combinatorial mutagenesis tech� nique lies in directed randomization of certain regions of V�domains using a set of oligonucleotides with degenerate codons. Randomization targets may include CDR3 regions of VH and VL domains [7], all six CDRs [8], or certain aminoacids of V� domains [9]. The indicated method is particularly valuable while working with naїve and synthetic libraries of antibody fragments («single�pot» antibody libraries), as combined with the phage display it allows isola� tion of antibody molecule variants with improved characteristics of expression in bacteria, prolonged stability in blood stream, as well as exclusively high affinity to the target antigen [8]. Our previous work resulted in obtaining and characterization of a panel of mouse ScFv’s against rhIFN�β1b. The goal of the present work was se� quencing and in silico analysis of the primary structure of the ScFv’s obtained. Materials and methods. DNA sequencing was carried out using the automatic DNA sequencer IBI Prism 3130 (Applied Biosystems, USA). We sequenced DNA (approx. 1000 bp) obtained by polymerase chain reaction (PCR) using the follow� ing primers: pCANTAB�R1 5'�d [CCATGATTA� CGCCAAGCTTTGGAGCC]�3', pCANTAB�R2 5'�d [CGATCTAAAGTTTTGTCGTCTTTCC]�3' and preliminary obtained recombinant phagemids of the corresponding bacterial clones as matrices. For sequencing, we used the following primers: pCANTAB 5�S3: 5'�d [GGTTCAGGCGGAGGTG� GCTCTGG] – 3'; pCANTAB 5�S4: 5'�d [CCAGAGCCACCTCCGCC� TAACC] – 3', pCANTAB 5�S1: 5'�d [CAACGTGAAAAAATTAT� TATTCGC] – 3'; pCANTAB 5�S6: 5'�d [GTAAATGAATTTTCTGTAT� GAGG] – 3'. Sequencing results were processed and interpret� ed with assistance of Vector NTI Advance 10 (Invi� trogen, USA) software. The level of homology bet� ween ScFv nucleotide sequences was determined using ClustalW2 software (http://www.ebi.ac.uk / Tools/clustalw2/) [10]. Identification of V�, D�, and J�gene segments encoding ScFv specific to rhIFN� β1b and rhIFN�α2b, was assisted by Somatic Diversification Analysis (SoDA) software (http:// dulci.org/soda/) [11]. All gene segment names are used in accordance with the standardization rules of the international information system IMGT [12]. Additional n�nucleotides and mutations that oc� curred during antibody affinity maturation were determined by comparing the target sequences with respective germline gene sequences of V�, D�, and J�gene segments from the IMGT database. CDR and FR regions were determined with the help of SoDA software in accordance with the crite� ria developed by IMGT. In view of this, we labeled the indicated regions as CDR�IMGT and FR� IMGT [13]. Search of closest homologs for the aminoacid sequences was performed using IgBLAST software (http://www.ncbi.nlm.nih.gov/igblast/) of the im� munoglobulin V region sequences database of the National Center for Biotechnology Information (NCBI), USA. First, we looked for homologs to a whole ScFv sequence, and then separately for vari� able domains VH and VL. For sequences with high� est homology, we built multiple alignments using Vector NTI Advance 10 software. Results and Discussion. In previous publica� tions, we described generation of an immune com� binatorial cDNA library of mouse immunoglobu� lin V�genes and isolation of a panel of single�chain antibodies specific to rhIFN�β1b [14, 15]. For some isolated ScFv’s such characteristics as bind� ing specificity to native and denatured antigen, level of production in E. coli by secretion, stability etc. were determined. An interesting point was that some producers randomly selected out of more ІSSN 0564–3783. Цитология и генетика. 2009. № 1 55 In silico analysis of the structure of variable domains of mouse single�chain than 30 isolated positive clones invariably differed between each other in the production level of the ScFv’s (0.6 to 3.5 mg/L) and their accumulation rate, ScFv’s sensitivity to proteolysis, ScFv’s affini� ty (1.96 · 10–8 M to 1.69 · 10–9 M), and ScFv’s bind� ing specificity with native and denatured rhIFN� β1b [15]. In many experiments dedicated to study expres� sion of ScFv in E. coli, the influence of the primary structure of variable domains on their production rate has been shown. It is also known that replace� ment of at least one aminoacid in CDR regions may have dramatic influence on antibody affinity and specificity [16]. The differences in production rates in bacterial cells, as well as various antigen� binding characteristics of some ScFv’s from the obtained panel seem to suggest nonidentity of the primary structure of their variable domains. To test this suggestion we sequenced the DNA of all ScFv’s identified as positive in the reaction of binding to rhIFN�β1b. Among the 12 analyzed sequences isolated from different producers, we revealed four DNA variants that encode ScFv with different primary structure – #1, #2, #4, #11. These were the sequences we selected for further analysis. DNA homology of ScFv’s was estimated using ClustalW2 software [10]. For analysis, we used the four sequences of ScFv’s against rhIFN�β1b iso� lated from the immune library, a sequence of ScFv against rhIFN�β1b preliminarily obtained from a naїve library [15], as well as a sequence of ScFv’s against rhIFN�α2b [17]. According to the criteri� on of homology for their DNA, all six ScFv’s were provisionally divided into four groups (Figure). Mapping structurally and functionally valuable regions within antibody variable domains is an important task. Using SoDA software, we identi� fied V�, D�, and J�gene segments, n�nucleotides, as well as mutations that occurred during affinity maturation of respective sequences in vivo [11]. Armed with this same software we identified the boundaries and lengths of all CDR�IMGT and FR�IMGT. The results are summarized in Table 1. It was determined that the DNA sequences of VH and VL domains of the ScFv’s from the first group (#1, #4) were formed by germline gene seg� ments IGHV1–26 and IGKV3–2; the sequences ISSN 0564–3783. Цитология и генетика. 2009. № 156 A.I. Flyak, M.V. Pavlova, P.V. Gilchuk A dendrograme reflecting the homology between nucleotide sequences of ScFv’s carried out using ClustalW2 software. #1, #2, #4, #11 are ScFv’s isolated from an immune cDNA library and specific to rhIFN�β1b; ScFv (naЇve) – ScFv’s isolated from a naїve cDNA library and specific to rhIFN�β1b; ScFv (IFNα) – ScFv’s specific to rhIFN�α2b Table 1 ScFv’s variable domain DNA analysis carried out using SoDA software Group ScFv V� domain V�gene segment Number of V� mutations Number of V�D n� nucleotides (V�J for VL) D�gene segment Number of D� mutations Number of D�J n� nucleotides J�gene segment Number of J�muta� tions CDRH3 region length 1 2 3 4 1 4 2 11 ScFv (naive) ScFv (IFNα) H L H L H L H L H L H L IGHV1�26 IGKV3�2 IGHV1�26 IGKV3�2 IGHV1�67 IGKV3�2 IGHV1�67 IGKV3�2 IGHV1S128 IGKV17�121 IGHV14�3 IGKV8�19 23 5 24 9 15 8 18 5 10 0 6 11 3 0 3 0 2 4 4 4 2 2 3 4 IGHD4�1 IGHD4�1 IGHD4�1 IGHD3�2 IGHD2�1 IGHD1�1 0 0 0 1 1 0 2 4 3 0 2 0 IGHJ2 IGKJ1 IGHJ1 IGKJ1 IGHJ4 IGKJ5 IGHJ1 IGKJ5 IGHJ2 IGKJ1 IGHJ4 IGKJ1 3 4 2 2 4 2 2 2 4 2 4 2 6 9 6 9 6 9 6 9 13 9 10 9 Note. All V�, D�, and J�gene segments’ names are in accordance with the IMGT standardization rules [12]. of the second group (#2, #11) were formed by the segments IGHV1–67 and IGKV3–2; those of the third group – by IGHV1S128 and IGKV17–121; and those of the fourth group – by IGHV14–3 and IGKV8–19, respectively. The results suggest that all the V�gene segment of the four ScFv’s from the panel isolated from the immune combinatorial cDNA library belong to the first and the third IMGT subgroup, respectively [12]. The length of CDRH3�IMGT and CDRL3�IMGT regions of the four ScFv’s isolated from the immune library was 6 and 9 aminoacid residues, respectively. The CDRH3�IMGT region of ScFv isolated from the naїve library turned out to be longer and consisted of 13 aminoacid residues (Table 1). One of V�genes’ diversity sources are somatic hypermutations appearing in vivo during the process� es known as B�cell affinity maturation. Random ІSSN 0564–3783. Цитология и генетика. 2009. № 1 57 In silico analysis of the structure of variable domains of mouse single�chain Table 2 Alignment of CDR�IMGT regions for VH and VL of obtained ScFv’s with nearest V�domain sequences 1 Group № of sequence CDR1 CDR2 CDR3 Regions for VH Regions for VL 1 2 3 4 1 4 AAO852802 AAO852842 AAO852862 ABK599112 2 11 AAF814172 CAA749172 CAA749232 AAA832672 ScFv(naЇve) AAA832672 ScFv(IFNa) AAA165832 GYSFTGYP ******** *******T *******T *******T *******T GYTFTDYA ******** ******** **K***** **K***** *****S*W GYTFTSYR *******W GFNIKDTF *******Y INPYNGGT ******** ******** ******** ******** ******** ISTYSGDT ******N* ****N*N* ****Y*** ****Y*** *NPSN*R* INPSNGRT ******** IDPANGYT ******N* ARF---------PA--Y ***---------**--* **YPQFITTARRY*MD* **AAG---ILRLRDFD* **AAG---ILRLRDFD* **DVRG------AWFA* ARP---------PN--Y ***---------*A--* **YYG-------NYFD* *LLRP---------FA* *LLRP---------FA* **GGVYY-DLYYYALDY ARSYYG----NFYYFDY **GGVYY-DLYY*AL** ASR-------VDYAMDY *R*-------AS***** 1 2 3 4 1 4 ABC553232 1H0D_A2 AAA390152 S099692 2 11 P016562 AAB304602 CAA801072 P016542 ScFv(naЇve) AAZ503752 ScFv(IFNa) AAA387302 ESVDNYGIS--F *********--* *********--* *********--* *********--* *********--* ESVDKYGIS--F ****N****--* ****NS***--* ****N****--* ****N****--* ****N****--* TDIDDD------ ******------ QSLLNSGNQKNY ************ AAS *** *** *** *** *** AAS *** *** *** *** *** EGN *** WAS *** QQSKEVPWT **G****** *******Y* *******L* ********* **G**I*Y* QQSKEVPWT ********* ********* ********* *******P* ********* LQSDNLPLP ********T QNDYSYPLT ********* Note. 1 – search of closest homologs for the aminoacid sequences was performed using IgBLAST software of the immunoglobulin V�region sequences database of the NCBI; 2 – the sequence number corresponds to the number in GenBank; «_» indicated amino acids common for CDR�IMGT regions of ScFv’s of groups 1 and 2; * indicated the same amino acids within each ScFv group; «�» – denotes the absence of an aminoacid at this position. aminoacid replacements affect the antigen�binding properties of antibodies, which results from local changes in variable domain conformation as well as changes in quantity/quality of functional groups in aminoacid residues that directly contact with antigen [8]. For V�, D�, and J�gene segments of V� domains of the studied ScFv’s, we have determined the respective mutation rates – the absolute quan� tity of nucleotide substitutions deduced from juxta� posing the sequences in question against the sequences of the identified germline gene segments (Table 1). It has been shown that the indicated rates for V�gene segments of ScFv’s #1 and #4 (group 1) is higher compared to that of ScFv #2 and #11 (group 2). The fact that the absolute mutation rate for V�gene segments of ScFv isolated from the naїve library (ScFv (naїve)) is the lowest for all analyzed sequences was an expected result (Table 1). Our search results for similar experimental works suggest that a panel of ScFv’s against rhIFN�β1b has been obtained for the first time. Taking into account this fact, as well as the methodological novelty of the generation and selection scheme for the respective combinatorial library of V�genes [14], it was important to estimate the degree of unique� ness of the antigen�binding site of the isolated ScFv’s. It is common knowledge that the specifici� ty of the «antigen�antibody» interaction is, first of all, determined by the primary structure of the CDR regions which aminoacids are responsible for direct contact with the antigen. Exposed on the surface of V�domains, CDR regions are spatially accessible for interaction with the antigen and form canonical loop�like structures. Among other CDRs, CDRH3 is the most variable in length and aminoacid composition, and plays a key role in antigen recognition [16]. Using IgBLAST software of the NCBI immuno� logic sequence database we performed a search for closest homologs separately for the aminoacid sequences of both V�domains and the whole sequence of ScFv. Multiple alignment of the obtained ScFv’s with their closest homologs from the database revealed differences in the primary structures of VH and VL in aminoacid substitutions at certain positions (results not presented), while the structure of CDRH3�IMGT turned out to be absolutely unique (Table 2). Uniqueness of the pri� mary structure of CDRH3�IMGT as well as the absence of antibody sequences with homologous V�domains in the database, suggests that the anti� gen�binding site of the four isolated ScFv is con� formationally unique, and the sequences are novel. Comparative analysis of the CDRH3�IMGT regions of these ScFv’s has revealed a conservative motif AR_P_Y with substitutions at positions 120 (F/P) and 122 (A/N). Substantial differences were observed in CDRH1�IMGT and CDRH2�IMGT (Table 2). It is known from published data that only a slight part of the aminoacid residues of CDRs contribute significantly to the free energy (�G) of interaction with the antigen [18]. Some publications show a key role for aminoacids located in the central part of CDRH3, while the flanking aminoacids mostly stabilize the formed complex [8, 16, 19]. It is a matter of fact that single aminoacid substitutions in the central part of CDRH3 may dramatically affect antibody’s affinity and speci� ficity. The aforementioned substitutions in CDR� IMGT may explain the differences in the panel’s ScFv’s antigen�binding properties studied in the previous work [15]. We suppose the identified amino acid residues are promising targets for fur� ther ScFv’s mutagenesis. It seemed interesting to compare the structure of CDRH3�IMGT regions of ScFv’s specific to antigens rhIFN�β1b and rhIFN�α2b that are structural and functional homologs. For compari� son, we used the sequences of two highly specific ScFv’s isolated from different independently gen� erated immune libraries. For all six CDR�IMGT of ScFv’s that were compared, we observed differ� ences in the amino acid composition to the extant of individual substitutions, while CDRL1�IMGT and CDRH3�IMGT also differed by the length of the loop (Table 2, sequences #1 and ScFv (IFNα)). Taking into account the absence of crosslink bind� ing between these ScFv’s and the respective antigens, which we had shown before using ELISA, we may suppose their interaction with different epitopes. Conclusion. Within a panel of ScFv’s against rhIFN�β1b isolated from an immune combinator� ial cDNA library of mouse genes, we have revealed four sequences with different primary structures. In silico analysis has identified structurally and functionally important regions in the variable domains of the obtained ScFv’s. It has been shown that the structure of the antigen�binding site of the four isolated ScFv’s is unique, and the sequences themselves are new. ISSN 0564–3783. Цитология и генетика. 2009. № 158 A.I. Flyak, M.V. Pavlova, P.V. Gilchuk Authors are grateful to staff of Department of Functional Genomics of Institute of Molecular Biology and Genetics NAS of Ukraine for DNA sequencing. А.И. Фляк, М.В. Павлова, П.В. Гильчук IN SILICO АНАЛИЗ СТРУКТУРЫ ВАРИАБЕЛЬНЫХ ДОМЕНОВ ОДНОЦЕПОЧЕЧНЫХ АНТИТЕЛ МЫШИ, СПЕЦИФИЧНЫХ К РЕКОМБИНАНТНОМУ ИНТЕРФЕРОНУ β1b ЧЕЛОВЕКА Проведен in silico анализ структуры последователь� ностей ДНК, кодирующих специфические к интерфе� рону β1b и α2b человека (rhIFN�β1b, rhIFN�α2b) од� ноцепочечные антитела (ScFv – single�chain Fv): опре� делены V, D и J сегменты, границы антиген�связыва� ющих (CDR) и каркасных (FR) участков, n�нуклеоти� ды, а также величина мутационных процессов, кото� рые имели место при аффинном дозревании последо� вательностей in vivo. Для представителей панели ScFv против rhIFN�β1b, изолированных из иммунной ком� бинаторной библиотеки кДНК V�генов, показана уникальность участка CDRH3 как по длине, так и по аминокислотному составу. Множественное вы� равнивание с ближайшими гомологами базы данных NCBI показало, что полученные нами последователь� ности ScFv являются новыми. А.І. Фляк, М.В. Павлова, П.В. Гільчук IN SILICO АНАЛІЗ СТРУКТУРИ ВАРІАБЕЛЬНИХ ДОМЕНІВ ОДНОЛАНЦЮГОВИХ АНТИТІЛ МИШІ, СПЕЦИФІЧНИХ ДО РЕКОМБІНАНТНОГО ІНТЕРФЕРОНУ β1b ЛЮДИНИ Проведено in silico аналіз структури послідовнос� тей ДНК, які кодують специфічні до рекомбінантного інтерферону β1b та α2b людини (rhIFN�β1b, rhIFN� α2b) одноланцюгові антитіла (ScFv – single�chain Fv): визначено V�, D� та J�генні сегменти, межі антиген� зв’язувальних (CDR) та каркасних (FR) ділянок, n� нуклеотиди, а також величину мутаційних процесів, що мали місце при афінному дозріванні даних послі� довностей in vivo. Для представників панелі ScFv про� ти rhIFN�β1b, ізольованих з імунної комбінаторної бі� бліотеки кДНК V�генів, показано унікальність ділян� ки CDRH3 як за довжиною, так і за амінокислотним складом. Множинне вирівнювання з найближчими гомологами бази даних NCBI показало, що одержані нами послідовності ScFv є новими. REFERENCES 1. Bird R.E., Hardman K.D., Jacobson J.W., Johnson S., Kaufman B.M., Lee S.M., Lee T., Pope S.H., Riordan G.S., Whitlow M. Single�chain antigen�binding proteins // Science. – 1988. – 242, № 4877. – P. 423–426. 2. Hoogenboom H.R. Overview of antibody phage�display technology and its applications // Meth. Mol. Biol. – 2002. – 178, № – P. 1–37. 3. Bradbury A., Marks J.D. Antibodies from Phage anti� body libraries // J. Immunol. Meth. – 2004. – 290, № 1/2. – P. 29–49. 4. Kepler T.B., Borrero M., Rugerio B., McCray S.K., Clarke S.H. Interdependence of N nucleotide addition and recombination site choice in V (D) J rearrange� ment // J. Immunol. – 1996. – 157, № 10. – P. 4451– 4457. 5. Jones P.T., Dear P.H., Foote J., Neuberger M.S., Winter G. Replacing the complementarity�determining regions in a human antibody with those from a mouse // Nature. – 1986. – 321, № 6069. – P. 522–525. 6. Dubel S. Recombinant therapeutic antibodies // Appl. microbiol. biotechnol. – 2007. – 74, № 4. – P. 723– 729. 7. Knappik A., Ge L., Honegger A., Pack P., Fischer M., Wellnhofer G., Hoess A., Wolle J., Pluckthun A., Vir� nekas B. Fully synthetic human combinatorial antibody libraries (HuCAL) based on modular consensus frame� works and CDRs randomized with trinucleotides // J. Mol. Biol. – 2000. – 296, № 1. – P. 57–86. 8. Rothe C., Urlinger S., Lohning C., Prassler J., Stark Y., Jager U., Hubner B., Bardroff M., Pradel I., Boss M., Bittlingmaier R., Bataa T., Frisch C., Brocks B., Honegger A., Urban M. The human сombinatorial anti� body library HuCAL GOLD combines diversification of all six CDRs according to the natural immune sys� tem with a novel display method for efficient selection of high�affinity antibodies // J. Mol. Biol. – 2008. – 376. – P. 1182–1200. 9. Sidhu S.S., Li B., Chen Y., Fellouse F.A., Eigenbrot C., Fuh G. Phage�displayed antibody libraries of synthetic heavy chain complementarity determining regions // J. Mol. Biol. – 2004. – 338, № 2. – P. 299–310. 10. Li K.B. ClustalW�MPI: ClustalW analysis using distri� buted and parallel computing // Bioinformatics. – 2003. – 19, № 12. – P. 1585–1586. 11. Volpe J.M., Cowell L.G., Kepler T.B. SoDA: implemen� tation of a 3D alignment algorithm for inference of antigen receptor recombinations // Bioinformatics. – 2006. – 22, № 4. – P. 438–444. 12. Giudicelli V., Lefranc M.P. Ontology for immunogenet� ics: the IMGT�ONTOLOGY // Bioinformatics. – 1999. – 15, № 12. – P. 1047–1054. 13. Lefranc M.P., Pommie C., Ruiz M., Giudicelli V., Foulquier E., Truong L., Thouvenin�Contet V., Lefranc G. IMGT unique numbering for immunoglobulin and T cell receptor variable domains and Ig superfamily V� like domains // Dev. Comp. Immunol. – 2003. – 27, № 1. – P. 55–77. ІSSN 0564–3783. Цитология и генетика. 2009. № 1 59 In silico analysis of the structure of variable domains of mouse single�chain 14. Pavlova M.V., Gilchuk P.V., Pokholenko Ya.O., Niko� layev Yu.S., Kordium V.A. Construction and character� ization of immune cDNA combinatorial antibody library of mouse variable immunoglobuline genes // Cytology and Genetics. – 2008. – 42, № 2. – P. 10–15. 15. Pavlova M.V., Nikolayev U.S., Irodov D.M., Kordium V.A., Gilchuk P.V. Characterization of a panel of mouse single�chain antibodies against human recombinant interferon β1b // Cytology and Genetics. – 2008. – 42, № 4. – P. 3–11. 16. Xu J.L., Davis M.M. Diversity in the CDR3 region of V (H) is sufficient for most antibody specificities // Immunity. – 2000. – 13, № 1. – P. 37–45. 17. Okunev O.V., Gilchuk P.V., Irodov D.M., Deryabina O.G. Obtaining and characterization of the single chain anti� bodies against human alpha2b�interferon // Ukrainan Biochemical Journal. – 2005. – 77, № 5. – P. 106– 115. 18. Kelley R.F., O’Connell M.P. Thermodynamic analysis of an antibody functional epitope // Biochemistry. – 1993. – 32, № 27. – P. 6828–6835. 19. Honegger A. Engineering antibodies for stability and efficient folding // Handbook of Experimental Pharmacology. Therapeutic Antibodies / Eds Y. Chernajovsky, A. Nissim – Heidelberg : Springer Berlin, 2008. – Vol. 181. – P. 47–68. Received 10.07.08 ISSN 0564–3783. Цитология и генетика. 2009. № 160 A.I. Flyak, M.V. Pavlova, P.V. Gilchuk
id nasplib_isofts_kiev_ua-123456789-66623
institution Digital Library of Periodicals of National Academy of Sciences of Ukraine
issn 0564-3783
language English
last_indexed 2025-12-07T13:20:14Z
publishDate 2009
publisher Інститут клітинної біології та генетичної інженерії НАН України
record_format dspace
spelling Flyak, A.I.
Pavlova, M.V.
Gilchuk, P.V.
2014-07-19T12:20:51Z
2014-07-19T12:20:51Z
2009
In silico analysis of the structure of variable domains of mouse single-chain antibodies specific to the human recombinant interferon β1b / A.I. Flyak, M.V. Pavlova, P.V. Gilchuk // Цитология и генетика. — 2009. — Т. 43, № 1. — С. 54-60. — Бібліогр.: 19 назв. — англ.
0564-3783
https://nasplib.isofts.kiev.ua/handle/123456789/66623
577.27
In silico analysis of the DNA encoding singlechain Fv antibodies (ScFv) specific to the human recombinant interferon β1b and α2b (rhIFNβ1b, rhIFNα2b) has been carried out. The V, D and J-gene segments, the complementaritydetermining (CDR) and framework (FR) regions, n-nucleotides as well as mutation rates which take place during the affinity maturation of the examined sequences have been determined. For the panel of ScFv against rhIFNβ1b isolated from an immune combinatorial cDNA library uniqueness of the CDRH3 loop by the length and amino acid composition has been shown. Multiple alignments with the nearest homologies from the NCBI databases have revealed that the sequences of ScFv obtained are new.
Проведен in silico анализ структуры последовательностей ДНК, кодирующих специфические к интерферону β1b и α2b человека (rhIFN β1b, rhIFN α2b) одноцепочечные антитела (ScFv – single chain Fv): определены V, D и J сегменты, границы антиген связывающих (CDR) и каркасных (FR) участков, n нуклеотиды, а также величина мутационных процессов, которые имели место при аффинном дозревании последовательностей in vivo. Для представителей панели ScFv против rhIFN β1b, изолированных из иммунной комбинаторной библиотеки кДНК V генов, показана уникальность участка CDRH3 как по длине, так и по аминокислотному составу. Множественное выравнивание с ближайшими гомологами базы данных NCBI показало, что полученные нами последовательности ScFv являются новыми.
Проведено in silico аналіз структури послідовностей ДНК, які кодують специфічні до рекомбінантного інтерферону β1b та α2b людини (rhIFN β1b, rhIFN-α2b) одноланцюгові антитіла (ScFv – single chain Fv): визначено V , D та J генні сегменти, межі антигензв’язувальних (CDR) та каркасних (FR) ділянок, n- нуклеотиди, а також величину мутаційних процесів, що мали місце при афінному дозріванні даних послідовностей in vivo. Для представників панелі ScFv проти rhIFN β1b, ізольованих з імунної комбінаторної бібліотеки кДНК V генів, показано унікальність ділянки CDRH3 як за довжиною, так і за амінокислотним складом. Множинне вирівнювання з найближчими гомологами бази даних NCBI показало, що одержані нами послідовності ScFv є новими.
Authors are grateful to staff of Department of Functional Genomics of Institute of Molecular Biology and Genetics NAS of Ukraine for DNA sequencing.
en
Інститут клітинної біології та генетичної інженерії НАН України
Цитология и генетика
Оригинальные работы
In silico analysis of the structure of variable domains of mouse single-chain antibodies specific to the human recombinant interferon β1b
In silico анализ структуры вариабельных доменов одноцепочечных антител мыши, специфичных к рекомбинантному интерферону β1b человека
In silico аналіз структури варіабельних доменів одноланцюгових антитіл миші, специфічних до рекомбінантного інтерферону β1b людини
Article
published earlier
spellingShingle In silico analysis of the structure of variable domains of mouse single-chain antibodies specific to the human recombinant interferon β1b
Flyak, A.I.
Pavlova, M.V.
Gilchuk, P.V.
Оригинальные работы
title In silico analysis of the structure of variable domains of mouse single-chain antibodies specific to the human recombinant interferon β1b
title_alt In silico анализ структуры вариабельных доменов одноцепочечных антител мыши, специфичных к рекомбинантному интерферону β1b человека
In silico аналіз структури варіабельних доменів одноланцюгових антитіл миші, специфічних до рекомбінантного інтерферону β1b людини
title_full In silico analysis of the structure of variable domains of mouse single-chain antibodies specific to the human recombinant interferon β1b
title_fullStr In silico analysis of the structure of variable domains of mouse single-chain antibodies specific to the human recombinant interferon β1b
title_full_unstemmed In silico analysis of the structure of variable domains of mouse single-chain antibodies specific to the human recombinant interferon β1b
title_short In silico analysis of the structure of variable domains of mouse single-chain antibodies specific to the human recombinant interferon β1b
title_sort in silico analysis of the structure of variable domains of mouse single-chain antibodies specific to the human recombinant interferon β1b
topic Оригинальные работы
topic_facet Оригинальные работы
url https://nasplib.isofts.kiev.ua/handle/123456789/66623
work_keys_str_mv AT flyakai insilicoanalysisofthestructureofvariabledomainsofmousesinglechainantibodiesspecifictothehumanrecombinantinterferonβ1b
AT pavlovamv insilicoanalysisofthestructureofvariabledomainsofmousesinglechainantibodiesspecifictothehumanrecombinantinterferonβ1b
AT gilchukpv insilicoanalysisofthestructureofvariabledomainsofmousesinglechainantibodiesspecifictothehumanrecombinantinterferonβ1b
AT flyakai insilicoanalizstrukturyvariabelʹnyhdomenovodnocepočečnyhantitelmyšispecifičnyhkrekombinantnomuinterferonuβ1bčeloveka
AT pavlovamv insilicoanalizstrukturyvariabelʹnyhdomenovodnocepočečnyhantitelmyšispecifičnyhkrekombinantnomuinterferonuβ1bčeloveka
AT gilchukpv insilicoanalizstrukturyvariabelʹnyhdomenovodnocepočečnyhantitelmyšispecifičnyhkrekombinantnomuinterferonuβ1bčeloveka
AT flyakai insilicoanalízstrukturivaríabelʹnihdomenívodnolancûgovihantitílmišíspecifíčnihdorekombínantnogoínterferonuβ1blûdini
AT pavlovamv insilicoanalízstrukturivaríabelʹnihdomenívodnolancûgovihantitílmišíspecifíčnihdorekombínantnogoínterferonuβ1blûdini
AT gilchukpv insilicoanalízstrukturivaríabelʹnihdomenívodnolancûgovihantitílmišíspecifíčnihdorekombínantnogoínterferonuβ1blûdini