Obtaining of transgenic french bean plants (Phaseolus vulgaris L.) resistant to the herbicide pursuit by Agrobacterium-mediated transformation

The transgenic plants of French bean (Phaseolus vulgaris) resistant herbicide Pursuit and kanamycin have been obtained. The genetic transformation was carried out with Agrobacterium tumefaciens strain LBA4404 containing binary vector carrying mutant ahas/als and selective nptII genes. Integration of...

Повний опис

Збережено в:
Бібліографічні деталі
Опубліковано в: :Цитология и генетика
Дата:2011
Автори: Nifantova, S.N., Komarnickiy, I.K., Kuchuk, N.V.
Формат: Стаття
Мова:Англійська
Опубліковано: Інститут клітинної біології та генетичної інженерії НАН України 2011
Теми:
Онлайн доступ:https://nasplib.isofts.kiev.ua/handle/123456789/66831
Теги: Додати тег
Немає тегів, Будьте першим, хто поставить тег для цього запису!
Назва журналу:Digital Library of Periodicals of National Academy of Sciences of Ukraine
Цитувати:Obtaining of transgenic french bean plants (Phaseolus vulgaris L.) resistant to the herbicide pursuit by Agrobacterium-mediated transformation / S.N. Nifantova, I.K. Komarnickiy, N.V. Kuchuk // Цитология и генетика. — 2011. — Т. 45, № 2. — С. 41-45. — Бібліогр.: 22 назв. — англ.

Репозитарії

Digital Library of Periodicals of National Academy of Sciences of Ukraine
_version_ 1860264067649765376
author Nifantova, S.N.
Komarnickiy, I.K.
Kuchuk, N.V.
author_facet Nifantova, S.N.
Komarnickiy, I.K.
Kuchuk, N.V.
citation_txt Obtaining of transgenic french bean plants (Phaseolus vulgaris L.) resistant to the herbicide pursuit by Agrobacterium-mediated transformation / S.N. Nifantova, I.K. Komarnickiy, N.V. Kuchuk // Цитология и генетика. — 2011. — Т. 45, № 2. — С. 41-45. — Бібліогр.: 22 назв. — англ.
collection DSpace DC
container_title Цитология и генетика
description The transgenic plants of French bean (Phaseolus vulgaris) resistant herbicide Pursuit and kanamycin have been obtained. The genetic transformation was carried out with Agrobacterium tumefaciens strain LBA4404 containing binary vector carrying mutant ahas/als and selective nptII genes. Integration of the transgenes into plant genome was confirmed by polymerase chain reaction. Получены трансгенные растения фасоли обыкновенной (Phaseolus vulgaris), которые содержат ген ahas/als, обусловливающий устойчивость к гербициду Pursuit. Генетическую трансформацию осуществляли с использованием штамма Agrobacterium tumefaciens LBA4404, который содержит плазмиду pCB004, с мутантным геном ahas/als и маркерным геном nptII, обусловливающим устойчивость к канамицину. Селектирован ряд устойчивых к гербициду Pursuit и канамицину линий. Интеграция перенесенных генов в растительный геном доказана при помощи метода полимеразной цепной реакции. Отримано трансгенні рослини квасолі звичайноі (Phaseolus vulgaris), які містять мутантний ген ahas/als, що обумовлює стійкість до гербіциду Pursuit. Генетичну трансформацію проводили за допомогою штаму Agrobacterium tumefaciens LBA4404 з використанням плазміди pCB004, яка містила мутантний ген ahas/als та маркерний ген nptII, що обумовлює стійкість до канаміцинсульфату. Інтеграція перенесених генів у рослинний геном доведена за допомогою полімеразної ланцюгової реакції.
first_indexed 2025-12-07T18:58:29Z
format Article
fulltext УДК 577.21:582.739:581.143 S.N. NIFANTOVA, I.K. KOMARNICKIY, N.V. KUCHUK Institute of Cell Biology and Genetic Engineering National Academy of Sciences of Ukraine, Kyiv E�mail: sveta@iicb.kiev.ua OBTAINING OF TRANSGENIC FRENCH BEAN PLANTS (PHASEOLUS VULGARIS L.) RESISTANT TO THE HERBICIDE PURSUIT BY AGROBACTERIUM� MEDIATED TRANSFORMATION The transgenic plants of French bean (Phaseolus vulgaris) resistant herbicide Pursuit and kanamycin have been obtained. The genetic transformation was carried out with Agrobacterium tumefaciens strain LBA4404 containing bina� ry vector carrying mutant ahas/als and selective nptII genes. Integration of the transgenes into plant genome was confirmed by polymerase chain reaction. Introduction. Herbicide Pursuit belongs to imi� dozolinone group and inhibits the acetolactate syn� thase enzyme involved into biosynthesis of hydro� xyaminoacids such as valine, leucine, isoleucine. The mechanism of imidozolinone effects has lots in common with the one of sulfonylurea [1, 2]. Plant resistance to this herbicide is caused by the acetolactate synthase (ahas/als) gene mutation that consequently changes proline for serine in position 197 [3]. The imidasolinone�resistant plants were obtained by mutagenesis [4] as well as transferring of the mutant acetolactate synthase gene to plant tissues [5–8]. Sulfonylurea�resistant mutants were obtained for Nicotiana tabacum [9], Arabidopsis thaliana [4], soybeans [10], Brassica napus [11], Datura innoxia [12], Zea mays [13]. Transgenic sulphonilurea�resist� ant Nicotiana tabacum plants were obtained as well [14]. We have also obtained the Pursuit�resistant transgenic plants of pea (Pisum sativum L.) [15]. French bean (Phaseolus vulgaris L.) belongs to the leguminous plants. Genetic transformation is expected to improve its edible qualities and form the new plant properties such as resistance to dis� eases, herbicides, pests and abiotic stresses. There are only few reports describing transgenic French bean production. Genetically transformed plants of French bean were developed by the method of particle bombardment [16]. The obtained plants contained gus and neo genes, which were co�intro� duced with methionine�rich 2S albumine gene isolated from Brazil nut and antisense sequence of AC1, AC2, AC3 and BC1 genes from bean golden mosaic geminivirus. Simultaneously transgenic plants of French bean with gus reporter gene were obtained by particle bombardment [17]. Tepary bean (Phaseolus acutifolius L. Gray) transgenic plants containing gus, nptII genes and arceline protein gene conferring resistance to insects (Coleoptera, Bruchidae) were obtained via Agrobacterium tume� faciens�mediated transformation [18]. There is one report describing the production of French bean transgenic «hairy roots» carrying gus and gfр genes [19]. The purpose of this work was to develop Agro� bacterium�mediated transformation protocol and to construct transgenic French bean (Phaseolus vulgaris L.) plants resistant to herbicide Pursuit. Materials and methods. Aseptically growing French bean (Phaseolus vulgaris L.) plants of «Krasnoperaya», «Nezhnost» and «Chudesnaya» varieties were used for this study. ІSSN 0564–3783. Цитология и генетика. 2011. № 2 41 © S.N. NIFANTOVA, I.K. KOMARNICKIY, N.V. KUCHUK, 2011 Genetic transformation was carried out with Agrobacterium tumefaciens strain LBA4404 contain� ing mutant ahas/als gene and neomycine phos� photransferase II selectable (nptII) marker gene in the binary vector pCB004. Plant leaves and stems were cut into explants and put onto basal B5 [20] agar solidified medium with 1 mg/l 2,4�D, 0.2 mg/l ВАР and 0.5 mg/l ade� nine for callus initiation. After 2–3 weeks the calli were transferred to the same but liquid medium and Agrobacterium tumefaciens overnight grown culture was added in proportion 1/100. Co�cultivation was held on at 22 °С in the dark for 48 hours. Callus was infiltrated, washed by sterile water and put onto the agar solidified nutrient B5 medi� um containing 400 mg/l cephotoxime for bacteria elimination and 40 μg/l Pursuit and 100 mg/l kanamycin. In 4–6 weeks the selected callus clones were put on the regeneration medium with B5 basal components, 2 mg/l ВАР, 0.2 mg/l ІAA, Ag2S2O3 and the same selective agents. Ag2S2O3 was added as 5 mg/l AgNO3 + 248 mg/l Na2S2O3. Regenerated shoots were transferred onto hor� mone free B5 medium for root formation. Fully formed plants were put from aseptic conditions into soil in humidity chamber for 2–3 days. Finally, plants grown in greenhouse formed flowers and seeds after manual pollination. Primers for amplification of ahas/als gene sequence f.5'�CCGAGCTCACACATTTCTCG�3', r. 5'�AAGGTTCTGATAATCACCGG�3' and the ones for amplification of nptII gene f. 5'�GAGGC� TATTCGGCTATGACTG�3', r. 5'�CAAGCTCT� TCAGCAATATCACG�3' were used for poly� merase chain reaction (PCR). 300�bp fragment was amplified by PCR for ahas/als gene and 647� bp fragment was amplified for nptII gene. The sample of 10 ng of total plant DNA extracted by CTAB method was used for this reaction [21]. The PCR reaction was carried out on Eppendorf Mastercycler personal and the mixture in total vol� ume of 50 μl contained of 39 μl with template DNA, 1 μl of each the primers (50 μM), 4 μl dNTPs (2.5 mM), 5 μl 10�Taq buffer and 1 μl with 1 unit of Taq polymerase Template DNA was ini� tially denatured at 95 °С for 3 min. Reaction fol� lowed by 35 cycles of PCR amplification under the following conditions: 45 s denaturation at 95 °С, 30 s primer annealing at 50 °С for ahas/als gene and 56 °С for nptII gene, and 45 s primer exten� sion at 72 °С. Final 6 min incubation at 72 °С was allowed for complementation of the fragment. After 40�cycled amplification the samples were fractionated in 2 % agar gel in the field voltage of 100 V/cm for 2 hours in TBE�buffer. The gels were stained by ethidium bromide. Results and discussion. The selective concentra� tion of herbicide Pursuit for callus tissues of all the studied bean varieties was specified to be 40 μg/l. The herbicide effect on callus tissues caused the stop of their biomass increasing and led to death at last. Genetic transformation was carried out with Agrobacterium tumefaciens harbouring pCB004 plas� mid for transferring mutant ahas/als gene and selective nptII gene as described in «Material and Methods» section. Selection was done on the agar� solidified callus inducing medium with 40 μg/l Pursuit and 100 mg/l kanamicyn. Selected callus clones were put on the regeneration medium with the same selective substances and Ag2S2O3. Silver thiosulfate is known for its antiethylene effect that ISSN 0564–3783. Цитология и генетика. 2011. № 242 S.N. Nifantova, I.K. Komarnickiy, N.V. Kuchuk Fig. 1. The selection and regeneration processes of French bean variety «Krasnoperaya» on the regeneration B5 medium with 2 mg/l ВАР, 0.2 mg/l IAA, Ag2S2O3, 40 μg/l Pursuit and 100 mg/l kanamicyn The number of regenerating and transgenic lines of bean Lines Climbing bean «Chudesnaya» Climbing bean «Nezhnost» French bean «Krasnoperaya» 0 5 13 0 3 10 The number transgenic plants obtained led to promotion of the regeneration capacity for calli. [22]. In 2–3 months some of the selected calli formed dark green regenerating spots that were used for further shoot regeneration (Fig. 1). The regeneration frequencies varied from 1.7 to 7.5 %. The results of the regenerating lines selec� tion are shown in the Table. There were no morphogenesis or callus forma� tion observed for control (not treated with Adrobac� terium) explants on selective medium with kanami� cyn and Pursuit for all tested French bean culti� vars. Due to the poor regeneration ability of bean «Chudesnaya» we didn’t manage to obtain the transformants. All the obtained regeneration lines were analysed using PCR analysis for the ahas/als and nptII trans� genes. There were 3 regeneration lines of «Nezh� nost» variety and 10 lines of «Krasnoperaya» variety that had positive signals after PCR analysis. The results for ahas/als gene are shown on the fig. 2 and for nptII gene on the fig. 3. The transformation frequencies varied from 2.8 to 17.4 %. The obtained transgenic French bean plants were rooted and then bloomed in vitro though they did not form seeds. But we managed to get seeds in greenhouse after manual pollination (Fig. 4). The present work is to the best of our knowledge the first report where transgenic plants of French bean have been obtained through Agrobacterium tumefaciens transformation. Developed protocol allowed us to get Pursuit resistant bean plants. Early we reported about regeneration of Pursuit� resistant transgenic plants of pea (Pisum sativum ІSSN 0564–3783. Цитология и генетика. 2011. № 2 43 Obtaining of transgenic French bean plants (Phaseolus vulgaris L.) resistant Fig. 2. PCR amplification of ahas/als gene fragment from plant DNA of the transformed lines of beans: 1 – molecular marker, 2 – positive control (plasmid pCB004), 3 – untrans� formed line, 4–7 – transformed lines (4 – R8, 5 – R6, 6 – R7, 7 – R9), 8 – negative control without DNA Fig. 3. PCR�analysis of gene nptII presence in plant DNA of the transformed lines of beans: 1 – molecular marker, 2 – positive control (plasmid pCB004), 3 – the untransformed line, 4–8 – transformed lines (4 – R8, 5 – R6, 6 – R7, 7 – R9, 8 – R10) Fig. 4. The transgenic French bean plant of «Krasnoperaya» variety in the soil L.) [15]. This communication confirms the effi� ciency of the worked�out protocols for genetic transformation of some leguminous plants. С.Н. Нифонтова, И.К. Комарницкий, Н.В. Кучук ПОЛУЧЕНИЕ ТРАНСГЕННЫХ PURSUIT�УСТОЙЧИВЫХ РАСТЕНИЙ ФАСОЛИ ОБЫКНОВЕННОЙ (PHASEOLUS VULGARIS L.) МЕТОДОМ АГРОБАКТЕРИАЛЬНОЙ ТРАНСФОРМАЦИИ Получены трансгенные растения фасоли обыкно� венной (Phaseolus vulgaris), которые содержат ген ahas/als, обусловливающий устойчивость к гербициду Pursuit. Генетическую трансформацию осуществляли с использованием штамма Agrobacterium tumefaciens LBA4404, который содержит плазмиду pCB004, с му� тантным геном ahas/als и маркерным геном nptII, обусловливающим устойчивость к канамицину. Селек� тирован ряд устойчивых к гербициду Pursuit и кана� мицину линий. Интеграция перенесенных генов в растительный геном доказана при помощи метода по� лимеразной цепной реакции. С.М. Нифонтова, І.К. Комарницький, М.В. Кучук ОТРИМАННЯ ТРАНСГЕННИХ РОСЛИН КВАСОЛІ ЗВИЧАЙНОЇ (PHASEOLUS VULGARIS L.), СТІЙКИХ ДО ГЕРБІЦИДУ PURSUIT, ЗА ДОПОМОГОЮ АГРОБАКТЕРІАЛЬНОЇ ТРАНСФОРМАЦІЇ Отримано трансгенні рослини квасолі звичайноі (Phaseolus vulgaris), які містять мутантний ген ahas/als, що обумовлює стійкість до гербіциду Pursuit. Генетич� ну трансформацію проводили за допомогою штаму Agrobacterium tumefaciens LBA4404 з використанням плазміди pCB004, яка містила мутантний ген ahas/als та маркерний ген nptII, що обумовлює стійкість до ка� наміцинсульфату. Інтеграція перенесених генів у рос� линний геном доведена за допомогою полімеразної ланцюгової реакції. REFERENCES 1. Hattori J., Rutledge R., Labbe H., Brown D., Sunohara G., Miki B. Multiple resistance to sulfonylureas and imida� zolinones conferred by an acetohydroxyacid synthase gene with separate mutations for selective resistanse // Mol. Gen. Genet. – 1992. – 232. – P. 167–173. 2. Li Z., Hayashimoto A., Murai N. A sulfonylurea herbi� cide resistance gene from Аrabidopsis thaliana as a new selectable marker for production of fertile transgenic rice // Plants. Plant Physiol. – 1992. – 100 (2). – P. 662– 668. 3. Yadav N., McDevitt R.E., Benard S., Falco S.C. Single amino acid substitutions in the enzyme acetolactate synthase confer resistance to the herbicide sulfometur� on methyl // Proc. Nat. Acad. Sci. USA. – 1986. – 83. – P. 4418–4422. 4. Haughn G.W., Somerville C. Sulfonylurea�resistant Arabidopsis thaliana // Mol. Gen. Genet. – 1986. – 204. – P. 430–434. 5. Haugh G.W., Smith J., Mazur B., Somerville C. Transfor� mation with a mutant Arabidopsis acetolactate synthase gene renders tobacco resistant to sulfonylurea herbi� cides // Mol. Gen. Genet. – 1988. – 211. – P. 266– 271. 6. Lee K.Y., Townsend J., Tepperman J., Black M., Chui C.F., Mazur B., Dunsmuir P., Bedbrook J. The molecular basis of sulfonylurea herbicide resistance in tobacco // EMBO J. – 1988. – 7(5). – P. 1241–1248. 7. Pogrebnyak N.Ya., Kravets O.A., Shisha E.N., Gleba Yu.Yu. Production of cell lines and plants of potato resistant to herbicide effect // Cytology and Genetics.– 1992. – 26. – P. 50–55 (in Russian). 8. Smith J.K., Mauvais C.J., Knowlton S., Mazur B.J. Molecular biology of resistance to sulfonylurea herbi� cides // Proc. ACS Symp. Biotechnol. Crop Protect. – Washington, 1988. – P. 25–36. 9. Ray T.B. Site of action of chlorsulfuron: inhibition of valine and isoleucine biosynthesis in plants // Plant Physiol. – 1984. – 75(3). – P. 827–831. 10. Sebastion S.A., Chaleff R.S. Soybean mutants with increased tolerance for the sulfonylurea herbicides // Crop Sci. – 1987. – 27. – P. 948–952. 11. Swanson E.B., Herrgesell M.J., Arnoldo M., Sippell D.W., Wong R.S.C. Microspore mutagenesis and selec� tion : Canola plants with field tolerance to the imida� zolinones // Theor. Appl. Genet. – 1989. – 78. – P. 525– 530. 12. Saxena P.K., King J. Herbicide resistance in Datura innoxia: cross�resistance of sulfonylurea�resistant cell lines to imidazolinones // Plant Physiol. – 1989. – 86(3). – P. 863–867. 13. Shaner D.L., Anderson P.C. Mechanism of action of the imidazolinones and cell culture selection of tolerant maize // Biotechnology in plant science / Eds M. Zaitlin, P.R. Day, A. Hollaender. – New York : Acad. рress, 1984. – P. 287–300. 14. Gabard J.M., Charest P.J., Iyer V.N., Miki B.L. Cross� resistance to short residual sulfonylurea herbicides in transgenic tobacсo // Plants. Plant Physiol. – 1989. – 91. – P. 574–580. 15. Nifantova S.N., Simonenko Yu., Komarnitskii I.K., Kuchuk N.V. Production of transgenic pea (Pisum sativum L.) plants resistant to the herbicide pursuit // Cytology and Genetics. – 2005. – 39, № 2. – P. 16–21 (in Russian). 16. Aragao F.J.L., Barros L.M.J., Brasileiro A.S.M., Ribei� ro S.G., Smith F.D., Sanford J.C., Faria J.C., Rech E.L. ISSN 0564–3783. Цитология и генетика. 2011. № 244 S.N. Nifantova, I.K. Komarnickiy, N.V. Kuchuk Inheritance of foreign genes in transgenic been (Phaseolus vulgaris L.) co�transformed via particle bombardment // Theor. Appl. Genet. – 1996. – 93. – P. 142–150. 17. Jae W.K., Minamikawa T. Transformation and regener� ation of French been plants by the particle bombard� ment process // Plant Sci. – 1996. – 117. – P. 131– 138. 18. Zambre M., Goossens A., Cardona C., Van Montagu M., Terryn N., Angenon G. A reproducible genetic transfor� mation system for cultivated Phaseolus acutifolius (tepary bean) and its use to assess the role of arcelins in resistance to the Mexican bean weevil // Theor. Appl. Genet. – 2005. – 110 (5). – P. 914–924. 19. Estrada�Navarrete G., Alvarado�Affantranger X., Oliva� res J.E., Diaz�Camino C., Santana O., Murillo E., Guil� lén G., Sánchez�Guevara N., Acosta J., Quinto C., Li D., Gresshoff P.M., Sánchez F. Agrobacterium rhizogenes transformation of the Phaseolus spp.: a tool for func� tional genomics // Mol. Plant Microbe Interact. – 2006. – 19(12). – P. 1385–1393. 20. Gamborg O.L., Miller R.A., Ojima K. Nutrient require� ments of suspension cultures of soybean foot cells // Exp. Cell Res. – 1968. – 50, № 1. – P. 151–158. 21. Murray M.J., Thompson W.E. Rapid isolation of high molecular weight DNA // Nucl. Acids Res. – 1980. – № 19. – P. 4321–4325. 22. De Block M. Genotype�independent leaf disc transfor� mation of potato (Solanum tuberosum) using Agrobac� terium tumefaciens // Theor. Appl. Genet. – 1988. – 76. – P. 767–774. Received 01.04.10 ІSSN 0564–3783. Цитология и генетика. 2011. № 2 45 Obtaining of transgenic French bean plants (Phaseolus vulgaris L.) resistant
id nasplib_isofts_kiev_ua-123456789-66831
institution Digital Library of Periodicals of National Academy of Sciences of Ukraine
issn 0564-3783
language English
last_indexed 2025-12-07T18:58:29Z
publishDate 2011
publisher Інститут клітинної біології та генетичної інженерії НАН України
record_format dspace
spelling Nifantova, S.N.
Komarnickiy, I.K.
Kuchuk, N.V.
2014-07-23T06:10:42Z
2014-07-23T06:10:42Z
2011
Obtaining of transgenic french bean plants (Phaseolus vulgaris L.) resistant to the herbicide pursuit by Agrobacterium-mediated transformation / S.N. Nifantova, I.K. Komarnickiy, N.V. Kuchuk // Цитология и генетика. — 2011. — Т. 45, № 2. — С. 41-45. — Бібліогр.: 22 назв. — англ.
0564-3783
https://nasplib.isofts.kiev.ua/handle/123456789/66831
577.21:582.739:581.143
The transgenic plants of French bean (Phaseolus vulgaris) resistant herbicide Pursuit and kanamycin have been obtained. The genetic transformation was carried out with Agrobacterium tumefaciens strain LBA4404 containing binary vector carrying mutant ahas/als and selective nptII genes. Integration of the transgenes into plant genome was confirmed by polymerase chain reaction.
Получены трансгенные растения фасоли обыкновенной (Phaseolus vulgaris), которые содержат ген ahas/als, обусловливающий устойчивость к гербициду Pursuit. Генетическую трансформацию осуществляли с использованием штамма Agrobacterium tumefaciens LBA4404, который содержит плазмиду pCB004, с мутантным геном ahas/als и маркерным геном nptII, обусловливающим устойчивость к канамицину. Селектирован ряд устойчивых к гербициду Pursuit и канамицину линий. Интеграция перенесенных генов в растительный геном доказана при помощи метода полимеразной цепной реакции.
Отримано трансгенні рослини квасолі звичайноі (Phaseolus vulgaris), які містять мутантний ген ahas/als, що обумовлює стійкість до гербіциду Pursuit. Генетичну трансформацію проводили за допомогою штаму Agrobacterium tumefaciens LBA4404 з використанням плазміди pCB004, яка містила мутантний ген ahas/als та маркерний ген nptII, що обумовлює стійкість до канаміцинсульфату. Інтеграція перенесених генів у рослинний геном доведена за допомогою полімеразної ланцюгової реакції.
en
Інститут клітинної біології та генетичної інженерії НАН України
Цитология и генетика
Оригинальные работы
Obtaining of transgenic french bean plants (Phaseolus vulgaris L.) resistant to the herbicide pursuit by Agrobacterium-mediated transformation
Получение трансгенных pursuit-устойчивых растений фасоли обыкновенной (Phaseolus vulgaris L.) методом агробактериальной трансформации
Отримання трансгенних рослин квасолі звичайної (Phaseolus vulgaris L.), стійких до гербіциду pursuit, за допомогою агробактеріальної трансформації
Article
published earlier
spellingShingle Obtaining of transgenic french bean plants (Phaseolus vulgaris L.) resistant to the herbicide pursuit by Agrobacterium-mediated transformation
Nifantova, S.N.
Komarnickiy, I.K.
Kuchuk, N.V.
Оригинальные работы
title Obtaining of transgenic french bean plants (Phaseolus vulgaris L.) resistant to the herbicide pursuit by Agrobacterium-mediated transformation
title_alt Получение трансгенных pursuit-устойчивых растений фасоли обыкновенной (Phaseolus vulgaris L.) методом агробактериальной трансформации
Отримання трансгенних рослин квасолі звичайної (Phaseolus vulgaris L.), стійких до гербіциду pursuit, за допомогою агробактеріальної трансформації
title_full Obtaining of transgenic french bean plants (Phaseolus vulgaris L.) resistant to the herbicide pursuit by Agrobacterium-mediated transformation
title_fullStr Obtaining of transgenic french bean plants (Phaseolus vulgaris L.) resistant to the herbicide pursuit by Agrobacterium-mediated transformation
title_full_unstemmed Obtaining of transgenic french bean plants (Phaseolus vulgaris L.) resistant to the herbicide pursuit by Agrobacterium-mediated transformation
title_short Obtaining of transgenic french bean plants (Phaseolus vulgaris L.) resistant to the herbicide pursuit by Agrobacterium-mediated transformation
title_sort obtaining of transgenic french bean plants (phaseolus vulgaris l.) resistant to the herbicide pursuit by agrobacterium-mediated transformation
topic Оригинальные работы
topic_facet Оригинальные работы
url https://nasplib.isofts.kiev.ua/handle/123456789/66831
work_keys_str_mv AT nifantovasn obtainingoftransgenicfrenchbeanplantsphaseolusvulgarislresistanttotheherbicidepursuitbyagrobacteriummediatedtransformation
AT komarnickiyik obtainingoftransgenicfrenchbeanplantsphaseolusvulgarislresistanttotheherbicidepursuitbyagrobacteriummediatedtransformation
AT kuchuknv obtainingoftransgenicfrenchbeanplantsphaseolusvulgarislresistanttotheherbicidepursuitbyagrobacteriummediatedtransformation
AT nifantovasn polučenietransgennyhpursuitustoičivyhrasteniifasoliobyknovennoiphaseolusvulgarislmetodomagrobakterialʹnoitransformacii
AT komarnickiyik polučenietransgennyhpursuitustoičivyhrasteniifasoliobyknovennoiphaseolusvulgarislmetodomagrobakterialʹnoitransformacii
AT kuchuknv polučenietransgennyhpursuitustoičivyhrasteniifasoliobyknovennoiphaseolusvulgarislmetodomagrobakterialʹnoitransformacii
AT nifantovasn otrimannâtransgennihroslinkvasolízvičainoíphaseolusvulgarislstíikihdogerbícidupursuitzadopomogoûagrobakteríalʹnoítransformacíí
AT komarnickiyik otrimannâtransgennihroslinkvasolízvičainoíphaseolusvulgarislstíikihdogerbícidupursuitzadopomogoûagrobakteríalʹnoítransformacíí
AT kuchuknv otrimannâtransgennihroslinkvasolízvičainoíphaseolusvulgarislstíikihdogerbícidupursuitzadopomogoûagrobakteríalʹnoítransformacíí