Obtaining of transgenic french bean plants (Phaseolus vulgaris L.) resistant to the herbicide pursuit by Agrobacterium-mediated transformation
The transgenic plants of French bean (Phaseolus vulgaris) resistant herbicide Pursuit and kanamycin have been obtained. The genetic transformation was carried out with Agrobacterium tumefaciens strain LBA4404 containing binary vector carrying mutant ahas/als and selective nptII genes. Integration of...
Saved in:
| Published in: | Цитология и генетика |
|---|---|
| Date: | 2011 |
| Main Authors: | , , |
| Format: | Article |
| Language: | English |
| Published: |
Інститут клітинної біології та генетичної інженерії НАН України
2011
|
| Subjects: | |
| Online Access: | https://nasplib.isofts.kiev.ua/handle/123456789/66831 |
| Tags: |
Add Tag
No Tags, Be the first to tag this record!
|
| Journal Title: | Digital Library of Periodicals of National Academy of Sciences of Ukraine |
| Cite this: | Obtaining of transgenic french bean plants (Phaseolus vulgaris L.) resistant to the herbicide pursuit by Agrobacterium-mediated transformation / S.N. Nifantova, I.K. Komarnickiy, N.V. Kuchuk // Цитология и генетика. — 2011. — Т. 45, № 2. — С. 41-45. — Бібліогр.: 22 назв. — англ. |
Institution
Digital Library of Periodicals of National Academy of Sciences of Ukraine| _version_ | 1860264067649765376 |
|---|---|
| author | Nifantova, S.N. Komarnickiy, I.K. Kuchuk, N.V. |
| author_facet | Nifantova, S.N. Komarnickiy, I.K. Kuchuk, N.V. |
| citation_txt | Obtaining of transgenic french bean plants (Phaseolus vulgaris L.) resistant to the herbicide pursuit by Agrobacterium-mediated transformation / S.N. Nifantova, I.K. Komarnickiy, N.V. Kuchuk // Цитология и генетика. — 2011. — Т. 45, № 2. — С. 41-45. — Бібліогр.: 22 назв. — англ. |
| collection | DSpace DC |
| container_title | Цитология и генетика |
| description | The transgenic plants of French bean (Phaseolus vulgaris) resistant herbicide Pursuit and kanamycin have been obtained. The genetic transformation was carried out with Agrobacterium tumefaciens strain LBA4404 containing binary vector carrying mutant ahas/als and selective nptII genes. Integration of the transgenes into plant genome was confirmed by polymerase chain reaction.
Получены трансгенные растения фасоли обыкновенной (Phaseolus vulgaris), которые содержат ген ahas/als, обусловливающий устойчивость к гербициду Pursuit. Генетическую трансформацию осуществляли с использованием штамма Agrobacterium tumefaciens LBA4404, который содержит плазмиду pCB004, с мутантным геном ahas/als и маркерным геном nptII, обусловливающим устойчивость к канамицину. Селектирован ряд устойчивых к гербициду Pursuit и канамицину линий. Интеграция перенесенных генов в растительный геном доказана при помощи метода полимеразной цепной реакции.
Отримано трансгенні рослини квасолі звичайноі (Phaseolus vulgaris), які містять мутантний ген ahas/als, що обумовлює стійкість до гербіциду Pursuit. Генетичну трансформацію проводили за допомогою штаму Agrobacterium tumefaciens LBA4404 з використанням плазміди pCB004, яка містила мутантний ген ahas/als та маркерний ген nptII, що обумовлює стійкість до канаміцинсульфату. Інтеграція перенесених генів у рослинний геном доведена за допомогою полімеразної ланцюгової реакції.
|
| first_indexed | 2025-12-07T18:58:29Z |
| format | Article |
| fulltext |
УДК 577.21:582.739:581.143
S.N. NIFANTOVA, I.K. KOMARNICKIY, N.V. KUCHUK
Institute of Cell Biology and Genetic Engineering
National Academy of Sciences of Ukraine, Kyiv
E�mail: sveta@iicb.kiev.ua
OBTAINING OF TRANSGENIC
FRENCH BEAN PLANTS
(PHASEOLUS VULGARIS L.)
RESISTANT TO THE HERBICIDE
PURSUIT BY AGROBACTERIUM�
MEDIATED TRANSFORMATION
The transgenic plants of French bean (Phaseolus vulgaris)
resistant herbicide Pursuit and kanamycin have been
obtained. The genetic transformation was carried out with
Agrobacterium tumefaciens strain LBA4404 containing bina�
ry vector carrying mutant ahas/als and selective nptII genes.
Integration of the transgenes into plant genome was confirmed
by polymerase chain reaction.
Introduction. Herbicide Pursuit belongs to imi�
dozolinone group and inhibits the acetolactate syn�
thase enzyme involved into biosynthesis of hydro�
xyaminoacids such as valine, leucine, isoleucine.
The mechanism of imidozolinone effects has lots
in common with the one of sulfonylurea [1, 2].
Plant resistance to this herbicide is caused by the
acetolactate synthase (ahas/als) gene mutation that
consequently changes proline for serine in position
197 [3].
The imidasolinone�resistant plants were obtained
by mutagenesis [4] as well as transferring of the
mutant acetolactate synthase gene to plant tissues
[5–8]. Sulfonylurea�resistant mutants were obtained
for Nicotiana tabacum [9], Arabidopsis thaliana [4],
soybeans [10], Brassica napus [11], Datura innoxia
[12], Zea mays [13]. Transgenic sulphonilurea�resist�
ant Nicotiana tabacum plants were obtained as well
[14]. We have also obtained the Pursuit�resistant
transgenic plants of pea (Pisum sativum L.) [15].
French bean (Phaseolus vulgaris L.) belongs to
the leguminous plants. Genetic transformation is
expected to improve its edible qualities and form
the new plant properties such as resistance to dis�
eases, herbicides, pests and abiotic stresses. There
are only few reports describing transgenic French
bean production. Genetically transformed plants
of French bean were developed by the method of
particle bombardment [16]. The obtained plants
contained gus and neo genes, which were co�intro�
duced with methionine�rich 2S albumine gene
isolated from Brazil nut and antisense sequence of
AC1, AC2, AC3 and BC1 genes from bean golden
mosaic geminivirus. Simultaneously transgenic
plants of French bean with gus reporter gene were
obtained by particle bombardment [17]. Tepary bean
(Phaseolus acutifolius L. Gray) transgenic plants
containing gus, nptII genes and arceline protein
gene conferring resistance to insects (Coleoptera,
Bruchidae) were obtained via Agrobacterium tume�
faciens�mediated transformation [18]. There is
one report describing the production of French
bean transgenic «hairy roots» carrying gus and gfр
genes [19].
The purpose of this work was to develop Agro�
bacterium�mediated transformation protocol and
to construct transgenic French bean (Phaseolus
vulgaris L.) plants resistant to herbicide Pursuit.
Materials and methods. Aseptically growing
French bean (Phaseolus vulgaris L.) plants of
«Krasnoperaya», «Nezhnost» and «Chudesnaya»
varieties were used for this study.
ІSSN 0564–3783. Цитология и генетика. 2011. № 2 41
© S.N. NIFANTOVA, I.K. KOMARNICKIY, N.V. KUCHUK, 2011
Genetic transformation was carried out with
Agrobacterium tumefaciens strain LBA4404 contain�
ing mutant ahas/als gene and neomycine phos�
photransferase II selectable (nptII) marker gene in
the binary vector pCB004.
Plant leaves and stems were cut into explants
and put onto basal B5 [20] agar solidified medium
with 1 mg/l 2,4�D, 0.2 mg/l ВАР and 0.5 mg/l ade�
nine for callus initiation. After 2–3 weeks the calli
were transferred to the same but liquid medium and
Agrobacterium tumefaciens overnight grown culture
was added in proportion 1/100. Co�cultivation was
held on at 22 °С in the dark for 48 hours.
Callus was infiltrated, washed by sterile water
and put onto the agar solidified nutrient B5 medi�
um containing 400 mg/l cephotoxime for bacteria
elimination and 40 μg/l Pursuit and 100 mg/l
kanamycin. In 4–6 weeks the selected callus
clones were put on the regeneration medium with
B5 basal components, 2 mg/l ВАР, 0.2 mg/l ІAA,
Ag2S2O3 and the same selective agents. Ag2S2O3
was added as 5 mg/l AgNO3 + 248 mg/l Na2S2O3.
Regenerated shoots were transferred onto hor�
mone free B5 medium for root formation. Fully
formed plants were put from aseptic conditions
into soil in humidity chamber for 2–3 days.
Finally, plants grown in greenhouse formed flowers
and seeds after manual pollination.
Primers for amplification of ahas/als gene
sequence f.5'�CCGAGCTCACACATTTCTCG�3',
r. 5'�AAGGTTCTGATAATCACCGG�3' and the
ones for amplification of nptII gene f. 5'�GAGGC�
TATTCGGCTATGACTG�3', r. 5'�CAAGCTCT�
TCAGCAATATCACG�3' were used for poly�
merase chain reaction (PCR). 300�bp fragment
was amplified by PCR for ahas/als gene and 647�
bp fragment was amplified for nptII gene. The
sample of 10 ng of total plant DNA extracted by
CTAB method was used for this reaction [21]. The
PCR reaction was carried out on Eppendorf
Mastercycler personal and the mixture in total vol�
ume of 50 μl contained of 39 μl with template
DNA, 1 μl of each the primers (50 μM), 4 μl
dNTPs (2.5 mM), 5 μl 10�Taq buffer and 1 μl with
1 unit of Taq polymerase Template DNA was ini�
tially denatured at 95 °С for 3 min. Reaction fol�
lowed by 35 cycles of PCR amplification under the
following conditions: 45 s denaturation at 95 °С,
30 s primer annealing at 50 °С for ahas/als gene
and 56 °С for nptII gene, and 45 s primer exten�
sion at 72 °С. Final 6 min incubation at 72 °С was
allowed for complementation of the fragment.
After 40�cycled amplification the samples were
fractionated in 2 % agar gel in the field voltage of
100 V/cm for 2 hours in TBE�buffer. The gels were
stained by ethidium bromide.
Results and discussion. The selective concentra�
tion of herbicide Pursuit for callus tissues of all the
studied bean varieties was specified to be 40 μg/l.
The herbicide effect on callus tissues caused the
stop of their biomass increasing and led to death
at last.
Genetic transformation was carried out with
Agrobacterium tumefaciens harbouring pCB004 plas�
mid for transferring mutant ahas/als gene and
selective nptII gene as described in «Material and
Methods» section. Selection was done on the agar�
solidified callus inducing medium with 40 μg/l
Pursuit and 100 mg/l kanamicyn. Selected callus
clones were put on the regeneration medium with
the same selective substances and Ag2S2O3. Silver
thiosulfate is known for its antiethylene effect that
ISSN 0564–3783. Цитология и генетика. 2011. № 242
S.N. Nifantova, I.K. Komarnickiy, N.V. Kuchuk
Fig. 1. The selection and regeneration processes of French
bean variety «Krasnoperaya» on the regeneration B5 medium
with 2 mg/l ВАР, 0.2 mg/l IAA, Ag2S2O3, 40 μg/l Pursuit
and 100 mg/l kanamicyn
The number of regenerating and transgenic lines of bean
Lines
Climbing bean «Chudesnaya»
Climbing bean «Nezhnost»
French bean «Krasnoperaya»
0
5
13
0
3
10
The number
transgenic
plants
obtained
led to promotion of the regeneration capacity for
calli. [22]. In 2–3 months some of the selected
calli formed dark green regenerating spots that
were used for further shoot regeneration (Fig. 1).
The regeneration frequencies varied from 1.7 to
7.5 %. The results of the regenerating lines selec�
tion are shown in the Table.
There were no morphogenesis or callus forma�
tion observed for control (not treated with Adrobac�
terium) explants on selective medium with kanami�
cyn and Pursuit for all tested French bean culti�
vars. Due to the poor regeneration ability of bean
«Chudesnaya» we didn’t manage to obtain the
transformants.
All the obtained regeneration lines were analysed
using PCR analysis for the ahas/als and nptII trans�
genes. There were 3 regeneration lines of «Nezh�
nost» variety and 10 lines of «Krasnoperaya» variety
that had positive signals after PCR analysis. The
results for ahas/als gene are shown on the fig. 2
and for nptII gene on the fig. 3. The transformation
frequencies varied from 2.8 to 17.4 %.
The obtained transgenic French bean plants
were rooted and then bloomed in vitro though they
did not form seeds. But we managed to get seeds in
greenhouse after manual pollination (Fig. 4).
The present work is to the best of our knowledge
the first report where transgenic plants of French
bean have been obtained through Agrobacterium
tumefaciens transformation. Developed protocol
allowed us to get Pursuit resistant bean plants.
Early we reported about regeneration of Pursuit�
resistant transgenic plants of pea (Pisum sativum
ІSSN 0564–3783. Цитология и генетика. 2011. № 2 43
Obtaining of transgenic French bean plants (Phaseolus vulgaris L.) resistant
Fig. 2. PCR amplification of ahas/als gene fragment from
plant DNA of the transformed lines of beans: 1 – molecular
marker, 2 – positive control (plasmid pCB004), 3 – untrans�
formed line, 4–7 – transformed lines (4 – R8, 5 – R6, 6 – R7,
7 – R9), 8 – negative control without DNA
Fig. 3. PCR�analysis of gene nptII presence in plant DNA
of the transformed lines of beans: 1 – molecular marker, 2 –
positive control (plasmid pCB004), 3 – the untransformed
line, 4–8 – transformed lines (4 – R8, 5 – R6, 6 – R7, 7 –
R9, 8 – R10)
Fig. 4. The transgenic French bean plant of «Krasnoperaya»
variety in the soil
L.) [15]. This communication confirms the effi�
ciency of the worked�out protocols for genetic
transformation of some leguminous plants.
С.Н. Нифонтова,
И.К. Комарницкий, Н.В. Кучук
ПОЛУЧЕНИЕ ТРАНСГЕННЫХ
PURSUIT�УСТОЙЧИВЫХ РАСТЕНИЙ ФАСОЛИ
ОБЫКНОВЕННОЙ (PHASEOLUS VULGARIS L.)
МЕТОДОМ АГРОБАКТЕРИАЛЬНОЙ
ТРАНСФОРМАЦИИ
Получены трансгенные растения фасоли обыкно�
венной (Phaseolus vulgaris), которые содержат ген
ahas/als, обусловливающий устойчивость к гербициду
Pursuit. Генетическую трансформацию осуществляли
с использованием штамма Agrobacterium tumefaciens
LBA4404, который содержит плазмиду pCB004, с му�
тантным геном ahas/als и маркерным геном nptII,
обусловливающим устойчивость к канамицину. Селек�
тирован ряд устойчивых к гербициду Pursuit и кана�
мицину линий. Интеграция перенесенных генов в
растительный геном доказана при помощи метода по�
лимеразной цепной реакции.
С.М. Нифонтова,
І.К. Комарницький, М.В. Кучук
ОТРИМАННЯ ТРАНСГЕННИХ РОСЛИН
КВАСОЛІ ЗВИЧАЙНОЇ (PHASEOLUS VULGARIS L.),
СТІЙКИХ ДО ГЕРБІЦИДУ PURSUIT,
ЗА ДОПОМОГОЮ АГРОБАКТЕРІАЛЬНОЇ
ТРАНСФОРМАЦІЇ
Отримано трансгенні рослини квасолі звичайноі
(Phaseolus vulgaris), які містять мутантний ген ahas/als,
що обумовлює стійкість до гербіциду Pursuit. Генетич�
ну трансформацію проводили за допомогою штаму
Agrobacterium tumefaciens LBA4404 з використанням
плазміди pCB004, яка містила мутантний ген ahas/als
та маркерний ген nptII, що обумовлює стійкість до ка�
наміцинсульфату. Інтеграція перенесених генів у рос�
линний геном доведена за допомогою полімеразної
ланцюгової реакції.
REFERENCES
1. Hattori J., Rutledge R., Labbe H., Brown D., Sunohara G.,
Miki B. Multiple resistance to sulfonylureas and imida�
zolinones conferred by an acetohydroxyacid synthase
gene with separate mutations for selective resistanse //
Mol. Gen. Genet. – 1992. – 232. – P. 167–173.
2. Li Z., Hayashimoto A., Murai N. A sulfonylurea herbi�
cide resistance gene from Аrabidopsis thaliana as a new
selectable marker for production of fertile transgenic
rice // Plants. Plant Physiol. – 1992. – 100 (2). – P. 662–
668.
3. Yadav N., McDevitt R.E., Benard S., Falco S.C. Single
amino acid substitutions in the enzyme acetolactate
synthase confer resistance to the herbicide sulfometur�
on methyl // Proc. Nat. Acad. Sci. USA. – 1986. – 83. –
P. 4418–4422.
4. Haughn G.W., Somerville C. Sulfonylurea�resistant
Arabidopsis thaliana // Mol. Gen. Genet. – 1986. –
204. – P. 430–434.
5. Haugh G.W., Smith J., Mazur B., Somerville C. Transfor�
mation with a mutant Arabidopsis acetolactate synthase
gene renders tobacco resistant to sulfonylurea herbi�
cides // Mol. Gen. Genet. – 1988. – 211. – P. 266–
271.
6. Lee K.Y., Townsend J., Tepperman J., Black M., Chui C.F.,
Mazur B., Dunsmuir P., Bedbrook J. The molecular
basis of sulfonylurea herbicide resistance in tobacco //
EMBO J. – 1988. – 7(5). – P. 1241–1248.
7. Pogrebnyak N.Ya., Kravets O.A., Shisha E.N., Gleba
Yu.Yu. Production of cell lines and plants of potato
resistant to herbicide effect // Cytology and Genetics.–
1992. – 26. – P. 50–55 (in Russian).
8. Smith J.K., Mauvais C.J., Knowlton S., Mazur B.J.
Molecular biology of resistance to sulfonylurea herbi�
cides // Proc. ACS Symp. Biotechnol. Crop Protect. –
Washington, 1988. – P. 25–36.
9. Ray T.B. Site of action of chlorsulfuron: inhibition of
valine and isoleucine biosynthesis in plants // Plant
Physiol. – 1984. – 75(3). – P. 827–831.
10. Sebastion S.A., Chaleff R.S. Soybean mutants with
increased tolerance for the sulfonylurea herbicides //
Crop Sci. – 1987. – 27. – P. 948–952.
11. Swanson E.B., Herrgesell M.J., Arnoldo M., Sippell
D.W., Wong R.S.C. Microspore mutagenesis and selec�
tion : Canola plants with field tolerance to the imida�
zolinones // Theor. Appl. Genet. – 1989. – 78. – P. 525–
530.
12. Saxena P.K., King J. Herbicide resistance in Datura
innoxia: cross�resistance of sulfonylurea�resistant cell
lines to imidazolinones // Plant Physiol. – 1989. –
86(3). – P. 863–867.
13. Shaner D.L., Anderson P.C. Mechanism of action of the
imidazolinones and cell culture selection of tolerant
maize // Biotechnology in plant science / Eds M.
Zaitlin, P.R. Day, A. Hollaender. – New York : Acad.
рress, 1984. – P. 287–300.
14. Gabard J.M., Charest P.J., Iyer V.N., Miki B.L. Cross�
resistance to short residual sulfonylurea herbicides in
transgenic tobacсo // Plants. Plant Physiol. – 1989. –
91. – P. 574–580.
15. Nifantova S.N., Simonenko Yu., Komarnitskii I.K.,
Kuchuk N.V. Production of transgenic pea (Pisum
sativum L.) plants resistant to the herbicide pursuit //
Cytology and Genetics. – 2005. – 39, № 2. – P. 16–21
(in Russian).
16. Aragao F.J.L., Barros L.M.J., Brasileiro A.S.M., Ribei�
ro S.G., Smith F.D., Sanford J.C., Faria J.C., Rech E.L.
ISSN 0564–3783. Цитология и генетика. 2011. № 244
S.N. Nifantova, I.K. Komarnickiy, N.V. Kuchuk
Inheritance of foreign genes in transgenic been
(Phaseolus vulgaris L.) co�transformed via particle
bombardment // Theor. Appl. Genet. – 1996. – 93. –
P. 142–150.
17. Jae W.K., Minamikawa T. Transformation and regener�
ation of French been plants by the particle bombard�
ment process // Plant Sci. – 1996. – 117. – P. 131–
138.
18. Zambre M., Goossens A., Cardona C., Van Montagu M.,
Terryn N., Angenon G. A reproducible genetic transfor�
mation system for cultivated Phaseolus acutifolius
(tepary bean) and its use to assess the role of arcelins in
resistance to the Mexican bean weevil // Theor. Appl.
Genet. – 2005. – 110 (5). – P. 914–924.
19. Estrada�Navarrete G., Alvarado�Affantranger X., Oliva�
res J.E., Diaz�Camino C., Santana O., Murillo E., Guil�
lén G., Sánchez�Guevara N., Acosta J., Quinto C., Li D.,
Gresshoff P.M., Sánchez F. Agrobacterium rhizogenes
transformation of the Phaseolus spp.: a tool for func�
tional genomics // Mol. Plant Microbe Interact. –
2006. – 19(12). – P. 1385–1393.
20. Gamborg O.L., Miller R.A., Ojima K. Nutrient require�
ments of suspension cultures of soybean foot cells //
Exp. Cell Res. – 1968. – 50, № 1. – P. 151–158.
21. Murray M.J., Thompson W.E. Rapid isolation of high
molecular weight DNA // Nucl. Acids Res. – 1980. –
№ 19. – P. 4321–4325.
22. De Block M. Genotype�independent leaf disc transfor�
mation of potato (Solanum tuberosum) using Agrobac�
terium tumefaciens // Theor. Appl. Genet. – 1988. –
76. – P. 767–774.
Received 01.04.10
ІSSN 0564–3783. Цитология и генетика. 2011. № 2 45
Obtaining of transgenic French bean plants (Phaseolus vulgaris L.) resistant
|
| id | nasplib_isofts_kiev_ua-123456789-66831 |
| institution | Digital Library of Periodicals of National Academy of Sciences of Ukraine |
| issn | 0564-3783 |
| language | English |
| last_indexed | 2025-12-07T18:58:29Z |
| publishDate | 2011 |
| publisher | Інститут клітинної біології та генетичної інженерії НАН України |
| record_format | dspace |
| spelling | Nifantova, S.N. Komarnickiy, I.K. Kuchuk, N.V. 2014-07-23T06:10:42Z 2014-07-23T06:10:42Z 2011 Obtaining of transgenic french bean plants (Phaseolus vulgaris L.) resistant to the herbicide pursuit by Agrobacterium-mediated transformation / S.N. Nifantova, I.K. Komarnickiy, N.V. Kuchuk // Цитология и генетика. — 2011. — Т. 45, № 2. — С. 41-45. — Бібліогр.: 22 назв. — англ. 0564-3783 https://nasplib.isofts.kiev.ua/handle/123456789/66831 577.21:582.739:581.143 The transgenic plants of French bean (Phaseolus vulgaris) resistant herbicide Pursuit and kanamycin have been obtained. The genetic transformation was carried out with Agrobacterium tumefaciens strain LBA4404 containing binary vector carrying mutant ahas/als and selective nptII genes. Integration of the transgenes into plant genome was confirmed by polymerase chain reaction. Получены трансгенные растения фасоли обыкновенной (Phaseolus vulgaris), которые содержат ген ahas/als, обусловливающий устойчивость к гербициду Pursuit. Генетическую трансформацию осуществляли с использованием штамма Agrobacterium tumefaciens LBA4404, который содержит плазмиду pCB004, с мутантным геном ahas/als и маркерным геном nptII, обусловливающим устойчивость к канамицину. Селектирован ряд устойчивых к гербициду Pursuit и канамицину линий. Интеграция перенесенных генов в растительный геном доказана при помощи метода полимеразной цепной реакции. Отримано трансгенні рослини квасолі звичайноі (Phaseolus vulgaris), які містять мутантний ген ahas/als, що обумовлює стійкість до гербіциду Pursuit. Генетичну трансформацію проводили за допомогою штаму Agrobacterium tumefaciens LBA4404 з використанням плазміди pCB004, яка містила мутантний ген ahas/als та маркерний ген nptII, що обумовлює стійкість до канаміцинсульфату. Інтеграція перенесених генів у рослинний геном доведена за допомогою полімеразної ланцюгової реакції. en Інститут клітинної біології та генетичної інженерії НАН України Цитология и генетика Оригинальные работы Obtaining of transgenic french bean plants (Phaseolus vulgaris L.) resistant to the herbicide pursuit by Agrobacterium-mediated transformation Получение трансгенных pursuit-устойчивых растений фасоли обыкновенной (Phaseolus vulgaris L.) методом агробактериальной трансформации Отримання трансгенних рослин квасолі звичайної (Phaseolus vulgaris L.), стійких до гербіциду pursuit, за допомогою агробактеріальної трансформації Article published earlier |
| spellingShingle | Obtaining of transgenic french bean plants (Phaseolus vulgaris L.) resistant to the herbicide pursuit by Agrobacterium-mediated transformation Nifantova, S.N. Komarnickiy, I.K. Kuchuk, N.V. Оригинальные работы |
| title | Obtaining of transgenic french bean plants (Phaseolus vulgaris L.) resistant to the herbicide pursuit by Agrobacterium-mediated transformation |
| title_alt | Получение трансгенных pursuit-устойчивых растений фасоли обыкновенной (Phaseolus vulgaris L.) методом агробактериальной трансформации Отримання трансгенних рослин квасолі звичайної (Phaseolus vulgaris L.), стійких до гербіциду pursuit, за допомогою агробактеріальної трансформації |
| title_full | Obtaining of transgenic french bean plants (Phaseolus vulgaris L.) resistant to the herbicide pursuit by Agrobacterium-mediated transformation |
| title_fullStr | Obtaining of transgenic french bean plants (Phaseolus vulgaris L.) resistant to the herbicide pursuit by Agrobacterium-mediated transformation |
| title_full_unstemmed | Obtaining of transgenic french bean plants (Phaseolus vulgaris L.) resistant to the herbicide pursuit by Agrobacterium-mediated transformation |
| title_short | Obtaining of transgenic french bean plants (Phaseolus vulgaris L.) resistant to the herbicide pursuit by Agrobacterium-mediated transformation |
| title_sort | obtaining of transgenic french bean plants (phaseolus vulgaris l.) resistant to the herbicide pursuit by agrobacterium-mediated transformation |
| topic | Оригинальные работы |
| topic_facet | Оригинальные работы |
| url | https://nasplib.isofts.kiev.ua/handle/123456789/66831 |
| work_keys_str_mv | AT nifantovasn obtainingoftransgenicfrenchbeanplantsphaseolusvulgarislresistanttotheherbicidepursuitbyagrobacteriummediatedtransformation AT komarnickiyik obtainingoftransgenicfrenchbeanplantsphaseolusvulgarislresistanttotheherbicidepursuitbyagrobacteriummediatedtransformation AT kuchuknv obtainingoftransgenicfrenchbeanplantsphaseolusvulgarislresistanttotheherbicidepursuitbyagrobacteriummediatedtransformation AT nifantovasn polučenietransgennyhpursuitustoičivyhrasteniifasoliobyknovennoiphaseolusvulgarislmetodomagrobakterialʹnoitransformacii AT komarnickiyik polučenietransgennyhpursuitustoičivyhrasteniifasoliobyknovennoiphaseolusvulgarislmetodomagrobakterialʹnoitransformacii AT kuchuknv polučenietransgennyhpursuitustoičivyhrasteniifasoliobyknovennoiphaseolusvulgarislmetodomagrobakterialʹnoitransformacii AT nifantovasn otrimannâtransgennihroslinkvasolízvičainoíphaseolusvulgarislstíikihdogerbícidupursuitzadopomogoûagrobakteríalʹnoítransformacíí AT komarnickiyik otrimannâtransgennihroslinkvasolízvičainoíphaseolusvulgarislstíikihdogerbícidupursuitzadopomogoûagrobakteríalʹnoítransformacíí AT kuchuknv otrimannâtransgennihroslinkvasolízvičainoíphaseolusvulgarislstíikihdogerbícidupursuitzadopomogoûagrobakteríalʹnoítransformacíí |