Expression of genes belonging to the IGF-system in glial tumors

The discrepancies arising from conflicting evidence on the results obtained by different laboratories in human gliomas are discussed. Our data highlight the importance of viewing the IGF-related proteins as a complex multifactorial system and show that changes in the expression levels of any one com...

Повний опис

Збережено в:
Бібліографічні деталі
Опубліковано в: :Цитология и генетика
Дата:2011
Автори: Dmitrenko, V.V., Kavsan, V.M., Boyko, O.I., Rymar, V.I., Stepanenko, A.A., Balynska, O.V., Malisheva, T.A., Rozumenko, V.D., Zozulya, Y.P.
Формат: Стаття
Мова:Англійська
Опубліковано: Інститут клітинної біології та генетичної інженерії НАН України 2011
Теми:
Онлайн доступ:https://nasplib.isofts.kiev.ua/handle/123456789/66864
Теги: Додати тег
Немає тегів, Будьте першим, хто поставить тег для цього запису!
Назва журналу:Digital Library of Periodicals of National Academy of Sciences of Ukraine
Цитувати:Expression of genes belonging to the IGF-system in glial tumors / V.V. Dmitrenko, V.M. Kavsan, O.I. Boyko, V.I. Rymar, A.A. Stepanenko, O.V. Balynska, T.A. Malisheva, V.D. Rozumenko, Y.P. Zozulya // Цитология и генетика. — 2011. — Т. 45, № 4. — С. 41-57. — Бібліогр.: 69 назв. — англ.

Репозитарії

Digital Library of Periodicals of National Academy of Sciences of Ukraine
_version_ 1859527159951917056
author Dmitrenko, V.V.
Kavsan, V.M.
Boyko, O.I.
Rymar, V.I.
Stepanenko, A.A.
Balynska, O.V.
Malisheva, T.A.
Rozumenko, V.D.
Zozulya, Y.P.
author_facet Dmitrenko, V.V.
Kavsan, V.M.
Boyko, O.I.
Rymar, V.I.
Stepanenko, A.A.
Balynska, O.V.
Malisheva, T.A.
Rozumenko, V.D.
Zozulya, Y.P.
citation_txt Expression of genes belonging to the IGF-system in glial tumors / V.V. Dmitrenko, V.M. Kavsan, O.I. Boyko, V.I. Rymar, A.A. Stepanenko, O.V. Balynska, T.A. Malisheva, V.D. Rozumenko, Y.P. Zozulya // Цитология и генетика. — 2011. — Т. 45, № 4. — С. 41-57. — Бібліогр.: 69 назв. — англ.
collection DSpace DC
container_title Цитология и генетика
description The discrepancies arising from conflicting evidence on the results obtained by different laboratories in human gliomas are discussed. Our data highlight the importance of viewing the IGF-related proteins as a complex multifactorial system and show that changes in the expression levels of any one component of the system, in a given malignancy, should be interpreted with caution. As IGF targeting for anticancer therapy is rapidly becoming clinical reality, an understanding of this complexity is very timely. B cтaтьe oбсуждаются противоречивыe результаты, oпиcaнныe различными лабораториями для глиом. Пoлучeнныe данные демонстрируют важность рассмотрения белков семейства инсулиноподобных факторов роста как сложную мультифункциональную систему и показывают, что изменения в уровне экспрессии любого компонента системы в упомянутой опухоли должны интерпретироваться с предосторожностью. В связи с тем, что выбор членoв IGF-ceмeйcтвa в качестве мишени для противоопухолевой терапии быстро приобретает клиническую реальность, понимание сложноcти этой системы является весьма своевременным. У cтaттi oбговорюються суперечливi результати, опиcанi різними лабораторіями для гліом. Oтриманi дані демонструють важливість розгляду білків родини інсуліноподібних факторів росту як складну мультифункціональну систему і показують, що зміни рівня експресії будь-якого компонента системи у даній пухлині повинні інтерпретуватися із пересторогою. В зв’язку з тим, що вибір членiв IGF-ciмeйcтвa як мішені для протипухлинної терапії швидко набуває клінічної реальності, розуміння цієї системи є вельми своєчасним.
first_indexed 2025-11-25T22:31:34Z
format Article
fulltext УДК 577.21:577.214.622 + 616–006.484.04 V.V. DMITRENKO 1, V.M. KAVSAN 1, O.I. BOYKO 1, V.I. RYMAR 1, A.A. STEPANENKO 1, O.V. BALYNSKA 1, T.A. MALISHEVA 2, V.D. ROZUMENKO 2, Y.P. ZOZULYA 2 1 Institute of Molecular Biology and Genetics, Kyiv, Ukraine 2 A.P. Romodanov Institute of Neurosurgery, Kyiv, Ukraine E�mail: dmitrenko@imbg.org.ua EXPRESSION OF GENES BELONGING TO THE IGF�SYSTEM IN GLIAL TUMORS Increased expression of the insulin�like growth factor (IGF) family members, IGF1, IGF2, their receptors and bind� ing proteins, or combinations thereof has been documented in various malignancies including gliomas. The results of multi� ple investigations suggest that the IGFs can play a paracrine and/or autocrine role in promoting tumor growth in situ dur� ing tumor progression but that these roles may vary depending on the tissue of origin. Enhanced IGF1 expression was not found in glioblastomas and it was supposed that IGF1 partic� ipation in the development of glial tumors may be substituted by protein products of highly expressed other genes, also par� ticipating in PI3K and MAPK pathways. Increased expression of IGF�binding protein genes in brain tumors makes the pic� ture even more complicated. As other binding proteins, IGFBPs regulate the activity of their ligands by prolonging their half�life. The discrepancies arising from conflicting evi� dence on the results obtained by different laboratories in human gliomas are discussed. Our data highlight the impor� tance of viewing the IGF�related proteins as a complex multi� factorial system and show that changes in the expression levels of any one component of the system, in a given malignancy, should be interpreted with caution. As IGF targeting for anti� cancer therapy is rapidly becoming clinical reality, an under� standing of this complexity is very timely. Introduction. In recent years, evidences have been appearing that the members of IGF system may be involved in cancer development. The anti� sense strategies, directed to the components of IGF�signaling, are the subject of many clinical tri� als. All three IGF receptors (IGF1R, INSR and IGF2R) are very well known targets for anti�can� cer therapy. Increased expression of IGF1 recep� tor same as its ligands may stimulate PI3K and MAPK signaling cascades leading to cell prolifer� ation [1–3]. However, the role of IGFs, IGF receptors and IGF�binding proteins (IGFBPs) in tumor develop� ment is poorly understood to this time. Increased levels of IGF1, IGF2 and their receptors have been found in different tumor types (reviewed in [4]), although the data about IGF1 and IGF2 gene expression in astrocytic gliomas are quite ambiguous. There are several publications reporting enhanced expression of these genes in anaplastic astrocytomas and glioblastomas on the RNA or protein levels [5–8]. For example, Sandberg et al. [5] analysed the expression of IGF genes by slot blot and Northern blot hybridization and found several fold increased IGF1 and IGF2 mRNA levels in one anaplastic astrocytoma and three glioblastoma specimens analyzed as compared to different regions of human adult normal brain. In other work, these authors demonstrated by immunohis� tochemistry the production of IGF1�like peptide in tumor cells in two of three anaplastic astrocy� tomas and in three of four glioblastomas examined [6]. In situ hybridization and immunocytochem� istry also have localized a production of both IGF1 and IGF2 mRNA and protein in small num� ber of astrocytoma samples analyzed that was accompanied by the co�expression of respective type�1 and type�2 IGF receptors [7]. Immunocyto� chemical analysis of 39 astrocytic tumors of WHO grades II–IV revealed tumor cells expressing IGF1 and IGF1R in all tumor grades (however, authors do not show how many of samples being under investigation were positive) [8]. On the other hand, the expression of IGF1 and IGF2 genes in astrocytic tumors was not found in other investigations. Thus, IGF2 mRNA was not detected by Northern analysis in 5 astrocytomas and 2 glioblastomas [9], and the expression of IGF1 was not found by Northern analysis in two investi� gated gliomas (ependymoma and glioblastoma) [10]. Earlier, we also could not find the significant change of IGF1 gene expression in glioblastoma by ІSSN 0564–3783. Цитология и генетика. 2011. № 5 41 © V.V. DMITRENKO, V.M. KAVSAN, O.I. BOYKO, V.I. RYMAR, A.A. STEPANENKO, O.V. BALYNSKA, T.A. MALISHEVA, V.D. ROZUMENKO, Y.P. ZOZULYA, 2011 Serial Analysis of Gene Expression (SAGE) [11]. Such contradictory results could be explained by not enough big quantity of samples being under investigations. Nevertheless, IGF1 and IGF2 genes were not presented also in the lists of the genes with significant expression changes in the articles on integrative genome�wide analysis of 81 [12] and 460 glioblastoma samples [13]. Expression of insulin�like growth factor bind� ing protein (IGFBP) genes in brain tumors makes the picture even more complicated. The IGFBP family consists of six high�affinity members (IGFBP1–IGFBP6) and four low�affinity pro� teins (IGFBP7–IGFBP10) which contain on the NH2�termini conserved «IGFBP motif» (GCGC� CXXC), share significant structural homology with IGFBP1–IGFBP6, and able specifically bind IGFs, although with relatively low affinity [14]. As other binding proteins, IGFBPs regulate the activ� ity of their ligands by prolonging their half�life. The biological actions of IGFs may be regulated by IGFBPs either negatively or positively, depending on the tissue type and the physiological or patho� logical status, some of the IGFBPs also act by a mechanism independent of IGFs. Elevation of the activity of IGF1 and IGF2 in the absence of the increasing of their genes expression may be a result of the enhancement of stability and lifetime due to the interaction with IGFBPs [15]. In addition to functioning in extracellular fluids as simple carrier proteins regulating circulating IGF turnover, transport, and distribution, the locally produced IGFBPs act as autocrine/paracrine regulators of IGF action [16]. Here, we analyze the expression of IGF system members including all ten IGFBP genes in glioblastoma by different methods to clarify their expression patterns in this tumor. Materials and methods. SAGE Genie database (http://cgap.nci.nih.gov/SAGE) was used for the comparison of gene expression in glioblastoma and human normal brain by Digital Gene Expression Displayer (DGED) tool. Two pools of SAGE� libraries (9 libraries of glioblastoma and 5 normal adult human brain libraries) were compared. Data, obtained by microarray analysis and available in Gene Expression Omnibus (GEO) site (http:// www.ncbi.nlm. nih.gov/geo), were used also for the comparison of these genes expression in glial tumors and normal brain. DataSet files were searched by keywords «glioblastoma», «astrocy� toma», and «normal brain». A DataSet represents a collection of biologically� and statistically�com� parable samples processed using the same plat� form. In order to measure expression levels from different DataSet files accurately, normalization by several housekeeping genes was required. Scripts, written in Perl were used for the analysis of these data. Glioblastoma surgical specimens were classi� fied on the basis of examination of hematoxylin and eosin stained sections according to World Health Organization (WHO) criteria [17]. Surgical specimens of histologically normal brain tissue adjacent to tumors were used as a source of normal adult human brain RNA and protein. All patients were being treated at the hospital of A.P. Romodanov Institute of Neurosurgery (Kyiv, Ukraine). The study protocol was approved by the human ethics review committees of both institutionsand a signed consent forms from patients were obtained. The tissue samples were stored at –70 °С until analysis. RNA was extracted from frozen samples as described in our previous articles [11, 18]. Equal amounts of total cellular RNA (5 μg each for 20 μl mixture) were transcribed into cDNA with an oligo (dT)/random hexamer primers and Revert Aid M�MuLV reverse transcriptase («Fer� mentas», Lithuania). Each semi�quantitative RT� PCR was performed in 25 μl reaction mixture con� taining cDNA synthesized on 50 ng of RNA (2 μl of 10�fold diluted cDNA), 2U Dream Taq Green DNA polymerase ((«Fermentas», Lithuania), man� ufacturer’s buffer, 0.2 mM dNTPs, and 10 μM gene�specific primers (Table 1). Thermal cycling parameters were: initial denaturing step at 95 °С for 2 min, followed by 27–35 cycles of denatura� tion at 95 °С for 30 sec, annealing at 56 0C for 30 sec, synthesis at 72 °С for 30 sec, and final extension incubation at 72 °С for 7 min. The number of cycles was chosen so that the PCR product amplification rate was in the linear phase. Amplified products were electrophoresed in a 1.5 % agarose gel. Densitometric analysis of PCR product bands was carried out by using the Scion Image 1.62c program. Relative expression levels of examined genes were estimated by normalization to the expression level of control gene, β�actin (ACTB). Data obtained with ACTB were used for calculation of P�value of gene expression changes ISSN 0564–3783. Цитология и генетика. 2011. № 542 V.V. Dmitrenko, V.M. Kavsan, O.I. Boyko et al. in glioblastoma by unpaired t�test assuming unequal variance. Real�time PCR was performed with the iCycler iQ5 (BIO�RAD, USA). Reaction mixture (20 μl) contained 2 μl cDNA (quantity equivalent to syn� thesized on 50 ng of total RNA), 10 μl MaximaTM SYBR Green qPCR Master Mix («Fermentas») and 10 pmole of each IGF1, IGF2 and IGF1R gene�specific primer (Table 1). The amplification procedure of target genes was as follows: initial denaturing step at 95 °С for 10 min, followed by 40 cycles of denaturation at 95 °С for 15 sec, annealing at 56 °С for 15 sec and extension at 72 °С for 15 sec. Melting curve analysis was per� formed to confirm amplification of single bands. Reaction efficiency was calculated by R package named qpcR package [19]. Gene expression values (relative mRNA levels) were calculated based on the modified ��Cq method [20] as ratio of effi� ciency raised to power Ct of analyzed gene to effi� ciency increased to power Ct of reference gene (ACTB). Results. Serial Analysis of Gene Expression (SAGE) revealed a very low level of IGF1 gene expression in glioblastoma. Thus, tag TTTGAT� TAAT corresponding to three known long IGF1 transcripts (7370 bases variant 1 mRNA, Ac.No NM_001111283; 7204 bases variant 2 mRNA, Ac.No NM_001111284, and 7321 bases variant 4 mRNA, Ac.No NM_000618) was found as only one tag per 101053 tags in one (SAGE_Brain_ glioblastoma_B_R20) of nine adult glioblastoma ІSSN 0564–3783. Цитология и генетика. 2011. № 5 43 Expression of genes belonging to the IGF�system in glial tumors Table 1 Primers used in this work for the analysis of gene expression Gene name Cycle numberPrimer sequences PCR product size IGF�I IGF�II IGF�IR IGFBP1 IGFBP2 IGFBP3 IGFBP4 IGFBP5 IGFBP6 IGFBP7 IGFBP8 IGFBP9 IGFBP10 ACTB 32 35 32 32 32 29 29 29 32 29 25 32 29 27 242 249 247 271 224 226 284 130 353 366 259 273 231 262 For GTCCTCCTCGCATCTCTTC Rev ACATCTCCAGCCTCCTTAG For ACACCCTCCAGTTCGTCT Rev ACTGCTTCCAGGTGTCATA T For ACAGAGAACCCCAAGACTGAGG Rev TGATGTTGTAGGTGTCTGCGGC For CGGAGATAACTGAGGAGGA Rev CACTGTCTGCTG TGATAAAATC For CTCAAGTCGGGTATGAAGG Rev GAGTAGAGGTGCTCCAGA For GCACAGATACCCAGAACT Rev CCATACTTATCCAC A CACCA For ACCTCTACATCATCCCCAT Rev TCAGACTCAGACTCCAC T For GACCGCAAAGGATTCTACAA Rev ACTGAAAGTCCCCGTCAA For GCAACTCCAGACTGAGGTC Rev CTCGGTTTTTTGTTGAGTGATG For CCATGACTACTTTTAACCATGCAG Rev GGTGTACTTGAGCTGTGAGGTC For GGCTTACCGACTGGAAGAC Rev GATAGGCTTGGAGATTTTGGG For CTGTGGTATGGGGTTCTC Rev TGGATGGTTTTGGTATTGTG For GCTCCCTGTTTTTGGAATG Rev CATTTCTTGCCCTTTTTCAG For AACTACCTTCACATCCATCA Rev GTACATACTCCTGCTTGCT SAGE�libraries from Cancer Genome Anatomy Project database. No one glioblastoma SAGE� library contains the tag CCCAAGACCC corre� sponding to the shortest IGF1 transcript (949 bases variant 3 mRNA, Ac No NM_001111285). Gene Expression Omnibus (GEO) Datasets (http://www.ncbi.nlm.nih.gov/gds) were used to increase the statistical significance of SAGE results. Obtained files represented the experimental data on gene expression according to microarray analysis. Altogether, there were found six DataSet files which contained data concerning gene expression in 225 glioblastoma and 71 normal brain samples (Table 2). To compare data from experiments with different microarray platforms, we used a normal� ization method proposed for real�time PCR by dividing expression level of every gene on geometric average of three housekeeping genes, ACTB, glycer� aldehyde 3�phosphate dehydrogenase (GAPDH) and TATA�box binding protein (TBP) [27]. In GEO repository, IGF1 gene set consists of three different probes corresponded to three nucleotide sequences in GeneBank (AU144912, M29644 and M37484) and represented different ISSN 0564–3783. Цитология и генетика. 2011. № 544 V.V. Dmitrenko, V.M. Kavsan, O.I. Boyko et al. Table 2 Characteristics of DataSet files from Gene Expression Omnibus (GEO) repository used for the evaluation of gene expession changes in glioblastoma GDS1975 GDS1815 GDS1096 GDS1962 GDS3069 GDS596 GPL96 [HG�U133A] Affymetrix Human Genome U133A Array GPL96 [HG�U133A] Affymetrix Human Genome U133A Array GPL96 [HG�U133A] Affymetrix Human Genome U133A Array GPL570 [HG�U133_ Plus_2] Affymetrix Human Genome U133 Plus 2.0 Array GPL96 [HG�U133A] Affymetrix Human Genome U133A Array GPL96 [HG�U133A] Affymetrix Human Genome U133A Array Freije et al., 2004 [21] Phillips et al., 2006 [22] Ge et al., 2005 [23] Sun et al., 2006 [24] Liu et al., 2007 [25] Su et al., 2004 [26] Large�scale gene expression analysis using the Affymetrix HG U133 oligonucleotide arrays on 85 diffuse infiltrating gliomas of all histologic types to assess whether a gene expression�based, histology�independent classifier is predictive of survival and to determine whether gene expression signatures provide insight into the biology of gliomas 77 primary high�grade astrocytomas and 23 matched recur� rences were profiled to identify changes in gene expression that relate to both survival and disease progression. Samples include WHO grade III and IV astrocytomas with a wide range of sur� vival times. Novel prognostic subclasses of high�grade astrocy� toma are identified and discovered to resemble stages in neuro� genesis Genome�wide expression profiling of 36 types of normal human tissues. Each RNA tissue sample pooled from several donors. 2503 tissue�specific genes were identified. Results provide base� lines for interpretation of gene expression profiles of cancers. mRNA expression data were collected from patients with brain tumor to improve diagnostic of gliomas on molecular level. 23 samples from epilepsy patients were used as non�tumor samples. 157 tumor samples included 26 astrocytomas, 50 oligoden� drogliomas and 81 glioblastomas Analysis of 12 primary brain tumor biopsies with some variation in their histological diagnoses. These results, together with those obtained from miRNA profiling by real�time PCR, provide insight into the relationship between endogenous fluctuations in miRNA and mRNA expression levels Designed custom arrays that interrogate the expression of the vast majority of protein�encoding human and mouse genes were used to profile a panel of 79 human and 61 mouse tissues. The resulting data set provides the expression patterns for thousands of predicted genes, as well as known and poorly characterized genes, from mice and humans File name Microarray platform Authors/Reference Short description of the experiments regions of IGF1 mRNA. Although the results were little bit different for each probe (Fig. 1), the aver� age IGF1 gene expression level was even 1,5�fold lower in glioblastoma than in anaplastic astrocy� toma or human normal brain with P < 0.05 (the significance of differences was calculated using unpaired two�tailed t�test and assuming unequal variance (Table 3). Analysis of each DataSet file for each IGF1 probe also did not reveal significant differences in IGF1 expression between glioblas� toma, anaplastic astrocytoma and normal brain as for example it is demonstrated for GDS1962 (GEO DataSet record 1962) file in Fig. 2. Real� time PCR showed also slightly decreased IGF1 expression level (Fig. 3). As it concerns IGF2 gene, SAGE revealed about 30�fold increased average expression level in glioblastoma as compared to adult normal brain. However, this increasing was not statistically signif� icant (P = 0,293) due to the very high expression levels in two of nine glioblastoma samples, much more than the sample population median level. In GEO repository, IGF2 gene set also consists of three different probes corresponding to nucleotide sequences in GeneBank: M17863, NM_000612 and X07868. In spite of some variations between different probes, the results show mainly that in average the expression level of IGF�II gene in glioblastoma is increased slightly as compared to anaplastic astrocytoma or normal brain (Fig. 4) and 1,6�fold increasing of average IGF�II expression in glioblastoma as compared to human normal brain is statistically significant (Table 3). Analysis of indi� vidual DataSet files for each IGF2 probe showed that glioblastomas can be divided on two subgroups: one group has low expression level of IGF2 gene just like normal brain samples, but other group was characterized by significantly increased expression of IGF2 gene (Fig. 5, a). This division could be seen more distinctly if individual samples of 81 glioblas� tomas and 23 normal brains, analyzed in GDS1962 file, to arrange according to IGF2 expression level in descending order: approximately one quarter of glioblastoma samples has increased IGF2 expres� sion level while other three quarters of glioblastoma samples have low expression level (Fig. 5, b). These microarray data are in a good concordance with results obtained by SAGE and were supported by real�time (Fig. 3) and semi�quantitative RT�PCR (Fig. 6). IGF1 receptor is very well known target for anti�cancer therapy [28]. However, SAGE revealed only 1,4�fold not statistically significant increasing of IGF1R expression (P = 0,510) and microarray techniques showed even 1,2�fold (P = 0,046) decreasing of its expression in glioblastoma as compared to normal brain (Table 3). Real�time RT�PCR (Fig. 3) revealed 1,7�fold increasing of IGF1R expression, but the result was not statisti� cally significant (P = 0,545). Thus, it can be con� cluded that IGF1R expression do not differ signifi� cantly in glial tumors and human normal brain. Expression of insulin receptor (IR), which is used alternatively by IGF2 [29], was decreased in 1,5� fold in glioblastoma according to SAGE and microarray results. At the same time, the expres� sion of IGF2R gene was increased in glioblastoma as compared to normal brain according to SAGE ІSSN 0564–3783. Цитология и генетика. 2011. № 5 45 Expression of genes belonging to the IGF�system in glial tumors Fig. 1. Comparison of IGF1 relative expression levels in glioblastoma, anaplastic astrocytoma and human normal brain according to microarray analysis data from six DataSet files of GEO repository (indicated below the bars in diagram). Data are presented for three probe sets of IGF1 gene located on microarrays: AU14491 (a), M29644 (b) and M37484 (c). Samples of normal brain indicated by white bars, anaplastic astrocytomas – by grey bars, glioblas� tomas – by dark bars (3,3�fold, P = 0,053) and microarray analysis data (1,9�fold, P < 0,001) (Table 3). Comparison of IGFBP genes expression in glioblastoma and normal brain by SAGE revealed increased expression of all genes in glioblastoma except IGFBP1 (Table 3). More than 3�fold up� regulation of IGFBP2, IGFBP3, IGFBP4, IGFBP5, and IGFBP7 genes in glioblastoma was statistically significant (P < 0,05) and confirmed by data of microarray analysis, which showed statistically sig� nificant increased expression levels also for IGFBP8 and IGFBP10 in addition to these five genes. Decreased expression of remained three genes (IGFBP1, IGFBP6 and IGFBP9) in glioblas� ISSN 0564–3783. Цитология и генетика. 2011. № 546 V.V. Dmitrenko, V.M. Kavsan, O.I. Boyko et al. Fig. 2. IGF1 expression in individual samples of glioblastoma, anaplastic astrocytoma and normal brain. Expression profile for IGF1 gene (GeneBank: AU144912) obtained on the basis of the experimental data from DataSet record GDS1962 of GEO repository, submitted by Sun et al. [24] Table 3 Changes of the expression of IGF�system genes in glioblastoma according to three methods Note. GB – glioblastoma, NB – normal brain. P�value below the chosen threshold P < 0.05 indicated in bold. Gene name SAGE Average GB NB GB/NB P Microarrays Average GB NB GB/NB P RT�PCR Average GB NB GB/NB P IGF1 IGF2 IGF1R IGF2R IR IGFBP1 IGFBP2 IGFBP3 IGFBP4 IGFBP5 IGFBP6 IGFBP7 IGFBP8 IGFBP9 IGFBP10 0.1 66.4 3.1 9.7 2.4 1.4 34.3 26.8 19.2 165.6 13.4 269.8 106.3 0.6 37.6 0.0 11.2 2.2 3.0 3.4 2.4 5.6 7.2 0.8 26.0 8.8 10.2 10.2 0.0 6.6 1.14 0.19 0.83 1.31 1.17 0.62 0.77 0.77 1.02 0.64 1.20 0.64 0.52 1.60 0.41 1.07 0.65 0.88 1.24 1.15 1.17 2.00 1.32 1.18 1.73 1.14 0.95 0.89 1.45 1.30 <0.001 0.033 0.046 <0.001 <0.001 0.058 <0.001 <0.001 <0.001 <0.001 0.004 <0.001 <0.001 <0.001 <0.001 0.7 1.6 0.8 1.9 0.6 0.7 16.3 5.7 1.7 2.7 0.4 3.3 1.9 0.4 2.0 3.7 7.0 7.6 5.6 5.3 2.2 5.4 8.4 8.2 9.9 22.1 27.5 13.1 10.6 13.5 2.4 11.4 6.3 10.6 2.9 1.6 87.3 47.9 13.7 27.1 8.5 90.2 24.8 4.4 27.1 0.347 0.363 0.510 0.053 0.488 0.506 0.023 0.039 0.020 0.032 0.389 0.014 0.215 0.247 0.103 NaN 5.9 1.4 3.3 0.7 0.6 6.1 3.7 24.0 6.4 1.5 26.5 10.4 NaN 5.7 0.94 3.36 1.06 0.95 0.98 1.88 2.58 1.72 1.16 2.71 0.95 1.48 1.72 0.90 3.20 <0.001 0.052 0.006 <0.001 <0.001 0.008 <0.001 0.001 <0.001 0.072 <0.001 0.003 0.002 <0.001 0.001 toma according to the results of microarray analy� sis in general were not in contradiction with SAGE results which showed some statistically nonsignifi� cant decrease of the expression for IGFBP1 or increase of the expression for IGFBP6 and IGFBP9 (Table 3). Results of the IGFBP genes expression analysis by RT�PCR were in a quite good concordance with SAGE and microarray data. Semi�quantitative RT�PCR confirmed statistically significant increa� sed expression of IGFBP2, IGFBP3, IGFBP4, IGFBP7, IGFBP8, and IGFBP10 genes in glioblas� toma (Fig. 6). Expression of IGFBP5 was increased too, although P = 0,072. RT�PCR revealed also increased expression of IGFBP1 gene in glioblas� toma and this 1,88�fold increase was statistically significant (Table 3). Unlike RT�PCR, SAGE and microarray analysis results showed not statistically significant decrease of IGFBP1 expression level in glioblastoma. Expression of IGFBP6 and IGFBP9 genes was not changed significantly in glioblas� toma according to the results of RT�PCR and this in general does not contradict to SAGE and microarray analysis, as mentioned above (Table 3). ІSSN 0564–3783. Цитология и генетика. 2011. № 5 47 Expression of genes belonging to the IGF�system in glial tumors Fig. 3. Analysis of IGF1 (a), IGF2 (b) and IGF1R (c) genes expression in glioblastoma and human normal brain by real� tyme RT�PCR. Samples of normal brain indicated by white bars, glioblastomas – by dark bars So, the expression of seven IGFBP genes (IGFBP2, IGFBP3, IGFBP4, IGFBP5, IGFBP7, IGFBP8, and IGFBP10) was increased in glioblas� tomas according to three methods used for the analysis. The results for IGFBP6 and IGFBP9 genes differ slightly for three methods, but there were no contrast differences between these results. It is necessary to note that gene expression differences found by microarray analysis were more statistical� ly significant: p�values were below the chosen threshold P < 0.05 for all genes analysed except IGFBP1. This may be explained by larger sample numbers in both glioblastoma and normal brain groups analysed by this method as compared to SAGE or RT�PCR. Discussion. The central role that the IGF sys� tem plays in initiating and promoting tumor pro� gression makes it an attractive target for cancer therapy. Various strategies have been used to target components of this system in established animal and human tumor cell lines and in animal models of cancer; some of these strategies may be advanc� ISSN 0564–3783. Цитология и генетика. 2011. № 548 V.V. Dmitrenko, V.M. Kavsan, O.I. Boyko et al. Fig. 4. Comparison of the relative expression levels of IGF2 gene in glioblastoma, anaplastic astrocytoma and human normal brain according to microarray analysis data from six DataSet files of GEO repository (are indicated below the bars in dia� gram). Data are presented for three probe sets of IGF2 gene located on microarrays: M17863 (a), NM_000612 (b) and X07868 (c). Samples of normal brain indicated by white bars, anaplastic astrocytomas – by grey bars, glioblastomas – by dark bars ing to clinical use. Among them IGF1 was target� ed by different strategies including IGF1 peptide analogues [30], antisense oligonucleotides [31] and triple helix�expressing vectors [32]. Although increased expression of IGF1, IGF2, IGF1R or combinations thereof have been docu� mented in various malignancies, these data show that while a correlation between IGF1/IGF2 expression levels and tumor progression could be consistently documented in some types of cancer (e.g. colorectal, hepatocellular and pancreatic car� cinomas), no consistent correlation was seen in others (e.g. breast cancer) [4]. Taken as a whole, these studies suggest that the IGF1 role in a paracrine and/or autocrine promoting tumor growth may vary depending on the tissue of origin. ІSSN 0564–3783. Цитология и генетика. 2011. № 5 49 Expression of genes belonging to the IGF�system in glial tumors Fig. 5. IGF2 expression in individual samples of glioblastoma, anaplastic astrocytoma and normal brain: a – expression profile for IGF2 gene (GeneBank: X07868) obtained on the basis of the experimental data from DataSet record GDS1962 of GEO repository, submitted by Sun et al. [24]; b – comparison of IGF2 expression in glioblastoma and normal brain samples. Samples of normal brain indicated by white bars, glioblastomas – by dark bars Moreover, in some cases, conflicting results were obtained in different studies that analysed the same types of malignant tumors (e.g. gliomas). The references on IGF1 gene expressions in glioblastoma are based on old papers, where authors used most� ly slot blot hybridization or immunohistochemistry on comparably small numbers of clinical samples [5–10]. Immunohistochemical studies themselves are not very convin�cing: authors only mention the expression of IGF1 in primary human astrocy� tomas [6] or write that IGFI mRNA can be seen in both astrocytoma and non malignant control human brain tissue [7]. The increased level of IGF1 expression was mostly at the margin of glioblastomas and in perivascular zone and so as it was explained by authors [8, 9], could not be seen when the total RNA from the whole tumor was taken for IGFI mRNA measurement. On the other hand, the expression of IGF1 gene in astrocytic tumors was not found when we used SAGE or analysed data from the GEO repository. These data show that IGF1 gene is expressed at a ISSN 0564–3783. Цитология и генетика. 2011. № 550 V.V. Dmitrenko, V.M. Kavsan, O.I. Boyko et al. Fig. 6. Semi�quantitative PCR�analysis of IGF system genes expression in glioblastomas and normal brain. Control gene, ACTB, was used to determine relative expression level of analyzed genes in indivdual samples. Tissue and tumor types are indicated above each lane of the electrophoresis, numbers are the conditional numbers of RNA samples. GB – glioblastoma, NB – human normal brain, K(–) – control reaction without cDNA low level in normal adult human brain and this level was not increased in glioblastoma. As it was mentioned above, other investigations also did not show the increased IGF1 gene expression in this tumor [9, 10]. Taking into account quite big number of samples and different methods used in present investigation, the results of this study indicate that increasing of IGF1 gene expression may be involved only in the formation of the limited part of astro� cytic gliomas. Although the IGF1 was proposed as one of targets for glial tumor therapy and was sup� posed to become the alternative treatment for human glioblastoma [33], our results show why the anti�IGF1 treatment may not give positive results with gliomas, supposing that the development of these tumors is activated by some other way. In contrast to IGF1, the expression of IGF2 gene is up�regulated in glioblastoma although its expression level is relatively low as it was found previously in our work [34] as well as in other pub� lications [35, 36]. Microarray analysis data show clearly the existence of the separate group of the glioblastomas overexpressing IGF2 gene. This is in agreement with the results of Soroceanu et al. [37] who found that among 165 primary high�grade astrocytomas, 13 % of glioblastomas and 2 % of anaplastic astrocytomas expressed IGF2 mRNA at the levels >50�fold the sample population median. Authors found that IGF2 can substitute for EGF to support the growth of glioblastoma�derived neurospheres and growth�promoting effects of IGF2 were mediated by the IGF1 receptor and phosphoinositide�3�kinase regulatory subunit 3 (PIK3R3), a regulatory subunit of PI3K. Survey of published data revealed only two old publications in which the author reported about the fourfold increase of IGF2 receptor, but not IGF1 receptor [38] or 2� to 5�fold higher cellular concentration of IGF2 receptor than the amount of IGF1 receptor [39]. Thus, IGF1 participation in cellular signaling pathways of glioblastoma may be substituted by IGF2 which may also stimulate both main signaling pathways, regulated by the extracellular signal�regulated kinase (ERK1/2) and protein kinase B�mediated (AKT). When viewed together, all studies concerning the role of IGFs and IGF1R expression levels per se as indicators of tumor stage or predicators of disease outcome defy simple generalization and may be highly tumor�type specific. However as dis� cussed above, the relevance of the IGF axis to can� cer progression cannot be fully estimated by analysis of the expression levels of the IGF1R and its lig� ands only, because activation of the signaling path� way may occur through alternative mechanisms that bypass the requirement for receptor and/or ligand upregulation. For example, product of chitinase 3� like 1 (CHI3L1, other names HC gp�39 or YKL�40) gene with significantly increased level in glioblas� toma [40] may also stimulate ERK1/2� and AKT� signaling pathways in a concentration range similar to the effective dose of IGF1. Just as IGF1, it acti� vates two signal cascades, regulated by ERK1/2 and AKT and associated with mitogenesis control [41]. Results of the analysis of IGFBP genes expres� sion in glioblastoma, obtained with three methods, demonstrate up�regulation of the majority IGFBPs in this tumor. Increased expression of IGFBP2 [21, 42–48], IGFBP3 [44, 47, 49, 50], IGFBP4 [21, 49], IGFBP5 [44, 48–50], IGFBP6 [21, 44, 49], IGFBP7 [51], and IGFBP8 [44] genes in glioblastoma was reported previously in the studies using microarray analysis. It was shown that overexpression of IGFBP5 gene correlates with the histological grade of human diffuse glioma: 83 % (58/70) of glioblas� tomas (WHO Grade IV) were immunopositive for IGFBP5, which was significantly higher than WHO Grade III gliomas (41 %, 41/101) or WHO Grade II gliomas (18 %, 13/72) (p < 0.001) [52]. Expression of IGFBP1 to IGFBP6 was analysed by PCR in glioblastoma cell lines T98G, A172, 86HG39 and U87MG and expression of IGFBP2� IGFBP6 was found in all cell lines [36]. Higher content of IGFBP1 mRNA in primary gliomas was demonstrated only in one work [53]. Authors found by RT�PCR that expression level of IGFBP1 gene did not depend on grade of tumor malignancy. Produced in tumor cells IGFBPs may stabilize insulin�like growth factor (s), IGF1 and/or IGF2, and drive their activation in glial tumors. On the other hand, some of the IGFBPs inhibit IGF actions or may act by a mechanism independent of IGFs, as reviewed by Mohan and Baylink [16]. It was documented that IGFBP1 increased migration of Chinese hamster ovary cells and trophoblast cells and affected apoptosis of breast cancer cells inde� pendently of IGF1 by activating α5β1 integrin– FAK–ILK–PI3�K–Akt signaling cascade [54]. Function of other inhibitory protein, IGFBP2, could be complex depending on the cell type and ІSSN 0564–3783. Цитология и генетика. 2011. № 5 51 Expression of genes belonging to the IGF�system in glial tumors cellular microenvironment. As reviewed by Fuku� shima and Kataoka [55], IGFBP2 has been con� sidered as an inhibitory factor of IGF actions, parti� cularly of IGF2, but binding of the IGFBP2/IGF complex to cellular surface proteoglycan may result in concentration of IGFs on the cell surface thus enhancing their actions. Authors supposed, that since binding of IGFs by IGFBP2 has growth�and/or migration�inhibitory effects, other mechanisms must be taken into account if attempt to find the correlation between overexpression of IGFBP2 and malignant phenotypes of glioblas� toma and proposed that IGFBP2 exerts influence on stimulation of cell proliferation and/or migra� tion in an IGF�independent manner. Other study supported this suggestion and provided definitive evidence that IGFBP2 plays a key role in activa� tion of the AKT pathway and collaborates with K� Ras or platelet derived growth factor B (PDGFB) in the development and progression of astrocytoma and oligodendroglioma [56]. IGFBP3 is known to block IGF action and inhibit cell growth. In addition, it possesses both growth�inhibitory and �potentiating effects on cells that are independent of IGF action and are medi� ated through specific IGFBP3 binding proteins/ receptors located at the cell membrane, cytosol, or nuclear compartments and in the extracellular matrix. Transferrin and type I alpha collagen were characterized as these IGFBP3 binding proteins [57, 58]. IGFBP3 was found among hypoxia� induced genes by the comparison of gene expres� sion profiles of the U251 malignant glioma cell line under normoxic and hypoxic conditions, but the role of increased expression of IGFBP3 gene in glioma tumorigenesis is unclear [59]. It was revealed that IGFBP4, a negative modu� lator of IGF1, displayed IGF1�independent anti� angiogenic effect on glioblastoma cells in response to their treatment by dibutyryl cyclic AMP (dB� cAMP) [60]. IGFBP5 could also stimulate cell migration through interaction with cell surface heparin sul� fate proteoglycans and to determine cell fates by regulating apoptotic molecules (bax, bcl�2) and activating p38 MAP kinase and ERK 1/2 signal transduction pathways [61]. IGFBP6 is a relatively specific inhibitor of IGF2 actions. Overexpression of IGFBP6 inhibits tumor growth by inducing apoptosis and recently IGFBP6 was listed as a marker for cell senescence because it produces growth arrest with features of senescence but without the expression of cell dif� ferentiation markers [62]. IGFBP7 plays a negative role in the growth of cancer cells, including breast cancer, human prostate cancer, human cervical carcinoma (HeLa), murine embryonic carcinoma (P19), and osteosar� coma (Saos�2) cells [63]. Expression of IGFBP7 has been found to be up�regulated in human colorec� tal cancer and glioma cell lines and down�regulat� ed in prostate and breast cancer cells. IGFBP7 is exclusively associated with laminin�stained glioblas� toma vessels but was not observed in the vessels from nonmalignant brain [51]. IGFBP7 regulated glioma LN18 and LN443 cells proliferation and growth but not cell survival and promoted the migration of these cells through regulating the AKT (decreased phosphorylation) and ERK1/2 (enhan� ced phosphorylation) signal transductions [64]. IGFBP8(CTGF), IGFBP9(NOV) and IGFBP10 (CYR61) belong to the family of genes encoding CCN (cysteine�rich CYR61/CTGF/nephroblas� toma�overexpressed gene) proteins which has been shown to play an important role in many processes, including proliferation, migration, adhesion, extra� cellular matrix regulation, angiogenesis, tumorige� nesis, fibrosis, and implantation. CCN proteins share a modular structure and have in their N�ter� mini four conserved domains with sequence homologies to insulin�like growth factor binding proteins (IGFBPs) [65]. Expression of these three genes was analysed by real�time PCR in gliomas of different malignancy grades and normal human brain by Xie et al. [66]. Authors found enhanced expression of IGFBP8 (CCN2) in 31 and IGFBP10 (CCN1) in 27 from 40 glioblastomas analysed, while only 7 glioblastomas had high levels of IGFBP9 (CCN3) mRNA. Significant correlation existed between IGFBP8 and IGFBP10 mRNA levels with tumor grade and survival of glioblastoma patients , but statistical analysis showed no difference between the clinical and pathological features and expression level of IGFBP9 in gliomas. Results obtained in this work suggest that IGFBP8 and IGFBP10 may play some role in the progression of gliomas, but IGFBP9 is involved neither in their development nor progression. Furthermore, IGFBP9 had antipro� liferative activity and suppressed the growth of glioma cells [67]. It was shown that IGFBP8 (CTGF) ISSN 0564–3783. Цитология и генетика. 2011. № 552 V.V. Dmitrenko, V.M. Kavsan, O.I. Boyko et al. was associated with oncogenic activities and drug resistance in glioblastoma. Overexpression of IGFBP8 caused the U343 glioblastoma cells to survive for longer than 40 days in serum�free medium and resist antitumor drugs including tumor necrosis factor (TNF), TNF�related apop� tosis�inducing ligand, VELCADE (bortezomib, proteasome inhibitor) and temozolomide [68]. Xie et al. [69] demonstrated that IGFBP10 acts as an oncogene through the integrin�linked kinase (ILK) to stimulate β�catenin�TCF/LEF and AKT signaling pathways. Authors showed that forced expression of IGFBP10 in U343 glioblastoma cells accelerated their growth in liquid culture, enhanced their anchorage�independent prolifera� tion in soft agar, and significantly increased their ability to form tumors in nude mice. As a summary, we have shown that IGF1 gene expression is increased only in few cases of glioblastoma but predominantly it is not higher that in normal brain. IGF1 participation in cellu� lar signaling pathways of glioblastoma may be sub� stituted by increasing expression of IGF2 or IGF1R, which may also stimulate both main sig� naling pathways, regulated by ERK1/2 and AKT. Several other genes with significantly increased expression may also stimulate these pathways in glioblastoma. Up�regulated IGFBPs may activate IGF, even if the latters do not increase their expres� sion leading to the anti�apoptotic consequences in glial tumors. On the other hand, increased produc� tion of some IGFBPs leads to enhance their IGF� independent effects which may play an important role in the development of gliomas. Obtained results highlight the importance of viewing the IGF�related proteins as a complex multifactorial system and show that changes in the expression levels of any one component of the sys� tem, in a given malignancy, should be interpreted with caution. Similar to the experience with other biology�based therapies, effective targeting of the IGF system may require a customized approach, where tumor profiling guides the selection of the appropriate drugs. As targeting of the IGF�family members for anti�cancer therapy is rapidly becom� ing clinical reality, an understanding of this com� plexity is very timely. This work was supported in part by National Academy of Sciences of Ukraine in frames of the pro� gram «Fundamental grounds of molecular and cell biotechnologies» and by Science and Technology Center in Ukraine, project 4688. В.В. Дмитренко, В.М. Кавсан, О.И. Бойко, В.И. Рымарь, А.А. Степаненко, O.В. Балынская, Т.А. Малышева, В.Д. Розуменко, Ю.А. Зозуля ЭКСПРЕССИЯ ГЕНОВ, ОТНОСЯЩИХСЯ К IGF�СИСТЕМЕ, В ГЛИАЛЬНЫХ ОПУХОЛЯХ Повышенныe уровни экспрессии отдельных чле� нов семейства инсулиноподобных факторов роста (IGF) – IGF1 и IGF2, IGF�рецепторов, IGF�связыва� ющих белков или их комбинации были обнаружены в различных новообразованиях, включая глиомы. Ре� зультаты множественных исследований свидетельст� вуют о том, что инсулиноподобные факторы роста мо� гут стимулировать рост опухоли in situ аутокринным и/или паракринным способом, однако это действие может варьировать в зависимости от тканевого проис� хождения опухоли. Усилениe экспрессии гена IGF1 не было найдено в глиобластомах и предполагается, что участие IGF1 в развитии глиальных опухолей мо� жет быть замещено белковыми продуктами экспресси� рующихся на высоком уровне генов, также участвую� щими в cигнальных путях MAPK и PI3K. Повышенный уровень экспрессии генов IGF�связывающих белков (IGFBP) в опухолях головного мозга делает картину еще более сложной. Как и другие связывающие белки, IGFBP регулируют активность своих лигандов, прод� левая время их полужизни. B cтaтьe oбсуждаются про� тиворечивыe результаты, oпиcaнныe различными ла� бораториями для глиом. Пoлучeнныe данные демон� стрируют важность рассмотрения белков семейства инсулиноподобных факторов роста как сложную муль� тифункциональную систему и показывают, что изме� нения в уровне экспрессии любого компонента системы в упомянутой опухоли должны интерпретироваться с предосторожностью. В связи с тем, что выбор членoв IGF�ceмeйcтвa в качестве мишени для противоопухо� левой терапии быстро приобретает клиническую ре� альность, понимание сложноcти этой системы явля� ется весьма своевременным. В.В. Дмитренко, В.М. Кавсан, О.І. Бойко, В.І. Римар, О.А. Степаненко, O.В. Балинська, Т.А. Малишева, В.Д. Розуменко, Ю.П. Зозуля ЕКСПРЕСІЯ ГЕНІВ, ЩО НАЛЕЖАТЬ ДО IGF�СИСТЕМИ, У ГЛІАЛЬНИХ ПУХЛИНАХ Підвищений рівень експресії окремих членів роди� ни інсуліноподібних факторів росту (IGF) – IGF1 та IGF2, IGF�рецепторів, IGF�зв’язуючих білків або їхньої комбінації був знайдений у різних новоутворен� нях, включаючи гліоми. Результати множинних до� ІSSN 0564–3783. Цитология и генетика. 2011. № 5 53 Expression of genes belonging to the IGF�system in glial tumors сліджень свідчать про те, що інсуліноподібні фактори росту можуть стимулювaти ріст пухлини in situ ауто� кринним та/або паракринним способом, однак ця дія може варіювати в залежності від тканинного походжен� ня пухлини. Посилення експресії гена IGF1 не було знайдено в гліобластомах і передбачається, що участь IGF1 у розвитку гліальних пухлин може бути замінена білковими продуктами генів, що експресуються на високому рівні, які також приймають участь у cигналь� них шляхах MAPK та PI3K. Підвищений рівень екс� пресії генів IGF�зв’язуючих білків у пухлинах голов� ного мозку робить картину ще більш складною. Як і інші зв’язуючі білки, IGF�зв’язуючі білки регулюють активність своїх лігандів, продовжуючи час їхнього півжиття. У cтaттi oбговорюються суперечливi резуль� тати, опиcанi різними лабораторіями для гліом. Oтри� манi дані демонструють важливість розгляду білків ро� дини інсуліноподібних факторів росту як складну мультифункціональну систему і показують, що зміни рівня експресії будь�якого компонента системи у да� ній пухлині повинні інтерпретуватися із пересторо� гою. В зв’язку з тим, що вибір членiв IGF�ciмeйcтвa як мішені для протипухлинної терапії швидко набуває клінічної реальності, розуміння цієї системи є вельми своєчасним. REFERENCES 1. Friedrichs N., K�chler J., Endl E., Koch A., Czerwitzki J., Wurst P., Metzger D., Schulte J.H., Holst M.I., Heukamp L.C., Larsson O., Tanaka S., Kawai A., Wardelmann E., Buettner R., Pietsch T., Hartmann W. Insulin�like growth factor�1 receptor acts as a growth regulator in synovial sarcoma // J. Pathol. – 2008. – 216, № 4. – P. 428–439. 2. Eckstein N., Servan K., Hildebrandt B., P�litz A., von Jon� qui�res G., Wolf�K�mmeth S., Napierski I., Hamacher A., Kassack M.U., Budczies J., Beier M., Dietel M., Royer� Pokora B., Denkert C., Royer H.D. Hyperactivation of the insulin�like growth factor receptor I signaling path� way is an essential event for cisplatin resistance of ovarian cancer cells // Cancer Res. – 2009. – 69, № 7. – P. 2996– 3003. 3. Ma J., Sawai H., Matsuo Y., Ochi N., Yasuda A., Taka� hashi H., Wakasugi T., Funahashi H., Sato M., Takeya� ma H. IGF�1 mediates PTEN suppression and enhances cell invasion and proliferation via activation of the IGF�1/PI3K/Akt signaling pathway in pancreatic can� cer cells // J. Surg. Res. – 2010. – 160, № 1. – P. 90– 101. 4. Samani A.A., Yakar S., LeRoith D., Brodt P. The role of the IGF system in cancer growth and metastasis: overview and recent insights // Endocr. Rev. – 2007. – 28, № 1. – P. 20–47. 5. Sandberg A.C., Engberg C., Lake M., von Holst H., Sara V.R. The expression of insulin�like growth factor I and insulin�like growth factor II genes in the human fetal and adult brain and in glioma // Neurosci. Lett. – 1988. – 93, № 1. – P. 114–119. 6. Sandberg�Nordqvist A.C., Stahlbom P.A., Reinecke M., Collins V.P., von Holst H., Sara V. Characterization of insulin�like growth factor 1 in human primary brain tumors // Cancer Res. – 1993. – 53, № 11. – P. 2475– 2478. 7. Antoniades H.N., Galanopoulos T., Neville�Golden J., Maxwell M. Expression of insulin�like growth factors I and II and their receptor mRNAs in primary human astrocytomas and meningiomas; in vivo studies using in situ hybridization and immunocytochemistry // Int. J. Cancer. – 1992. – 50, № 2. – P. 215–222. 8. Hirano H., Lopes M.B., Laws Jr E.R., Asakura T., Goto M., Carpenter J.E., Karns L.R., Vanden Berg S.R. Insulin� like growth factor�1 content and pattern of expression correlates with histopathologic grade in diffusely infil� trating astrocytomas // Neuro Oncol. – 1999. – 1, № 2. – P. 109–119. 9. Lichtor T., Kurpakus M.A., Gurney M.E. Differential ex� pression of insulin�like growth factor II in human menin� giomas // Neurosurgery. – 1991. – 29, № 3. – P. 405– 409. 10. Glick R.P., Unterman T.G., Lacson R. Identification of insulin�like growth factor (IGF) and glucose trans� porter�1 and �3 mRNA in CNS tumors // Regul. Pept. – 1993. – 48, № 1/2. – P. 251–256. 11. Kavsan V., Shostak K., Dmitrenko V., Zozulya Y., Rozu� menko V., Demotes�Mainard J. Characterization of genes with increased expression in human glioblas� tomas // Cytol. Genet. – 2005. – 39, № 1. – P. 37–49. 12. De Tayrac M., Etcheverry A., Aubry M., Saїkali S., Hamlat A., Quillien V., Le Treut A., Galibert M.D., Mosser J. Integrative genome�wide analysis reveals a robust genomic glioblastoma signature associated with copy number driving changes in gene expression // Genes Chromosomes Cancer. – 2009. – 48, № 1. – P. 55–68. 13. Verhaak R.G., Hoadley K.A., Purdom E., Wang V., Qi Y., Wilkerson M.D., Miller C.R., Ding L., Golub T., Mesirov J.P., Alexe G., Lawrence M., O’Kelly M., Tamayo P., Weir B.A., Gabriel S., Winckler W., Gupta S., Jakkula L., Feiler H.S., Hodgson J.G., James C.D., Sarkaria J.N., Brennan C., Kahn A., Spellman P.T., Wilson R.K., Speed T.P., Gray J.W., Meyerson M., Getz G., Perou C.M., Hayes D.N. Cancer Genome Atlas Research Network. Integrated genomic analysis identifies clinically relevant subtypes of glioblastoma characterized by abnormalities in PDGFRA, IDH1, EGFR, and NF1 // Cancer Cell. – 2010. – 17, № 1. – P. 98–110. 14. Kim H.S., Nagalla S.R., Oh Y., Wilson E., Roberts C.T. Jr., Rosenfeld R.G. Identification of a family of low�affinity insulin�like growth factor binding proteins (IGFBPs): characterization of connective tissue growth factor as a member of the IGFBP superfamily // Proc. Natl. Acad. Sci. USA. – 1997. – 94, № 24. – P. 12981–12986. ISSN 0564–3783. Цитология и генетика. 2011. № 554 V.V. Dmitrenko, V.M. Kavsan, O.I. Boyko et al. 15. Collett�Solberg P.F., Cohen P. Genetics, chemistry, and function of the IGF/IGFBP system // Endocrine. – 2000. – 12, № 2. – P. 121–136. 16. Mohan S., Baylink D.J. IGF�binding proteins are mul� tifunctional and act via IGF�dependent and �inde� pendent mechanisms // J. Endocrinol. – 2002. – 175, № 1. – P. 19–31. 17. Louis D.N., Ohgaki H., Wiestler O.D., Cavenee W.K., Burger P.C., Jouvet A., Scheithauer B.W., Kleihues P. The 2007 WHO Classification of Tumours of the Central Nervous System // Acta Neuropathol. – 2007. – 114, № 2. – P. 97–109. 18. Kavsan V.M., Dmitrenko V.V., Shostak K.O., Bukreie� va T.V., Vitak N.Y., Simirenko O.E., Malisheva T.A., Sha� mayev M.I., Rozumenko V.D., Zozulya Y.A. Compa� rison of microarray and SAGE techniques in gene expression analysis of human glioblastoma // Cytol. Genet. – 2007. – 41, № 1. – P. 36–55. 19. Ritz C., Spiess A.N. qpcR: an R package for sigmoidal model selection in quantitative real�time polymerase chain reaction analysis // Bioinformatics. – 2008. – 24, № 13. – P. 1549–1551. 20. Livak K.J., Schmittgen T.D. Analysis of relative gene expression data using real�time quantitative PCR and the 2(�Delta Delta C (T)) method // Methods. – 2001. – 25, № 4. – P. 402–408. 21. Freije W.A., Castro�Vargas F.E., Fang Z., Horvath S., Cloughesy T., Liau L.M., Mischel P.S., Nelson S.F. Gene expression profiling of gliomas strongly predicts survival // Cancer Res. – 2004. – 64, № 18. – P. 6503–6510. 22. Phillips H.S., Kharbanda S., Chen R., Forrest W.F., Soriano R.H., Wu T.D., Misra A., Nigro J.M., Colman H., Soroceanu L., Williams P.M., Modrusan Z., Feuerstein B.G., Aldape K. Molecular subclasses of high�grade glioma predict prognosis, delineate a pattern of disease progression, and resemble stages in neurogenesis // Cancer Cell. – 2006. – 9, № 3. – P. 157–173. 23. Ge X., Yamamoto S., Tsutsumi S., Midorikawa Y., Ihara S., Wang S.M., Aburatani H. Interpreting expression pro� files of cancers by genome�wide survey of breadth of expression in normal tissues // Genomics. – 2005. – 86, № 2. – P. 127–141. 24. Sun L., Hui A.M., Su Q., Vortmeyer A., Kotliarov Y., Pastorino S., Passaniti A., Menon J., Walling J., Bailey R., Rosenblum M., Mikkelsen T., Fine H.A. Neuronal and glioma�derived stem cell factor induces angiogene� sis within the brain // Cancer Cell. – 2006. – 9, № 4. – P. 287–300. 25. Liu T., Papagiannakopoulos T., Puskar K., Qi S., Santiago F., Clay W., Lao K., Lee Y., Nelson S.F., Kornblum H.I., Doyle F., Petzold L., Shraiman B., Kosik K.S. Detection of a microRNA signal in an in vivo expression set of mRNAs // PLoS One. – 2007. – 2, № 8. – P. e804. 26. Su A.I., Wiltshire T., Batalov S., Lapp H., Ching K.A., Block D., Zhang J., Soden R., Hayakawa M., Kreiman G., Cooke M.P., Walker J.R., Hogenesch J.B. A gene atlas of the mouse and human protein�encoding transcrip� tomes // Proc. Natl. Acad. Sci. USA. – 2004. – 101, № 16. – P. 6062–6067. 27. Vandesompele J., De Preter K., Pattyn F., Poppe B., Van Roy N., De Paepe A., Speleman F. Accurate normaliza� tion of real�time quantitative RT�PCR data by geomet� ric averaging of multiple internal control genes // Genome Biol. – 2002. – 3, № 7. – P. RESEARCH0034. 28. Weroha S.J., Haluska P. IGF�1 receptor inhibitors in clinical trials – early lessons // J. Mammary Gland Biol. Neoplasia. – 2008. – 13, № 4. – P. 471–483. 29. Denley A., Wallace J.C., Cosgrove L.J., Forbes B.E. The insulin receptor isoform exon 11�(IR�A) in cancer and other diseases: a review // Horm. Metab. Res. – 2003. – 35, № 11/12. – P. 778–785. 30. Pietrzkowski Z., Mulholland G., Gomella L., Jameson B.A., Wernicke D., Baserga R. Inhibition of growth of prostatic cancer cell lines by peptide analogues of insulin�like growth factor 1 // Cancer Res. – 1993. – 53, № 5. – P. 1102–1106. 31. Rininsland F., Johnson T.R., Chernicky C.L., Schulze E., Burfeind P., Ilan J. Suppression of insulin�like growth factor type I receptor by a triple�helix strategy inhibits IGF�I transcription and tumorigenic potential of rat C6 glioblastoma cells // Proc. Natl. Acad. Sci. USA. – 1997. – 94, № 11. – P. 5854–5859. 32. Trojan J., Johnson T.R., Rudin S.D., Ilan J., Tykocinski M.L. Treatment and prevention of rat glioblastoma by immunogenic C6 cells expressing antisense insulin�like growth factor I RNA // Science. – 1993. – 259, № 5091. – P. 94–97. 33. Trojan J., Cloix J.F., Ardourel M.Y., Chatel M., Anthony D.D. Insulin�like growth factor type I biology and tar� geting in malignant gliomas // Neuroscience. – 2007. – 145, № 3. – P. 795–811. 34. Dmitrenko V.V., Bukreeva T.V., Shostak K.O., Vitak N.Y., Pekarsky Y.A., Malisheva T.A., Shamayev M.I., Rozumenko V.D., Kondratyuk V.V., Zozulya Y.P., Kavsan V.M. Extraordinary high content of mRNA of IGF�II�associated protein in meningiomas // Ukr. Biochem. J. – 2007. – 79, № 1. – P. 55–61. 35. Nordqvist A.C., Peyrard M., Pettersson H., Mathiesen T., Collins V.P., Dumanski J.P., Schalling M. A high ratio of insulin�like growth factor II/insulin�like growth factor binding protein 2 messenger RNA as a marker for anaplasia in meningiomas // Cancer Res. – 1997. – 57, № 13. – P. 2611–2614. 36. Schlenska�Lange A., Kn�pfer H., Lange T.J., Kiess W., Kn�pfer M. Cell proliferation and migration in glioblas� toma multiforme cell lines are influenced by insulin� like growth factor I in vitro // Anticancer Res. – 2008. – 28, № 2a. – P. 1055–1060. 37. Soroceanu L., Kharbanda S., Chen R., Soriano R.H., Aldape K., Misra A., Zha J., Forrest W.F., Nigro J.M., ІSSN 0564–3783. Цитология и генетика. 2011. № 5 55 Expression of genes belonging to the IGF�system in glial tumors Modrusan Z., Feuerstein B.G., Phillips H.S. Identification of IGF2 signaling through phosphoinositide�3�kinase regulatory subunit 3 as a growth�promoting axis in glioblastoma // Proc. Natl. Acad. Sci. USA. – 2007. – 104, № 9. – P. 3466–3471. 38. Sara V.R., Prisell P., Sj�gren B., Persson L., Boethius J., Enberg G. Enhancement of insulin�like growth factor 2 receptors in glioblastoma // Cancer Lett. – 1986. – 32, № 3. – P. 229–234. 39. Gammeltoft S., Ballotti R., Kowalski A., Westermark B., Van Obberghen E. Expression of two types of receptor for insulin�like growth factors in human malignant glioma // Cancer Res. – 1988. – 48, № 5. – P. 1233– 1237. 40. Shostak K., Labunskyy V., Dmitrenko V., Malisheva T., Shamayev M., Rozumenko V., Zozulya Y., Zehetner G., Kavsan V. HC gp�39 gene is upregulated in glioblas� tomas // Cancer Lett. – 2003. – 198, № 2. – P. 203– 210. 41. Recklies A.D., White C., Ling H. The chitinase 3�like protein human cartilage glycoprotein 39 (HC�gp39) stimulates proliferation of human connective�tissue cells and activates both extracellular signal�regulated kinase� and protein kinase B�mediated signalling path� ways // Biochem. J. – 2002. – 365, Pt 1. – P. 119–126. 42. Fuller G.N., Rhee C.H., Hess K.R., Caskey L.S., Wang R., Bruner J.M., Yung W.K., Zhang W. Reactivation of insulin�like growth factor binding protein 2 expression in glioblastoma multiforme: a revelation by parallel gene expression profiling // Cancer Res. – 1999. – 59, № 17. – P. 4228–4232. 43. Zhang W., Wang H., Song S.W., Fuller G.N. Insulin�like growth factor binding protein 2: gene expression microarrays and the hypothesis�generation paradigm // Brain Pathol. – 2002. – 12, № 1. – P. 87–94. 44. Sallinen S.L., Sallinen P.K., Haapasalo H.K., Helin H.J., Helen P.T., Schraml P., Kallioniemi O.P., Kononen J. Identification of differentially expressed genes in human gliomas by DNA microarray and tissue chip techniques // Cancer Res. – 2000. – 60, № 23. – P. 6617–6622. 45. Rickman D.S., Bobek M.P., Misek D.E., Kuick R., Blaivas M., Kurnit D.M., Taylor J., Hanash S.M. Distinctive molecular profiles of high�grade and low� grade gliomas based on oligonucleotide microarray analy� sis // Cancer Res. – 2001. – 61, № 18. – P. 6885– 6891. 46. Kim S., Dougherty E.R., Shmulevich I., Hess K.R., Hamil� ton S.R., Trent J.M., Fuller G.N., Zhang W. Identification of combination gene sets for glioma classification. // Mol. Cancer Ther. – 2002. – 1, № 13. – P. 1229– 1236. 47. Godard S., Getz G., Delorenzi M., Farmer P., Kobayashi H., Desbaillets I., Nozaki M., Diserens A.C., Hamou M.F., Dietrich P.Y., Regli L., Janzer R.C., Bucher P., Stupp R., De Tribolet N., Domany E., Hegi M.E. Classification of human astrocytic gliomas on the basis of gene expres� sion: a correlated group of genes with angiogenic activ� ity emerges as a strong predictor of subtypes // Cancer Res. – 2003. – 63, № 20. – P. 6613–6625. 48. Nigro J.M., Misra A., Zhang L., Smirnov I., Colman H., Griffin C., Ozburn N., Chen M., Pan E., Koul D., Yung W.K., Feuerstein B.G., Aldape K.D. Integrated array� comparative genomic hybridization and expression array profiles identify clinically relevant molecular sub� types of glioblastoma // Cancer Res. – 2005. – 65, № 5. – P. 1678–1686. 49. Markert J.M., Fuller C.M., Gillespie G.Y., Bubien J.K., McLean L.A., Hong R.L., Lee K., Gullans S.R., Mapstone T.B., Benos D.J. Differential gene expression profiling in human brain tumors // Physiol. Genom. – 2001. – 5, № 1. – P. 21–33. 50. Ljubimova J.Y., Lakhter A.J., Loksh A., Yong W.H., Riedinger M.S., Miner J.H., Sorokin L.M., Ljubimov A.V., Black K. Overexpression of alpha4 chain�con� taining laminins in human glial tumors identified by gene microarray analysis // Cancer Res. – 2001. – 61, № 14. – P. 5601–5610. 51. Pen A., Moreno M.J., Martin J., Stanimirovic D.B. Molecular markers of extracellular matrix remodeling in glioblastoma vessels: microarray study of laser�cap� tured glioblastoma vessels // Glia. – 2007. – 55, № 6. – P. 559–572. 52. Wang H., Wang H., Zhang W., Fuller G.N. Overexpression of IGFBP5, but not IGFBP3, correlates with the histo� logic grade of human diffuse glioma: a tissue microar� ray and immunohistochemical study // Technol. Cancer Res. Treat. – 2006. – 5, № 3. – P. 195–199. 53. Elmlinger M.W., Deininger M.H., Schuett B.S., Meyermann R., Duffner F., Grote E.H., Ranke M.B. In vivo expression of insulin�like growth factor�binding protein�2 in human gliomas increases with the tumor grade // Endocrinology. – 2001. – 142, № 4. – P. 1652– 1658. 54. Wheatcroft S.B., Kearney M.T. IGF�dependent and IGF� independent actions of IGF�binding protein�1 and �2: implications for metabolic homeostasis // Trends in Endocrinol. Metab. – 2009. – 20, № 4. – P. 153–162. 55. Fukushima T., Kataoka H. Roles of insulin�like growth factor binding protein�2 (IGFBP�2) in glioblastoma // Anticancer Res. – 2007. – 27, № 6A. – P. 3685–3692. 56. Dunlap S.M., Celestino J., Wang H., Jiang R., Holland E.C., Fuller G.N., Zhang W. Insulin�like growth factor binding protein 2 promotes glioma development and progression // Proc. Natl. Acad. Sci. USA. – 2007. – 104, № 28. – P. 11736–11741. 57. Weinzimer S.A., Gibson T.B., Collett�Solberg P.F., Khare A., Liu B., Cohen P. Transferrin is an insulin�like growth factor�binding protein�3 binding protein // J. Clin. Endocrinol. Metab. – 2001. – 86, № 4. – P. 1806– 1813. ISSN 0564–3783. Цитология и генетика. 2011. № 556 V.V. Dmitrenko, V.M. Kavsan, O.I. Boyko et al. 58. Liu B., Weinzimer S.A., Gibson T.B., Mascarenhas D., Cohen P. Type Ialpha collagen is an IGFBP�3 binding protein // Growth Horm. IGF Res. – 2003. – 13, № 2/3. – P. 89–97. 59. Ragel B.T., Couldwell W.T., Gillespie D.L., Jensen R.L. Identification of hypoxia�induced genes in a malignant glioma cell line (U�251) by cDNA microarray analysis // Neurosurg. Rev. – 2007. – 30, № 3. – P. 181–187. 60. Moreno M.J., Ball M., Andrade M.F., McDermid A., Stanimirovic D.B. Insulin�like growth factor binding protein�4 (IGFBP�4) is a novel anti�angiogenic and anti�tumorigenic mediator secreted by dibutyryl cyclic AMP (dB�cAMP)�differentiated glioblastoma cells // Glia. – 2006. – 53, № 8. – P. 845–857. 61. Akkiprik M., Hu L., Sahin A., Hao X., Zhang W. The subcellular localization of IGFBP5 affects its cell growth and migration functions in breast cancer // BMC Cancer. – 2009. – 9. – P. 103 62. Iosef C., Vilk G., Gkourasas T., Lee K.J., Chen B.P., Fu P., Bach L.A., Lajoie G., Gupta M.B., Li S.S., Han V.K. Insulin�like growth factor binding protein�6 (IGFBP� 6) interacts with DNA�end binding protein Ku80 to regulate cell fate // Cell Signal. – 2010. – 22, № 7. – P. 1033–1043. 63. Ruan W.J., Lin J., Xu E.P., Xu F.Y., Ma Y., Deng H., Huang Q., Lv B.J., Hu H., Cui J., Di M.J., Dong J.K., Lai M.D. IGFBP7 plays a potential tumor suppressor role against colorectal carcinogenesis with its expression associated with DNA hypomethylation of exon // J. Zhejiang Univ. Sci. B. – 2006. – 7, № 11. – P. 929–932. 64. Jiang W., Xiang C., Cazacu S., Brodie C., Mikkelsen T. Insulin�like growth factor binding protein 7 mediates glioma cell growth and migration // Neoplasia. – 2008. – 10, № 12. – P. 1335–1342. 65. Chen C.C., Lau L.F. Functions and mechanisms of action of CCN matricellular proteins // Int. J. Biochem. Cell Biol. – 2009. – 41, № 4. – P. 771–783. 66. Xie D., Yin D., Wang H.J., Liu G.T., Elashoff R., Black K., Koeffler H.P. Levels of expression of CYR61 and CTGF are prognostic for tumor progression and sur� vival of individuals with gliomas // Clin. Cancer Res. – 2004. – 10, № 6. – P. 2072–2081. 67. Bleau A.M., Planque N., Lazar N., Zambelli D., Ori A., Quan T., Fisher G., Scotlandi K., Perbal B. Antiprolife� rative activity of CCN3: involvement of the C�terminal module and post�translational regulation // J. Cell Biochem. – 2007. – 101, № 6. – P. 1475–1491. 68. Yin D., Chen W., O’Kelly J., Lu D., Ham M., Doan N.B., Xie D., Wang C., Vadgama J., Said J.W., Black K.L., Koeffler H.P. Connective tissue growth factor associated with oncogenic activities and drug resistance in glioblastoma multiforme // Int. J. Cancer. – 2010. – 127, № 10. – P. 2257–2267. 69. Xie D., Yin D., Tong X., O’Kelly J., Mori A., Miller C., Black K., Gui D., Said J.W., Koeffler H.P. Cyr61 is over� expressed in gliomas and involved in integrin�linked kinase�mediated Akt and beta�catenin�TCF/Lef sig� naling pathways // Cancer Res. – 2004. – 64, № 6. – P. 1987–1996. Received 17.03.11 ІSSN 0564–3783. Цитология и генетика. 2011. № 5 57 Expression of genes belonging to the IGF�system in glial tumors
id nasplib_isofts_kiev_ua-123456789-66864
institution Digital Library of Periodicals of National Academy of Sciences of Ukraine
issn 0564-3783
language English
last_indexed 2025-11-25T22:31:34Z
publishDate 2011
publisher Інститут клітинної біології та генетичної інженерії НАН України
record_format dspace
spelling Dmitrenko, V.V.
Kavsan, V.M.
Boyko, O.I.
Rymar, V.I.
Stepanenko, A.A.
Balynska, O.V.
Malisheva, T.A.
Rozumenko, V.D.
Zozulya, Y.P.
2014-07-23T18:47:32Z
2014-07-23T18:47:32Z
2011
Expression of genes belonging to the IGF-system in glial tumors / V.V. Dmitrenko, V.M. Kavsan, O.I. Boyko, V.I. Rymar, A.A. Stepanenko, O.V. Balynska, T.A. Malisheva, V.D. Rozumenko, Y.P. Zozulya // Цитология и генетика. — 2011. — Т. 45, № 4. — С. 41-57. — Бібліогр.: 69 назв. — англ.
0564-3783
https://nasplib.isofts.kiev.ua/handle/123456789/66864
577.21:577.214.622 + 616–006.484.04
The discrepancies arising from conflicting evidence on the results obtained by different laboratories in human gliomas are discussed. Our data highlight the importance of viewing the IGF-related proteins as a complex multifactorial system and show that changes in the expression levels of any one component of the system, in a given malignancy, should be interpreted with caution. As IGF targeting for anticancer therapy is rapidly becoming clinical reality, an understanding of this complexity is very timely.
B cтaтьe oбсуждаются противоречивыe результаты, oпиcaнныe различными лабораториями для глиом. Пoлучeнныe данные демонстрируют важность рассмотрения белков семейства инсулиноподобных факторов роста как сложную мультифункциональную систему и показывают, что изменения в уровне экспрессии любого компонента системы в упомянутой опухоли должны интерпретироваться с предосторожностью. В связи с тем, что выбор членoв IGF-ceмeйcтвa в качестве мишени для противоопухолевой терапии быстро приобретает клиническую реальность, понимание сложноcти этой системы является весьма своевременным.
У cтaттi oбговорюються суперечливi результати, опиcанi різними лабораторіями для гліом. Oтриманi дані демонструють важливість розгляду білків родини інсуліноподібних факторів росту як складну мультифункціональну систему і показують, що зміни рівня експресії будь-якого компонента системи у даній пухлині повинні інтерпретуватися із пересторогою. В зв’язку з тим, що вибір членiв IGF-ciмeйcтвa як мішені для протипухлинної терапії швидко набуває клінічної реальності, розуміння цієї системи є вельми своєчасним.
en
Інститут клітинної біології та генетичної інженерії НАН України
Цитология и генетика
Оригинальные работы
Expression of genes belonging to the IGF-system in glial tumors
Экспрессия генов, относящихся к IGF-системе, в глиальных опухолях
Експресія генів, що належать до IGF-системи, у гліальних пухлинах
Article
published earlier
spellingShingle Expression of genes belonging to the IGF-system in glial tumors
Dmitrenko, V.V.
Kavsan, V.M.
Boyko, O.I.
Rymar, V.I.
Stepanenko, A.A.
Balynska, O.V.
Malisheva, T.A.
Rozumenko, V.D.
Zozulya, Y.P.
Оригинальные работы
title Expression of genes belonging to the IGF-system in glial tumors
title_alt Экспрессия генов, относящихся к IGF-системе, в глиальных опухолях
Експресія генів, що належать до IGF-системи, у гліальних пухлинах
title_full Expression of genes belonging to the IGF-system in glial tumors
title_fullStr Expression of genes belonging to the IGF-system in glial tumors
title_full_unstemmed Expression of genes belonging to the IGF-system in glial tumors
title_short Expression of genes belonging to the IGF-system in glial tumors
title_sort expression of genes belonging to the igf-system in glial tumors
topic Оригинальные работы
topic_facet Оригинальные работы
url https://nasplib.isofts.kiev.ua/handle/123456789/66864
work_keys_str_mv AT dmitrenkovv expressionofgenesbelongingtotheigfsysteminglialtumors
AT kavsanvm expressionofgenesbelongingtotheigfsysteminglialtumors
AT boykooi expressionofgenesbelongingtotheigfsysteminglialtumors
AT rymarvi expressionofgenesbelongingtotheigfsysteminglialtumors
AT stepanenkoaa expressionofgenesbelongingtotheigfsysteminglialtumors
AT balynskaov expressionofgenesbelongingtotheigfsysteminglialtumors
AT malishevata expressionofgenesbelongingtotheigfsysteminglialtumors
AT rozumenkovd expressionofgenesbelongingtotheigfsysteminglialtumors
AT zozulyayp expressionofgenesbelongingtotheigfsysteminglialtumors
AT dmitrenkovv ékspressiâgenovotnosâŝihsâkigfsistemevglialʹnyhopuholâh
AT kavsanvm ékspressiâgenovotnosâŝihsâkigfsistemevglialʹnyhopuholâh
AT boykooi ékspressiâgenovotnosâŝihsâkigfsistemevglialʹnyhopuholâh
AT rymarvi ékspressiâgenovotnosâŝihsâkigfsistemevglialʹnyhopuholâh
AT stepanenkoaa ékspressiâgenovotnosâŝihsâkigfsistemevglialʹnyhopuholâh
AT balynskaov ékspressiâgenovotnosâŝihsâkigfsistemevglialʹnyhopuholâh
AT malishevata ékspressiâgenovotnosâŝihsâkigfsistemevglialʹnyhopuholâh
AT rozumenkovd ékspressiâgenovotnosâŝihsâkigfsistemevglialʹnyhopuholâh
AT zozulyayp ékspressiâgenovotnosâŝihsâkigfsistemevglialʹnyhopuholâh
AT dmitrenkovv ekspresíâgenívŝonaležatʹdoigfsistemiuglíalʹnihpuhlinah
AT kavsanvm ekspresíâgenívŝonaležatʹdoigfsistemiuglíalʹnihpuhlinah
AT boykooi ekspresíâgenívŝonaležatʹdoigfsistemiuglíalʹnihpuhlinah
AT rymarvi ekspresíâgenívŝonaležatʹdoigfsistemiuglíalʹnihpuhlinah
AT stepanenkoaa ekspresíâgenívŝonaležatʹdoigfsistemiuglíalʹnihpuhlinah
AT balynskaov ekspresíâgenívŝonaležatʹdoigfsistemiuglíalʹnihpuhlinah
AT malishevata ekspresíâgenívŝonaležatʹdoigfsistemiuglíalʹnihpuhlinah
AT rozumenkovd ekspresíâgenívŝonaležatʹdoigfsistemiuglíalʹnihpuhlinah
AT zozulyayp ekspresíâgenívŝonaležatʹdoigfsistemiuglíalʹnihpuhlinah