2025-02-22T09:51:47-05:00 DEBUG: VuFindSearch\Backend\Solr\Connector: Query fl=%2A&wt=json&json.nl=arrarr&q=id%3A%22ujp2-article-2019074%22&qt=morelikethis&rows=5
2025-02-22T09:51:47-05:00 DEBUG: VuFindSearch\Backend\Solr\Connector: => GET http://localhost:8983/solr/biblio/select?fl=%2A&wt=json&json.nl=arrarr&q=id%3A%22ujp2-article-2019074%22&qt=morelikethis&rows=5
2025-02-22T09:51:47-05:00 DEBUG: VuFindSearch\Backend\Solr\Connector: <= 200 OK
2025-02-22T09:51:47-05:00 DEBUG: Deserialized SOLR response
Спектральнi властивостi фрагментiв теломери

Спектральнi властивостi фрагментiв теломери

The optical absorption and phosphorescence (at low temperatures) of a telomere fragment (oligonucleotide d(AGGGTTAGGGTTAGGGTTAGGG)) and (for comparing) the DNA macromolecule are investigated under various excitation wavelengths (240–300 nm). Two types of d(AGGGTTAGGGTTAGGGTTAGGG) samples were studie...

Full description

Saved in:
Bibliographic Details
Main Authors: Kudrya, V. Yu., Yashchuk, V. M., Dubey, I. Ya., Kovalyuk, K. I., Batsmanova, O. I., Mel’nik, V. I., Klishevich, G. V., Naumenko, A. P., Kudrya, Yu. M.
Format: Article
Language:English
Published: Publishing house "Academperiodika" 2019
Subjects:
optical absorption
phosphorescence
adenine chromophore
thymine chromophore
oligonucleotide d(AGGGTTAGGGTTAGGGTTAGGG)
-
Online Access:https://ujp.bitp.kiev.ua/index.php/ujp/article/view/2019074
Tags: Add Tag
No Tags, Be the first to tag this record!
Description
Summary:The optical absorption and phosphorescence (at low temperatures) of a telomere fragment (oligonucleotide d(AGGGTTAGGGTTAGGGTTAGGG)) and (for comparing) the DNA macromolecule are investigated under various excitation wavelengths (240–300 nm). Two types of d(AGGGTTAGGGTTAGGGTTAGGG) samples were studied: (1) the intact sample, and (2) the sample heated to 90 ∘C and studied immediately after heating. It is concluded that the main traps of triplet electronic excitations in both these samples of d(AGGGTTAGGGTTAGGGTTAGGG), as well as DNA, are the complexes formed by neighbor adenine (A) and thymine (T) chromophores from the same strand (not from complementary chromophores of the different strands).

Similar Items