Спектральнi властивостi фрагментiв теломери

The optical absorption and phosphorescence (at low temperatures) of a telomere fragment (oligonucleotide d(AGGGTTAGGGTTAGGGTTAGGG)) and (for comparing) the DNA macromolecule are investigated under various excitation wavelengths (240–300 nm). Two types of d(AGGGTTAGGGTTAGGGTTAGGG) samples were studie...

Повний опис

Збережено в:
Бібліографічні деталі
Дата:2019
Автори: Kudrya, V. Yu., Yashchuk, V. M., Dubey, I. Ya., Kovalyuk, K. I., Batsmanova, O. I., Mel’nik, V. I., Klishevich, G. V., Naumenko, A. P., Kudrya, Yu. M.
Формат: Стаття
Мова:Англійська
Опубліковано: Publishing house "Academperiodika" 2019
Онлайн доступ:https://ujp.bitp.kiev.ua/index.php/ujp/article/view/2019074
Теги: Додати тег
Немає тегів, Будьте першим, хто поставить тег для цього запису!
Назва журналу:Ukrainian Journal of Physics

Репозитарії

Ukrainian Journal of Physics
Опис
Резюме:The optical absorption and phosphorescence (at low temperatures) of a telomere fragment (oligonucleotide d(AGGGTTAGGGTTAGGGTTAGGG)) and (for comparing) the DNA macromolecule are investigated under various excitation wavelengths (240–300 nm). Two types of d(AGGGTTAGGGTTAGGGTTAGGG) samples were studied: (1) the intact sample, and (2) the sample heated to 90 ∘C and studied immediately after heating. It is concluded that the main traps of triplet electronic excitations in both these samples of d(AGGGTTAGGGTTAGGGTTAGGG), as well as DNA, are the complexes formed by neighbor adenine (A) and thymine (T) chromophores from the same strand (not from complementary chromophores of the different strands).
DOI:10.15407/ujpe61.06.0516