Спектральнi властивостi фрагментiв теломери

Спектральнi властивостi фрагментiв теломери

The optical absorption and phosphorescence (at low temperatures) of a telomere fragment (oligonucleotide d(AGGGTTAGGGTTAGGGTTAGGG)) and (for comparing) the DNA macromolecule are investigated under various excitation wavelengths (240–300 nm). Two types of d(AGGGTTAGGGTTAGGGTTAGGG) samples were studie...

Ausführliche Beschreibung

Gespeichert in:
Bibliographische Detailangaben
Datum:2019
Hauptverfasser: Kudrya, V. Yu., Yashchuk, V. M., Dubey, I. Ya., Kovalyuk, K. I., Batsmanova, O. I., Mel’nik, V. I., Klishevich, G. V., Naumenko, A. P., Kudrya, Yu. M.
Format: Artikel
Sprache:English
Veröffentlicht: Publishing house "Academperiodika" 2019
Online Zugang:https://ujp.bitp.kiev.ua/index.php/ujp/article/view/2019074
Tags: Tag hinzufügen
Keine Tags, Fügen Sie den ersten Tag hinzu!
Назва журналу:Ukrainian Journal of Physics

Institution

Ukrainian Journal of Physics
Beschreibung
Zusammenfassung:The optical absorption and phosphorescence (at low temperatures) of a telomere fragment (oligonucleotide d(AGGGTTAGGGTTAGGGTTAGGG)) and (for comparing) the DNA macromolecule are investigated under various excitation wavelengths (240–300 nm). Two types of d(AGGGTTAGGGTTAGGGTTAGGG) samples were studied: (1) the intact sample, and (2) the sample heated to 90 ∘C and studied immediately after heating. It is concluded that the main traps of triplet electronic excitations in both these samples of d(AGGGTTAGGGTTAGGGTTAGGG), as well as DNA, are the complexes formed by neighbor adenine (A) and thymine (T) chromophores from the same strand (not from complementary chromophores of the different strands).

Ähnliche Einträge