Спектральнi властивостi фрагментiв теломери
The optical absorption and phosphorescence (at low temperatures) of a telomere fragment (oligonucleotide d(AGGGTTAGGGTTAGGGTTAGGG)) and (for comparing) the DNA macromolecule are investigated under various excitation wavelengths (240–300 nm). Two types of d(AGGGTTAGGGTTAGGGTTAGGG) samples were studie...
Saved in:
| Date: | 2019 |
|---|---|
| Main Authors: | , , , , , , , , |
| Format: | Article |
| Language: | English |
| Published: |
Publishing house "Academperiodika"
2019
|
| Online Access: | https://ujp.bitp.kiev.ua/index.php/ujp/article/view/2019074 |
| Tags: |
Add Tag
No Tags, Be the first to tag this record!
|
| Journal Title: | Ukrainian Journal of Physics |
Institution
Ukrainian Journal of Physics| Summary: | The optical absorption and phosphorescence (at low temperatures) of a telomere fragment (oligonucleotide d(AGGGTTAGGGTTAGGGTTAGGG)) and (for comparing) the DNA macromolecule are investigated under various excitation wavelengths (240–300 nm). Two types of d(AGGGTTAGGGTTAGGGTTAGGG) samples were studied: (1) the intact sample, and (2) the sample heated to 90 ∘C and studied immediately after heating. It is concluded that the main traps of triplet electronic excitations in both these samples of d(AGGGTTAGGGTTAGGGTTAGGG), as well as DNA, are the complexes formed by neighbor adenine (A) and thymine (T) chromophores from the same strand (not from complementary chromophores of the different strands). |
|---|