Спектральнi властивостi фрагментiв теломери

The optical absorption and phosphorescence (at low temperatures) of a telomere fragment (oligonucleotide d(AGGGTTAGGGTTAGGGTTAGGG)) and (for comparing) the DNA macromolecule are investigated under various excitation wavelengths (240–300 nm). Two types of d(AGGGTTAGGGTTAGGGTTAGGG) samples were studie...

Ausführliche Beschreibung

Gespeichert in:
Bibliographische Detailangaben
Datum:2019
Hauptverfasser: Kudrya, V. Yu., Yashchuk, V. M., Dubey, I. Ya., Kovalyuk, K. I., Batsmanova, O. I., Mel’nik, V. I., Klishevich, G. V., Naumenko, A. P., Kudrya, Yu. M.
Format: Artikel
Sprache:English
Veröffentlicht: Publishing house "Academperiodika" 2019
Online Zugang:https://ujp.bitp.kiev.ua/index.php/ujp/article/view/2019074
Tags: Tag hinzufügen
Keine Tags, Fügen Sie den ersten Tag hinzu!
Назва журналу:Ukrainian Journal of Physics

Institution

Ukrainian Journal of Physics
id ujp2-article-2019074
record_format ojs
spelling ujp2-article-20190742019-04-17T14:56:58Z The Spectral Properties of the Telomere Fragments Спектральнi властивостi фрагментiв теломери Kudrya, V. Yu. Yashchuk, V. M. Dubey, I. Ya. Kovalyuk, K. I. Batsmanova, O. I. Mel’nik, V. I. Klishevich, G. V. Naumenko, A. P. Kudrya, Yu. M. optical absorption phosphorescence adenine chromophore thymine chromophore oligonucleotide d(AGGGTTAGGGTTAGGGTTAGGG) - The optical absorption and phosphorescence (at low temperatures) of a telomere fragment (oligonucleotide d(AGGGTTAGGGTTAGGGTTAGGG)) and (for comparing) the DNA macromolecule are investigated under various excitation wavelengths (240–300 nm). Two types of d(AGGGTTAGGGTTAGGGTTAGGG) samples were studied: (1) the intact sample, and (2) the sample heated to 90 ∘C and studied immediately after heating. It is concluded that the main traps of triplet electronic excitations in both these samples of d(AGGGTTAGGGTTAGGGTTAGGG), as well as DNA, are the complexes formed by neighbor adenine (A) and thymine (T) chromophores from the same strand (not from complementary chromophores of the different strands). У роботi наведенi результати дослiджень спектрiв оптичного поглинання та фосфоресценцiї (при низьких температурах) фрагмента теломери – олiгонуклеотида д(AГГГTTAГГГTTAГГГTTAГГГ) та (для порiвняння) макромолекули ДНК при рiзних довжинах хвиль збуджуючого свiтла (240–300 нм). Дослiджено два типи зразкiв д(AГГГTTAГГГTTAГГГTTAГГГ): (1) неушкоджений зразок та (2) зразок, нагрiтий до 90 ∘C. Зроблено висновок про те, що пасткою триплетних електронних збуджень в олiгонуклеотидi д(AГГГTTAГГГTTAГГГTTAГГГ), так само як i в ДНК, є комплекс, сформований мiж сусiднiми аденiновою (А) та тимiновою (Т) хромофорами з одного i того самого ланцюга (але не мiж вiдповiдними комплементарними хромофорами рiзних ланцюгiв). Publishing house "Academperiodika" 2019-01-06 Article Article Peer-reviewed Рецензована стаття application/pdf https://ujp.bitp.kiev.ua/index.php/ujp/article/view/2019074 10.15407/ujpe61.06.0516 Ukrainian Journal of Physics; Vol. 61 No. 6 (2016); 516 Український фізичний журнал; Том 61 № 6 (2016); 516 2071-0194 2071-0186 10.15407/ujpe61.06 en https://ujp.bitp.kiev.ua/index.php/ujp/article/view/2019074/965 Copyright (c) 2019 Bogolyubov Institute for Theoretical Physics, National Academy of Sciences of Ukraine
institution Ukrainian Journal of Physics
baseUrl_str
datestamp_date 2019-04-17T14:56:58Z
collection OJS
language English
topic_facet optical absorption
phosphorescence
adenine chromophore
thymine chromophore
oligonucleotide d(AGGGTTAGGGTTAGGGTTAGGG)
-
format Article
author Kudrya, V. Yu.
Yashchuk, V. M.
Dubey, I. Ya.
Kovalyuk, K. I.
Batsmanova, O. I.
Mel’nik, V. I.
Klishevich, G. V.
Naumenko, A. P.
Kudrya, Yu. M.
spellingShingle Kudrya, V. Yu.
Yashchuk, V. M.
Dubey, I. Ya.
Kovalyuk, K. I.
Batsmanova, O. I.
Mel’nik, V. I.
Klishevich, G. V.
Naumenko, A. P.
Kudrya, Yu. M.
Спектральнi властивостi фрагментiв теломери
author_facet Kudrya, V. Yu.
Yashchuk, V. M.
Dubey, I. Ya.
Kovalyuk, K. I.
Batsmanova, O. I.
Mel’nik, V. I.
Klishevich, G. V.
Naumenko, A. P.
Kudrya, Yu. M.
author_sort Kudrya, V. Yu.
title Спектральнi властивостi фрагментiв теломери
title_short Спектральнi властивостi фрагментiв теломери
title_full Спектральнi властивостi фрагментiв теломери
title_fullStr Спектральнi властивостi фрагментiв теломери
title_full_unstemmed Спектральнi властивостi фрагментiв теломери
title_sort спектральнi властивостi фрагментiв теломери
title_alt The Spectral Properties of the Telomere Fragments
description The optical absorption and phosphorescence (at low temperatures) of a telomere fragment (oligonucleotide d(AGGGTTAGGGTTAGGGTTAGGG)) and (for comparing) the DNA macromolecule are investigated under various excitation wavelengths (240–300 nm). Two types of d(AGGGTTAGGGTTAGGGTTAGGG) samples were studied: (1) the intact sample, and (2) the sample heated to 90 ∘C and studied immediately after heating. It is concluded that the main traps of triplet electronic excitations in both these samples of d(AGGGTTAGGGTTAGGGTTAGGG), as well as DNA, are the complexes formed by neighbor adenine (A) and thymine (T) chromophores from the same strand (not from complementary chromophores of the different strands).
publisher Publishing house "Academperiodika"
publishDate 2019
url https://ujp.bitp.kiev.ua/index.php/ujp/article/view/2019074
work_keys_str_mv AT kudryavyu thespectralpropertiesofthetelomerefragments
AT yashchukvm thespectralpropertiesofthetelomerefragments
AT dubeyiya thespectralpropertiesofthetelomerefragments
AT kovalyukki thespectralpropertiesofthetelomerefragments
AT batsmanovaoi thespectralpropertiesofthetelomerefragments
AT melnikvi thespectralpropertiesofthetelomerefragments
AT klishevichgv thespectralpropertiesofthetelomerefragments
AT naumenkoap thespectralpropertiesofthetelomerefragments
AT kudryayum thespectralpropertiesofthetelomerefragments
AT kudryavyu spektralʹnivlastivostifragmentivtelomeri
AT yashchukvm spektralʹnivlastivostifragmentivtelomeri
AT dubeyiya spektralʹnivlastivostifragmentivtelomeri
AT kovalyukki spektralʹnivlastivostifragmentivtelomeri
AT batsmanovaoi spektralʹnivlastivostifragmentivtelomeri
AT melnikvi spektralʹnivlastivostifragmentivtelomeri
AT klishevichgv spektralʹnivlastivostifragmentivtelomeri
AT naumenkoap spektralʹnivlastivostifragmentivtelomeri
AT kudryayum spektralʹnivlastivostifragmentivtelomeri
AT kudryavyu spectralpropertiesofthetelomerefragments
AT yashchukvm spectralpropertiesofthetelomerefragments
AT dubeyiya spectralpropertiesofthetelomerefragments
AT kovalyukki spectralpropertiesofthetelomerefragments
AT batsmanovaoi spectralpropertiesofthetelomerefragments
AT melnikvi spectralpropertiesofthetelomerefragments
AT klishevichgv spectralpropertiesofthetelomerefragments
AT naumenkoap spectralpropertiesofthetelomerefragments
AT kudryayum spectralpropertiesofthetelomerefragments
first_indexed 2025-10-02T01:15:45Z
last_indexed 2025-10-02T01:15:45Z
_version_ 1851765162106683392