2025-02-22T10:12:27-05:00 DEBUG: VuFindSearch\Backend\Solr\Connector: Query fl=%2A&wt=json&json.nl=arrarr&q=id%3A%22ujp2-article-2019074%22&qt=morelikethis&rows=5
2025-02-22T10:12:27-05:00 DEBUG: VuFindSearch\Backend\Solr\Connector: => GET http://localhost:8983/solr/biblio/select?fl=%2A&wt=json&json.nl=arrarr&q=id%3A%22ujp2-article-2019074%22&qt=morelikethis&rows=5
2025-02-22T10:12:27-05:00 DEBUG: VuFindSearch\Backend\Solr\Connector: <= 200 OK
2025-02-22T10:12:27-05:00 DEBUG: Deserialized SOLR response
Спектральнi властивостi фрагментiв теломери
The optical absorption and phosphorescence (at low temperatures) of a telomere fragment (oligonucleotide d(AGGGTTAGGGTTAGGGTTAGGG)) and (for comparing) the DNA macromolecule are investigated under various excitation wavelengths (240–300 nm). Two types of d(AGGGTTAGGGTTAGGGTTAGGG) samples were studie...
Saved in:
Main Authors: | , , , , , , , , |
---|---|
Format: | Article |
Language: | English |
Published: |
Publishing house "Academperiodika"
2019
|
Subjects: | |
Online Access: | https://ujp.bitp.kiev.ua/index.php/ujp/article/view/2019074 |
Tags: |
Add Tag
No Tags, Be the first to tag this record!
|