Спектральнi властивостi фрагментiв теломери
The optical absorption and phosphorescence (at low temperatures) of a telomere fragment (oligonucleotide d(AGGGTTAGGGTTAGGGTTAGGG)) and (for comparing) the DNA macromolecule are investigated under various excitation wavelengths (240–300 nm). Two types of d(AGGGTTAGGGTTAGGGTTAGGG) samples were studie...
Gespeichert in:
| Datum: | 2019 |
|---|---|
| Hauptverfasser: | , , , , , , , , |
| Format: | Artikel |
| Sprache: | Englisch |
| Veröffentlicht: |
Publishing house "Academperiodika"
2019
|
| Online Zugang: | https://ujp.bitp.kiev.ua/index.php/ujp/article/view/2019074 |
| Tags: |
Tag hinzufügen
Keine Tags, Fügen Sie den ersten Tag hinzu!
|
| Назва журналу: | Ukrainian Journal of Physics |
Institution
Ukrainian Journal of PhysicsSchreiben Sie den ersten Kommentar!