Спектральнi властивостi фрагментiв теломери
The optical absorption and phosphorescence (at low temperatures) of a telomere fragment (oligonucleotide d(AGGGTTAGGGTTAGGGTTAGGG)) and (for comparing) the DNA macromolecule are investigated under various excitation wavelengths (240–300 nm). Two types of d(AGGGTTAGGGTTAGGGTTAGGG) samples were studie...
Saved in:
| Date: | 2019 |
|---|---|
| Main Authors: | , , , , , , , , |
| Format: | Article |
| Language: | English |
| Published: |
Publishing house "Academperiodika"
2019
|
| Online Access: | https://ujp.bitp.kiev.ua/index.php/ujp/article/view/2019074 |
| Tags: |
Add Tag
No Tags, Be the first to tag this record!
|
| Journal Title: | Ukrainian Journal of Physics |
Institution
Ukrainian Journal of PhysicsBe the first to leave a comment!