Спектральнi властивостi фрагментiв теломери

• Date: 2019
• Main Authors: Kudrya, V. Yu., Yashchuk, V. M., Dubey, I. Ya., Kovalyuk, K. I., Batsmanova, O. I., Mel’nik, V. I., Klishevich, G. V., Naumenko, A. P., Kudrya, Yu. M.
• Format: Article
• Language: English
• Published: Publishing house "Academperiodika" 2019
• Online Access: https://ujp.bitp.kiev.ua/index.php/ujp/article/view/2019074
• Journal Title: Ukrainian Journal of Physics

The optical absorption and phosphorescence (at low temperatures) of a telomere fragment (oligonucleotide d(AGGGTTAGGGTTAGGGTTAGGG)) and (for comparing) the DNA macromolecule are investigated under various excitation wavelengths (240–300 nm). Two types of d(AGGGTTAGGGTTAGGGTTAGGG) samples were studie...