Спектральнi властивостi фрагментiв теломери
The optical absorption and phosphorescence (at low temperatures) of a telomere fragment (oligonucleotide d(AGGGTTAGGGTTAGGGTTAGGG)) and (for comparing) the DNA macromolecule are investigated under various excitation wavelengths (240–300 nm). Two types of d(AGGGTTAGGGTTAGGGTTAGGG) samples were studie...
Збережено в:
| Дата: | 2019 |
|---|---|
| Автори: | , , , , , , , , |
| Формат: | Стаття |
| Мова: | Англійська |
| Опубліковано: |
Publishing house "Academperiodika"
2019
|
| Онлайн доступ: | https://ujp.bitp.kiev.ua/index.php/ujp/article/view/2019074 |
| Теги: |
Додати тег
Немає тегів, Будьте першим, хто поставить тег для цього запису!
|
| Назва журналу: | Ukrainian Journal of Physics |
Репозитарії
Ukrainian Journal of Physics| _version_ | 1863131265457192960 |
|---|---|
| author | Kudrya, V. Yu. Yashchuk, V. M. Dubey, I. Ya. Kovalyuk, K. I. Batsmanova, O. I. Mel’nik, V. I. Klishevich, G. V. Naumenko, A. P. Kudrya, Yu. M. |
| author_facet | Kudrya, V. Yu. Yashchuk, V. M. Dubey, I. Ya. Kovalyuk, K. I. Batsmanova, O. I. Mel’nik, V. I. Klishevich, G. V. Naumenko, A. P. Kudrya, Yu. M. |
| author_sort | Kudrya, V. Yu. |
| baseUrl_str | https://ujp.bitp.kiev.ua/index.php/ujp/oai |
| collection | OJS |
| datestamp_date | 2019-04-17T14:56:58Z |
| description | The optical absorption and phosphorescence (at low temperatures) of a telomere fragment (oligonucleotide d(AGGGTTAGGGTTAGGGTTAGGG)) and (for comparing) the DNA macromolecule are investigated under various excitation wavelengths (240–300 nm). Two types of d(AGGGTTAGGGTTAGGGTTAGGG) samples were studied: (1) the intact sample, and (2) the sample heated to 90 ∘C and studied immediately after heating. It is concluded that the main traps of triplet electronic excitations in both these samples of d(AGGGTTAGGGTTAGGGTTAGGG), as well as DNA, are the complexes formed by neighbor adenine (A) and thymine (T) chromophores from the same strand (not from complementary chromophores of the different strands). |
| doi_str_mv | 10.15407/ujpe61.06.0516 |
| first_indexed | 2025-10-02T01:15:45Z |
| format | Article |
| id | ujp2-article-2019074 |
| institution | Ukrainian Journal of Physics |
| keywords_txt_mv | keywords |
| language | English |
| last_indexed | 2025-10-02T01:15:45Z |
| publishDate | 2019 |
| publisher | Publishing house "Academperiodika" |
| record_format | ojs |
| spelling | ujp2-article-20190742019-04-17T14:56:58Z The Spectral Properties of the Telomere Fragments Спектральнi властивостi фрагментiв теломери Kudrya, V. Yu. Yashchuk, V. M. Dubey, I. Ya. Kovalyuk, K. I. Batsmanova, O. I. Mel’nik, V. I. Klishevich, G. V. Naumenko, A. P. Kudrya, Yu. M. optical absorption phosphorescence adenine chromophore thymine chromophore oligonucleotide d(AGGGTTAGGGTTAGGGTTAGGG) - The optical absorption and phosphorescence (at low temperatures) of a telomere fragment (oligonucleotide d(AGGGTTAGGGTTAGGGTTAGGG)) and (for comparing) the DNA macromolecule are investigated under various excitation wavelengths (240–300 nm). Two types of d(AGGGTTAGGGTTAGGGTTAGGG) samples were studied: (1) the intact sample, and (2) the sample heated to 90 ∘C and studied immediately after heating. It is concluded that the main traps of triplet electronic excitations in both these samples of d(AGGGTTAGGGTTAGGGTTAGGG), as well as DNA, are the complexes formed by neighbor adenine (A) and thymine (T) chromophores from the same strand (not from complementary chromophores of the different strands). У роботi наведенi результати дослiджень спектрiв оптичного поглинання та фосфоресценцiї (при низьких температурах) фрагмента теломери – олiгонуклеотида д(AГГГTTAГГГTTAГГГTTAГГГ) та (для порiвняння) макромолекули ДНК при рiзних довжинах хвиль збуджуючого свiтла (240–300 нм). Дослiджено два типи зразкiв д(AГГГTTAГГГTTAГГГTTAГГГ): (1) неушкоджений зразок та (2) зразок, нагрiтий до 90 ∘C. Зроблено висновок про те, що пасткою триплетних електронних збуджень в олiгонуклеотидi д(AГГГTTAГГГTTAГГГTTAГГГ), так само як i в ДНК, є комплекс, сформований мiж сусiднiми аденiновою (А) та тимiновою (Т) хромофорами з одного i того самого ланцюга (але не мiж вiдповiдними комплементарними хромофорами рiзних ланцюгiв). Publishing house "Academperiodika" 2019-01-06 Article Article Peer-reviewed Рецензована стаття application/pdf https://ujp.bitp.kiev.ua/index.php/ujp/article/view/2019074 10.15407/ujpe61.06.0516 Ukrainian Journal of Physics; Vol. 61 No. 6 (2016); 516 Український фізичний журнал; Том 61 № 6 (2016); 516 2071-0194 2071-0186 10.15407/ujpe61.06 en https://ujp.bitp.kiev.ua/index.php/ujp/article/view/2019074/965 Copyright (c) 2019 Bogolyubov Institute for Theoretical Physics, National Academy of Sciences of Ukraine |
| spellingShingle | Kudrya, V. Yu. Yashchuk, V. M. Dubey, I. Ya. Kovalyuk, K. I. Batsmanova, O. I. Mel’nik, V. I. Klishevich, G. V. Naumenko, A. P. Kudrya, Yu. M. Спектральнi властивостi фрагментiв теломери |
| title | Спектральнi властивостi фрагментiв теломери |
| title_alt | The Spectral Properties of the Telomere Fragments |
| title_full | Спектральнi властивостi фрагментiв теломери |
| title_fullStr | Спектральнi властивостi фрагментiв теломери |
| title_full_unstemmed | Спектральнi властивостi фрагментiв теломери |
| title_short | Спектральнi властивостi фрагментiв теломери |
| title_sort | спектральнi властивостi фрагментiв теломери |
| topic_facet | optical absorption phosphorescence adenine chromophore thymine chromophore oligonucleotide d(AGGGTTAGGGTTAGGGTTAGGG) - |
| url | https://ujp.bitp.kiev.ua/index.php/ujp/article/view/2019074 |
| work_keys_str_mv | AT kudryavyu thespectralpropertiesofthetelomerefragments AT yashchukvm thespectralpropertiesofthetelomerefragments AT dubeyiya thespectralpropertiesofthetelomerefragments AT kovalyukki thespectralpropertiesofthetelomerefragments AT batsmanovaoi thespectralpropertiesofthetelomerefragments AT melnikvi thespectralpropertiesofthetelomerefragments AT klishevichgv thespectralpropertiesofthetelomerefragments AT naumenkoap thespectralpropertiesofthetelomerefragments AT kudryayum thespectralpropertiesofthetelomerefragments AT kudryavyu spektralʹnivlastivostifragmentivtelomeri AT yashchukvm spektralʹnivlastivostifragmentivtelomeri AT dubeyiya spektralʹnivlastivostifragmentivtelomeri AT kovalyukki spektralʹnivlastivostifragmentivtelomeri AT batsmanovaoi spektralʹnivlastivostifragmentivtelomeri AT melnikvi spektralʹnivlastivostifragmentivtelomeri AT klishevichgv spektralʹnivlastivostifragmentivtelomeri AT naumenkoap spektralʹnivlastivostifragmentivtelomeri AT kudryayum spektralʹnivlastivostifragmentivtelomeri AT kudryavyu spectralpropertiesofthetelomerefragments AT yashchukvm spectralpropertiesofthetelomerefragments AT dubeyiya spectralpropertiesofthetelomerefragments AT kovalyukki spectralpropertiesofthetelomerefragments AT batsmanovaoi spectralpropertiesofthetelomerefragments AT melnikvi spectralpropertiesofthetelomerefragments AT klishevichgv spectralpropertiesofthetelomerefragments AT naumenkoap spectralpropertiesofthetelomerefragments AT kudryayum spectralpropertiesofthetelomerefragments |