Спектральнi властивостi фрагментiв теломери

The optical absorption and phosphorescence (at low temperatures) of a telomere fragment (oligonucleotide d(AGGGTTAGGGTTAGGGTTAGGG)) and (for comparing) the DNA macromolecule are investigated under various excitation wavelengths (240–300 nm). Two types of d(AGGGTTAGGGTTAGGGTTAGGG) samples were studie...

Full description

Saved in:
Bibliographic Details
Date:2019
Main Authors: Kudrya, V. Yu., Yashchuk, V. M., Dubey, I. Ya., Kovalyuk, K. I., Batsmanova, O. I., Mel’nik, V. I., Klishevich, G. V., Naumenko, A. P., Kudrya, Yu. M.
Format: Article
Language:English
Published: Publishing house "Academperiodika" 2019
Online Access:https://ujp.bitp.kiev.ua/index.php/ujp/article/view/2019074
Tags: Add Tag
No Tags, Be the first to tag this record!
Journal Title:Ukrainian Journal of Physics

Institution

Ukrainian Journal of Physics
_version_ 1863131265457192960
author Kudrya, V. Yu.
Yashchuk, V. M.
Dubey, I. Ya.
Kovalyuk, K. I.
Batsmanova, O. I.
Mel’nik, V. I.
Klishevich, G. V.
Naumenko, A. P.
Kudrya, Yu. M.
author_facet Kudrya, V. Yu.
Yashchuk, V. M.
Dubey, I. Ya.
Kovalyuk, K. I.
Batsmanova, O. I.
Mel’nik, V. I.
Klishevich, G. V.
Naumenko, A. P.
Kudrya, Yu. M.
author_sort Kudrya, V. Yu.
baseUrl_str https://ujp.bitp.kiev.ua/index.php/ujp/oai
collection OJS
datestamp_date 2019-04-17T14:56:58Z
description The optical absorption and phosphorescence (at low temperatures) of a telomere fragment (oligonucleotide d(AGGGTTAGGGTTAGGGTTAGGG)) and (for comparing) the DNA macromolecule are investigated under various excitation wavelengths (240–300 nm). Two types of d(AGGGTTAGGGTTAGGGTTAGGG) samples were studied: (1) the intact sample, and (2) the sample heated to 90 ∘C and studied immediately after heating. It is concluded that the main traps of triplet electronic excitations in both these samples of d(AGGGTTAGGGTTAGGGTTAGGG), as well as DNA, are the complexes formed by neighbor adenine (A) and thymine (T) chromophores from the same strand (not from complementary chromophores of the different strands).
doi_str_mv 10.15407/ujpe61.06.0516
first_indexed 2025-10-02T01:15:45Z
format Article
id ujp2-article-2019074
institution Ukrainian Journal of Physics
keywords_txt_mv keywords
language English
last_indexed 2025-10-02T01:15:45Z
publishDate 2019
publisher Publishing house "Academperiodika"
record_format ojs
spelling ujp2-article-20190742019-04-17T14:56:58Z The Spectral Properties of the Telomere Fragments Спектральнi властивостi фрагментiв теломери Kudrya, V. Yu. Yashchuk, V. M. Dubey, I. Ya. Kovalyuk, K. I. Batsmanova, O. I. Mel’nik, V. I. Klishevich, G. V. Naumenko, A. P. Kudrya, Yu. M. optical absorption phosphorescence adenine chromophore thymine chromophore oligonucleotide d(AGGGTTAGGGTTAGGGTTAGGG) - The optical absorption and phosphorescence (at low temperatures) of a telomere fragment (oligonucleotide d(AGGGTTAGGGTTAGGGTTAGGG)) and (for comparing) the DNA macromolecule are investigated under various excitation wavelengths (240–300 nm). Two types of d(AGGGTTAGGGTTAGGGTTAGGG) samples were studied: (1) the intact sample, and (2) the sample heated to 90 ∘C and studied immediately after heating. It is concluded that the main traps of triplet electronic excitations in both these samples of d(AGGGTTAGGGTTAGGGTTAGGG), as well as DNA, are the complexes formed by neighbor adenine (A) and thymine (T) chromophores from the same strand (not from complementary chromophores of the different strands). У роботi наведенi результати дослiджень спектрiв оптичного поглинання та фосфоресценцiї (при низьких температурах) фрагмента теломери – олiгонуклеотида д(AГГГTTAГГГTTAГГГTTAГГГ) та (для порiвняння) макромолекули ДНК при рiзних довжинах хвиль збуджуючого свiтла (240–300 нм). Дослiджено два типи зразкiв д(AГГГTTAГГГTTAГГГTTAГГГ): (1) неушкоджений зразок та (2) зразок, нагрiтий до 90 ∘C. Зроблено висновок про те, що пасткою триплетних електронних збуджень в олiгонуклеотидi д(AГГГTTAГГГTTAГГГTTAГГГ), так само як i в ДНК, є комплекс, сформований мiж сусiднiми аденiновою (А) та тимiновою (Т) хромофорами з одного i того самого ланцюга (але не мiж вiдповiдними комплементарними хромофорами рiзних ланцюгiв). Publishing house "Academperiodika" 2019-01-06 Article Article Peer-reviewed Рецензована стаття application/pdf https://ujp.bitp.kiev.ua/index.php/ujp/article/view/2019074 10.15407/ujpe61.06.0516 Ukrainian Journal of Physics; Vol. 61 No. 6 (2016); 516 Український фізичний журнал; Том 61 № 6 (2016); 516 2071-0194 2071-0186 10.15407/ujpe61.06 en https://ujp.bitp.kiev.ua/index.php/ujp/article/view/2019074/965 Copyright (c) 2019 Bogolyubov Institute for Theoretical Physics, National Academy of Sciences of Ukraine
spellingShingle Kudrya, V. Yu.
Yashchuk, V. M.
Dubey, I. Ya.
Kovalyuk, K. I.
Batsmanova, O. I.
Mel’nik, V. I.
Klishevich, G. V.
Naumenko, A. P.
Kudrya, Yu. M.
Спектральнi властивостi фрагментiв теломери
title Спектральнi властивостi фрагментiв теломери
title_alt The Spectral Properties of the Telomere Fragments
title_full Спектральнi властивостi фрагментiв теломери
title_fullStr Спектральнi властивостi фрагментiв теломери
title_full_unstemmed Спектральнi властивостi фрагментiв теломери
title_short Спектральнi властивостi фрагментiв теломери
title_sort спектральнi властивостi фрагментiв теломери
topic_facet optical absorption
phosphorescence
adenine chromophore
thymine chromophore
oligonucleotide d(AGGGTTAGGGTTAGGGTTAGGG)
-
url https://ujp.bitp.kiev.ua/index.php/ujp/article/view/2019074
work_keys_str_mv AT kudryavyu thespectralpropertiesofthetelomerefragments
AT yashchukvm thespectralpropertiesofthetelomerefragments
AT dubeyiya thespectralpropertiesofthetelomerefragments
AT kovalyukki thespectralpropertiesofthetelomerefragments
AT batsmanovaoi thespectralpropertiesofthetelomerefragments
AT melnikvi thespectralpropertiesofthetelomerefragments
AT klishevichgv thespectralpropertiesofthetelomerefragments
AT naumenkoap thespectralpropertiesofthetelomerefragments
AT kudryayum thespectralpropertiesofthetelomerefragments
AT kudryavyu spektralʹnivlastivostifragmentivtelomeri
AT yashchukvm spektralʹnivlastivostifragmentivtelomeri
AT dubeyiya spektralʹnivlastivostifragmentivtelomeri
AT kovalyukki spektralʹnivlastivostifragmentivtelomeri
AT batsmanovaoi spektralʹnivlastivostifragmentivtelomeri
AT melnikvi spektralʹnivlastivostifragmentivtelomeri
AT klishevichgv spektralʹnivlastivostifragmentivtelomeri
AT naumenkoap spektralʹnivlastivostifragmentivtelomeri
AT kudryayum spektralʹnivlastivostifragmentivtelomeri
AT kudryavyu spectralpropertiesofthetelomerefragments
AT yashchukvm spectralpropertiesofthetelomerefragments
AT dubeyiya spectralpropertiesofthetelomerefragments
AT kovalyukki spectralpropertiesofthetelomerefragments
AT batsmanovaoi spectralpropertiesofthetelomerefragments
AT melnikvi spectralpropertiesofthetelomerefragments
AT klishevichgv spectralpropertiesofthetelomerefragments
AT naumenkoap spectralpropertiesofthetelomerefragments
AT kudryayum spectralpropertiesofthetelomerefragments